S1

Electronic Supplementary Information

for

Aptamer-mediated ‘turn-off/turn-on’ nanozyme

activity of gold nanoparticles for kanamycin detection

Tarun Kumar Sharma,a,b,

* Rajesh Ramanathan,a Pabudi Weerathunge,

a Mahsa

Mohammadtaheri,a Hemant Kumar Daima,

a,c Ravi Shukla

a and Vipul Bansal

a,*

aIan Potter NanoBioSensing Facility, NanoBiotechnology Research Laboratory, School of Applied

Science, RMIT University, GPO Box 2476V, Melbourne VIC 3001, Australia.

bCentre for Biodesign and Diagnostics, Translational Health Science and Technology Research Institute,

Gurgaon, Haryana 247667, India.

cDepartment of Biotechnology, Siddaganga Institute of Technology, Tumkur, Karnataka 572103, India.

*Email: vipul.bansal@rmit.edu.au (V. B.); tarun@thsti.res.in (T. K. S.)

Fax: +61 3 99253747; Tel: +61 3 99252121

Electronic Supplementary Material (ESI) for ChemComm.This journal is © The Royal Society of Chemistry 2014

S2

Experimental Details.

Materials. Gold (III) chloride (HAuCl4.3H2O), tyrosine, kanamycin, ampicillin, penicillin,

streptomycin and other reagents used in this study were procured from Sigma-Aldrich (St. Louis,

USA). Two component TMB kit containing 3,3,5,5-Tetramethylbenzidine (TMB) and H2O2 kit was

obtained from BD Bioscience and used as per the supplier’s protocol. The sequence for kanamycin

aptamer Ky2 [5’TGGGGGTTGAGGCTAAGCCGA3’] was obtained from a previous study.1 Ky2

aptamer and its three mutants viz. Ky2 M-1 [5’TGGGGGTTGAAACTAAGCCGA3’], Ky2 M-2

[5’TGGGGGGTGAGGCTACGCCGA3’] and Ky2 M3 [5’TGGGGGTTTTTTTTTAGCCGA3’] were

custom-synthesised through Integrated DNA Technologies (IDT, USA). Notably, in Ky2 M-1, GG

sequence in the Ky2 aptamer loop was mutated to AA; in Ky2 M-2, AT sequence in the original stem

was mutated to GC; while in Ky2 M-3, all nucleotides in the original loop region were replaced with T.

These mutations allowed the importance of nucleotides present in the Ky2 aptamer’s loop as well as

stem regions in kanamycin sensing to be systematically studied.

Synthesis of gold nanoparticles (GNPs). GNPs were synthesised using tyrosine amino acid as a

reducing and capping agent, as elaborated in our previous studies.2,3

Briefly, 300 mL aqueous solution

comprising of 0.1 mM L-tyrosine and 0.1 mM KOH were allowed to boil. Under alkaline boiling

conditions, 0.2 mM equivalent of [AuCl4]- ions were added to the above solution with subsequent

boiling for further 5 min. This resulted in a ruby-red coloured solution consisting of GNPs. To prepare

concentrated GNP solution, as-synthesised nanoparticles were boiled to reduce the volume to 30 mL.

These colloidal solutions were found to be highly stable even after concentration, signifying the

strong tyrosine capping. Further, concentrated solution of GNPs was dialysed overnight against

deionised MilliQ water using 12 kDa molecular weight cut-off cellulose dialysis membranes, followed

by exchange of water twice to remove the excess amount of KOH, potentially unreduced metal ions

and unbound tyrosine, if any. The concentration of gold in GNPs was determined using atomic

absorption spectroscopy (Varian) after digesting GNPs in aqua-regia, followed by preparation of an

aqueous GNP stock solution with 1 mM equivalent of gold. This GNP solution was further used for

characterisation and subsequent biosensing experiments.

Materials characterisation. The homogeneous colloidal solution obtained after removal of unbound

amino acids and ions was characterized by UV−visible absorbance spectroscopy using Envision

multilabel plate reader (PerkinElmer). The samples for transmission electron microscopy (TEM) were

prepared by drop-coating the solutions on to carbon-coated copper grids, followed by TEM

measurements using a JEOL 1010 TEM instrument operated at an accelerating voltage of 100 kV.

S3

Dynamic light scattering (DLS) measurements on different GNP solutions were carried out using a

Malvern Nano-Zs/Zen3600 zetasizer instrument.

Functionalisation of GNPs with Ky2 aptamer and its mutants. It has been well-established that in

the presence of GNPs, ssDNA can uncoil sufficiently due to the structural flexibility exposing its

nitrogenous bases to GNPs, whereas dsDNA presents its negatively charged phosphate backbone to the

surface of GNPs due to its stable double helical geometry.4 Therefore, the coordination interaction

between the nitrogenous bases of the unfolded ssDNA and GNPs is stronger than the electrostatic

repulsion between the negatively charged phosphate backbone of dsDNA and GNPs. This concept has

also been previously employed for conductometric detection of DNA hybridization by exploiting the

self-catalytic glucose oxidase-like activity of GNPs.5 In the current study, similar concept was utilised

for efficient non-covalent adsorption of ssDNA Ky2 aptamer onto the GNP surface. For GNP-aptamer

binding, before incubation of Ky2 aptamer with GNPs, the appropriate secondary structure of Ky2 was

ascertained by its heat-treatment at 92 °C for 10 min, followed by snap-chilling on ice for 5 min and

bringing it back to room temperature. Following this, different concentrations of Ky2 aptamer (100-

750 nM) were incubated with a fixed concentration of GNPs (75 µM) for 10 min. In a similar manner,

the ability of three mutated versions of Ky2 aptamer viz. Ky2 M-1, Ky2 M-2 and Ky2 M3 to bind to

GNPs was also studied.

Biosensing of kanamycin using aptamer-conjugated GNPs. To achieve high sensitivity without

compromising specificity during biosensing, a number of experiments were performed to optimise

experimental parameters such as the concentration of Ky2 aptamer relative to GNP concentration, as

well as the reaction temperature. To determine the optimum temperature for peroxidase-like activity of

GNPs, in a 200 µL reaction volume, 75 µM GNPs were incubated with components provided in the

TMB kit as per the supplier’s (BD Biosciences) protocol, and activity was assessed at three different

temperatures (25, 37 and 55 ºC) after 8 min of reaction by measuring oxidation product of TMB

through UV-visible absorbance spectroscopy at 650 nm. Among these, 37 ºC showed the highest

degree of oxidation of TMB. Therefore all further experiments in the current study were performed at

37 ºC. The optimum concentration of Ky2 aptamer relative to GNP concentration was optimised by

incubating a range of aptamer concentrations (100-750 nM) with fixed concentration of GNPs (75 µM)

for 10 min, followed by addition of TMB and H2O2 in 200 µL reaction volume and evaluation of

peroxidase-like activity of aptamer-functionalised GNPs after 8 min. From above experiments, 500 nM

Ky2 aptamer concentration showed the highest inhibition of nanozyme activity of GNPs, beyond which

no further inhibition of activity was observed. Therefore all further experiments employed 500 nM Ky2

aptamer functionalised on to the surface of 75 µM GNPs at 37 ºC in 200 µL volume, either in the

S4

presence or absence of different analytes (kanamycin, ampicillin, penicillin and streptomycin). The

above experiments involving wild-type Ky2 aptamer conjugated on to GNPs were also performed in a

concentration- and time-dependent manner, wherein the influence of different concentrations of

analytes on peroxidase-like activity of Ky2-GNPs was studied as a function of time. In addition to the

spectroscopic examination, optical photographs of the reactions were also captured using a digital

camera (Canon) to allow a visual readout of the biosensing event. To further ascertain that GNP-Ky2

mediated kanamycin detection is governed by specific ssDNA sequence of Ky2 aptamer, control

experiments were performed under similar condition, wherein the kanamycin sensing performance of

GNPs functionalised with three mutated Ky2 aptamers viz. Ky2 M-1, Ky2 M-2 and Ky2 M-3 was

evaluated.

Determination of apparent dissociation constant (Kd) of Ky2 aptamer. To determine the Kd of

Ky2-kanamycin interaction, different concentrations of kanamycin (1-200 nM) were incubated with

GNP-Ky2 nanoconjugate prepared as per the aforementioned protocol. Peroxidase-like activity of these

nanoconjugates was monitored as a function of kanamycin concentration, which correlated to the

dissociation of Ky2 aptamer from GNP surface to allow aptamer-kanamycin interaction. The obtained

data was fitted using a Michaelis-Menten model and apparent dissociation constant (Kd) of kanamycin

with Ky2 aptamer was determined.

Evaluation of the biosensing performance of the proposed nanozyme assay. Important biosensor

parameters such as limit of detection (LoD), limit of quantification (LoQ), linearity, accuracy and

precision of the proposed assay were also determined. LoD was determined as quotient of 3.3*SD to S

whereas, LoQ was expressed as quotient of 10*SD to S, wherein SD corresponds to standard deviation

of y-intercepts and S is the slope of the specific calibration curve obtained from data in the linear range.

Since the response of biosensor to kanamycin followed a typical Michaelis-Menten behaviour, the

linearity of the biosensor was determined by plotting kanamycin concentration (x-axis) dependent

response (y-axis) in the form of a log-linear (x-y) curve. The accuracy and the precision of the proposed

biosensor were tested by exposing 5 nM kanamycin to the GNP-Ky2 nanoconjugates in 20 independent

experiments, followed by obtaining the sensor response. Thereafter, the % accuracy was calculated at

5% and 10% confidence interval levels as (n/N)*100, wherein n is the number of sensing events that

fall within the target concentration (5 nM) and N is the total number of test events. The % precision

was calculated by the coefficient of variation (CoV) method by using the formula %Precision = 100 -

%CoV.

S5

References

1 K. M. Song, M. Cho, H. Jo, K. Min, S. H. Jeon, T. Kim, M. S. Han, J. K. Ku and C. Ban, Anal.

Biochem., 2011, 415, 175–181

2 H. K. Daima, P. R. Selvakannan, R. Shukla, S. K. Bhargava and V. Bansal, PLoS ONE 2013, 8,

e79676.

3 P. R. Selvakannan, R. Ramanathan, B. J. Plowman, Y. M. Sabri, H. K. Daima, A. P. O'Mullane,

V. Bansal and S. K. Bhargava, Phys. Chem. Chem. Phys. 2013, 15, 12920-12929.

4 H. Li and L. Rothberg, Proc. Natl. Acad. Sci. U. S. A. 2004, 101, 14036-14039.

5 J. Zhang, H. Nie, Z. Wu, Z. Yang, L. Zhang, X. Xu and S. Huang. Anal. Chem. 2013, 86, 1178-

1185.

S6

Figure S1. Secondary structure of aptamer Ky2 as predicted by M-Fold tool based on Zuker algorithm.

S7

Figure S2. (a) UV-visible absorbance spectra, (b-d) TEM images, and (e) dynamic light scattering

measurements on (b) pristine GNPs, (c) Ky2 aptamer-bound GNPs and (d) Ky2 aptamer-bound GNPs

on exposure to kanamycin. Scale bars in TEM images correspond to 50 nm. The UV-visible

absorbance spectra of pristine GNPs, aptamer-functionalised GNPs before (GNP+Ky2) and after

kanamycin exposure (GNP+Ky2+Kan) show characteristic SPR peaks with maxima at ca. 520 nm,

confirming the stability of GNPs during aptamer functionalisation as well as in the presence of the

cognate target. Dynamic light scattering measurements reveal that while the hydrodynamic radius of

GNPs increases slightly after Ky2 functionalisation, the GNPs revert back to their original size on

exposure to aptamers’ cognate target kanamycin, indicating removal of aptamers from GNP surface in

the presence of kanamycin. TEM images further confirm that the adsorption of aptamers on the GNP

surface followed by aptamer desorption in the presence of the target does not lead to any aggregation.

S8

Figure S3. Effect of reaction temperature on peroxidase-like activity of GNPs. 37 °C is the most

optimum temperature that shows the highest peroxidase-like activity of GNPs.

S9

Figure S4. Effect of different concentrations of Ky2 aptamer exposed to 75 µM GNPs in reducing the

peroxidase-like activity of GNPs. 500 nM concentration of Ky2 aptamer is the optimum concentration

as it is the lowest concentration that causes the highest reduction in peroxidase activity.

S10

Figure S5. Chemical structures of different antibiotics (ampicillin, penicillin, streptomycin and

kanamycin) used in the current study.

S11

1 10 100

0

20

40

60

80

100

Nan

ozym

e a

cti

vit

y (

%)

Kanamycin concentration (nM)

Equation y = a + b*x

Pearson's r 0.99166

Adj. R-Square 0.98007

Value Standard Error

Nanozyme activity

Intercept 2.53319 3.59322

Slope 50.50494 2.93558

Figure S6. Log-linear response behaviour of GNP-Ky2 nanozyme activity between 1-100 nM

kanamycin concentrations. This data was used to determine the limit of detection (LoD) and the limit

of quantification (LoQ) of kanamycin detection using proposed assay. LoD was calculated using the

formula LoD = 3.3*(Standard Deviation of response in the linear range/Slope), whereas LoQ was

calculated using the formula LoQ = 10*(Standard Deviation of response in the linear range/Slope),

which gave the values of 1.49 nM and 4.52 nM, respectively.

S12

0 50 100 150 200

0

20

40

60

80

100

En

zym

e a

cti

vit

y (

%)

Kanamycin concentration (nM)

Model Michaelis-Menten

Equation y = Vmax * x / (Km + x)

Adj. R-Square 0.98934

Value Standard Error

Km 8.3814 0.71766

Figure S7. Peroxidase-like activity of GNP-Ky2 nanoconjugate in the presence of increasing

concentrations of kanamycin after subtracting the background response from GNP-Ky2 aptamer in the

absence of kanamycin. The fitted curve shows a typical Michaelis-Menten behaviour. Since the

nanozyme activity of GNP-Ky2 in the presence of kanamycin results from the dissociation of Ky2

aptamer from the GNP surface to interact with kanamycin, the Michaelis-Menten constant (Km =

8.3814 nM) represents the dissociation constant (Kd) of Ky2-kanamycin interaction.

S13

(A) Ky2 Wild 5’ T G G G G G T T G A G G C T A A G C C G A 3’

(B) Ky2 M-1 5’ T G G G G G T T G A A A C T A A G C C G A 3’

(C) Ky2 M-2 5’ T G G G G G G T G A G G C T A C G C C G A 3’

(D) Ky2 M-3 5’ T G G G G G T T T T T T T T T A G C C G A 3’

Figure S8. Change in peroxidase-like activity of GNPs after functionalisation with kanamycin-specific

Ky2 aptamer and three mutated forms of Ky2 aptamers (Ky2 M-1, Ky2 M-2 and Ky2 M-3). It is

evident that among four aptamer sequences, the wild-type Ky2 binds most strongly to GNP leading to

largest reduction in GNP nanozyme activity (middle bars in all the four panels). On exposure of these

four GNP-aptamer conjugates to 100 nM kanamycin, GNP-Ky2 (panel A, last bar) further shows

largest ‘switch-on’ of nanozyme activity, while other three GNP-aptamer systems so almost no

increase in activity (panels B-D, last bars). This supports that mutated forms of Ky2 aptamer lose their

affinity to kanamycin. The table above lists the nucleotide sequence of four aptamers utilised in this

study, wherein the ‘red’ text corresponds to mutated nucleotide w.r.t. Ky2 wild aptamer. Specifically,

in Ky2 M-1, GG sequence in the aptamer loop structure was mutated to AA; in Ky2 M-2, TA sequence

in the stem was mutated to GC; whereas in Ky2 M-3, all the nucleotides in the loop structure were

replaced with T. For the secondary structure of Ky2 wild type, please refer to Figure S1.