Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 1

In: Cleaved Amplified Polymorphic Sequences … ISBN: 978-1-63117-553-4

Editor: Yuri Shavrukov © 2014 Nova Science Publishers, Inc.

Chapter 3

APPLICATION OF CAPS MARKERS FOR GENOMIC

STUDIES IN WILD EMMER WHEAT

Dina Raats1, Elitsur Yaniv

1,4, Assaf Distelfeld

2, Roi Ben-David

3,

Johanna Shanir1, Valery Bocharova

1, Alan Schulman

4

and Tzion Fahima1*

1Institute of Evolution and Department of Evolutionary and Environmental Biology,

University of Haifa, Haifa 31905, Israel 2Faculty of Life Sciences, Department of Molecular Biology and Ecology of Plants, Tel

Aviv University, Tel Aviv 69978, Israel 3Institute of Plant Sciences, Department of Vegetable and Field crops, Agricultural

Research Organization (ARO)-Volcani Center, Bet Dagan 5025000, Israel 4MTT/BI Plant Genomics Lab, MTT Agrifood Research, Jokioinen, Finland; Institute of

Biotechnology, Viikki Biocenter, University of Helsinki, P.O. Box 65, Helsinki, Finland

ABSTRACT

Wild emmer wheat, Triticum dicoccoides, the tetraploid progenitor of domesticated

wheat, is a promising source for crop improvement. Wild wheat populations harbor broad

phenotypic diversity for numerous agronomic traits such as yield, grain quality, disease

resistance, tolerance to abiotic stresses, and phenological characters. Wheat is of great

societal and economic importance. However, it possesses a large and complex genome

due to polyploidy and a high proportion of repetitive DNA, making genomic analysis and

development of markers for wheat improvement a significant challenge. Single-

nucleotide polymorphisms (SNPs) are considered among the most reliable and

reproducible types of sequence-based genetic markers. SNP genotyping by cleaved

amplified polymorphic sequences (CAPS) and derived CAPS (dCAPS) markers are

commonly used to target specific chromosome regions in genetic and breeding projects.

However, the application of CAPS markers for genetic mapping in polyploid wheat is

* Corresponding author: Tel: +972-4-8240-784, Fax: +972-4-8288-602, Email: fahima@research.haifa.ac.il.

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 2

complicated by the presence of both paralogous and homoeologous gene copies.

Therefore, an essential part of any mapping strategy is the development of genome-

specific markers. Previously, the development of CAPS markers was based on very

limited resources such as wheat expressed sequence tags (EST) and syntenic information

from rice, making the allocation of loci on homoeologous genomes a very laborious task.

Nevertheless, CAPS markers served as a major tool for high-resolution genetic mapping

and QTL cloning of the high grain protein transcription factor Gpc-B1 and the slow-

rusting resistance gene, Yr36, derived from wild emmer wheat. The recent efforts to

develop whole-genome sequence and chromosome-specific bacterial artificial

chromosome (BAC) libraries have permitted the establishment of large-scale wheat

genomics resources. An increase in wheat sequence data and the sequencing of complete

model grass genomes, used to infer wheat gene content and order based on comparative

genomics, had a major impact on CAPS marker development. Gene isolation projects,

including the powdery mildew resistance genes PmG16 and PmG3M, as well as the stripe

rust resistance genes Yr15 and YrH52 derived from wild emmer wheat, are currently

underway. In these projects, the development of genome-specific CAPS primers is based

on comparisons of wheat genome survey sequence data of individually sorted

chromosome arms. Although high throughput development and genotyping of markers

has progressed significantly in wheat, CAPS markers remain the method of choice for

fine genetic dissection and positional cloning of genes derived from T. dicoccoides and

other species in the genus because they provide simple analysis of complex genomes.

INTRODUCTION

Wild emmer wheat, Triticum turgidum ssp. dicoccoides (Korn.) Thell (T. dicoccoides

hereafter), is a winter annual, predominantly self-pollinating, grass of the Poaceae family and

Triticeae tribe, which was discovered in northern Israel by Aaronsohn in 1906 (Aaronsohn,

1910). T. dicoccoides is considered to be the progenitor of both cultivated bread and durum

wheat (McFadden and Sears, 1946). Wild emmer is an allotetraploid species comprised of

two sub-genomes (AA and BB) with 2n = 4x = 28 chromosomes. The A genome of wild

emmer originated from T. urartu (AA genome, 2n = 14; Dvořák et al., 1993; Huang et al.,

2002) and the BB genome from an extinct member of the sitopsis section closely related to

Aegilops speltoides (SS genome, 2n = 14; Feldman et al., 1995). Both genomes (AA and BB)

evolved from a common ancestor about 2.5 to 4.5 million years ago and were fused back into

a common nucleus about 0.36 to 0.5 million years ago by a spontaneous amphiploidization

event (Dvorak and Akhunov, 2005; Huang et al., 2002). Wild emmer is fully compatible with

the tetraploid (AABB) durum wheat T. turgidum ssp. durum and can be crossed with the

hexaploid (AABBDD) bread wheat T. aestivum L. (Feldman and Sears, 1981). In many crop

species, the domestication process resulted in a population bottleneck (Buckler et al., 2001)

that drastically decreased the gene pool of the domesticated populations; many alleles, or

gene variants, that were present in the original progenitor populations were lost. In particular,

the small initial population sizes and intense human selection for agronomic traits have

decreased the available genetic diversity of domesticated wheat, making it more sensitive to

biotic and abiotic stresses (Tanksley and McCouch, 1997).

Wild emmer wheat has been recognized as a promising source for improvement of

cultivated wheat. The wide ecological amplitude of wild emmer in the Fertile Crescent and its

unique genetic structure makes its gene pool of great importance for wheat breeding (Harlan

Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 3

and Zohary, 1966; Nevo et al., 2002; Peleg et al., 2005). Broad phenotypic diversity, both

between and within wild emmer populations, has been reported for numerous characters

including agronomic traits such as yield (Nevo et al., 2002; Peleg et al., 2005; Peleg et al.,

2008a), tolerance to abiotic stresses (Krugman et al., 2010; Krugman et al., 2011; Peleg et al.,

2005), grain constituents such as protein (Peleg et al., 2008a; Peleg et al., 2009; Uauy et al.,

2006) and mineral concentration (Bonfil and Kafkafi, 2000; Peleg et al., 2008a), phenological

traits (Kato et al., 1997), and resistance to diseases including powdery mildew (Gerechter-

Amitai and Silfhout, 1984; Moseman et al., 1985), stripe rust (Fahima et al., 1998; Gerechter-

Amitai and Stubbs, 1970; Nevo et al., 1986), and leaf rust (Moseman et al., 1985; Nevo et al.,

1986). The high grain protein transcription factor, Gpc-B1, and the stripe rust resistance gene,

Yr36, recently isolated by a map-based cloning approach, were found to be absent in

cultivated wheat germplasm and therefore demonstrated value of wild wheat biodiversity for

improvement of domesticated bread and pasta wheats (Fu et al., 2009; Uauy et al., 2006).

Gene isolation through map-based cloning in wheat is challenging because of its large

genome size (11.6 Gb in tetraploids, 17 Gb in hexaploids) and the high content (>80%) of

repetitive DNA, particularly retrotransposons (Bennett and Smith, 1976; Hollister and Gaut,

2009). Most wheat genes are present in more than one copy as homologs, usually located in

the same chromosomal regions of homoeologous chromosomes (Akhunov et al., 2003). In

addition, many genes have paralogs within each constituent genome as well as related gene

pairs stemming from the ancient whole-genome duplication. This genetic redundancy has

made it difficult to follow specific loci in genetics and breeding projects (Blake et al., 2004).

The development of genome-specific markers is hence an important goal. Polymerase chain

reaction (PCR)-based markers, such as those employing simple sequence repeats (SSRs) and

single nucleotide polymorphisms (SNPs), can potentially be genome-specific, allowing

polyploid wheat to be treated as a diploid in genetic analysis (Blake et al., 2004). Cleaved

amplified polymorphic sequence (CAPS) markers, which can be analyzed by PCR followed

by restriction enzyme treatment and agarose electrophoresis, are commonly used as a method

of choice for SNP genotyping in map-based cloning projects when marker identification and

saturation is required to cover a defined chromosome region.

In polyploids, SNP discovery is confounded by the presence of two types of SNPs. The

first corresponds to polymorphisms between homoeologous genomes that occur within

homozygous individuals. These SNPs are commonly found in wheat because the

homoeologous genomes share sequence identities of ~96-98% (Dvorak et al., 2006). These

SNPs are referred to as inter-homoeologue polymorphisms (IHP). The second type of

polymorphism corresponds to varietal SNPs between individuals, representing what is

traditionally referred to as allelic variation. This type of SNP is much less frequent (Trick et

al., 2012). The combined importance of gene flow in wild emmer populations, the synergy of

self-pollination, and the action of Ph1-like genes results in low and heterogeneous diversity

across wild emmer genomes (Akhunov et al., 2010). Nucleotide diversity θπ (Tajima, 1983)

was reported to be 2.7 × 10-3

in 21 A- and B-genome wild emmer genes in 28 accessions from

16 geographic locations (Haudry et al., 2007) and 0.72 × 10-3

in 585 and 576 A- and B-

genome loci in 10 wild emmer accessions from a Diyarbakir, Turkey population (Akhunov et

al., 2010). For comparison, θπ was estimated to be 9.7 × 10-3

in teosinte genes (Zea mays ssp.

parviglumis; Wright et al., 2005) and 7.7 to 8.1 × 10-3

in wild barley genes (Hordeum vulgare

ssp. spontaneum; Morrell et al., 2006). These studies show that wild wheat genomes exhibit

lower SNP levels as compared with other crop progenitors. Haudry et al.. (2007) estimated

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 4

SNP frequency to be 9.8 SNP/kb, while Akhunov et al.. (2010) detected 4.3 SNP/kb in the A

genome and 5.5 SNP/kb in the B genome of wild emmer wheat. Therefore, the molecular

diversity found in the A and B genomes of wild emmer wheat is still much higher than the

diversity found in the same genomes of cultivated wheat: 1.80 (±1.46) SNP/kb (Trick et al.,

2012) and 4.29 SNP/kb (Barker and Edwards 2009).

Because a complete reference genome sequence is not yet available for wheat, several

alternative strategies for locus allocation have been used so far to develop genome-specific

primers (GSPs) that amplify DNA markers from only a single genome in the allopolyploid

wheat. One approach to distinguish between A, B, and D genome -derived loci of hexaploid

wheat is based on comparisons with genomic DNA sequences of putative diploid wheat

ancestors of wheat. Triticum urartu or T. monococcum represents the A-genome donor, Ae.

speltoides, represents the source of the B-genome, and Ae. tauschii, is the ancestral D-genome

(Akhunov et al., 2010; Brenchley et al., 2012). A complementary approach to validate the

specificity of GSPs is based on assignment to a particular genome using aneuploid

cytogenetic stocks available for hexaploid wheat. Given that polyploid wheat can tolerate a

loss of chromosome segments, chromosome arms and even entire chromosomes, these

genetic stocks can enable more specific locus assignment (Endo and Gill, 1996). Wheat

aneuploid cytogenetic stocks available today include nulli-tetrasomics, ditelosomics and

deletion lines. All of these lines were developed in Chinese Spring (CS) background (Endo

and Gill, 1996). A set of T.durum cv Langdon (LDN)/CS D-genome disomic substitution

lines was established by Joppa and Williams (1988). These cytogenetic stocks present a

powerful tool for marker allocation to a specific chromosome arm as well as for sub-arm

assignment. However, these stocks provide limited resolution due to large deletion sizes

(average ~35 Mb) and the inability to order markers within a given bin (Paux et al., 2008).

The development of new polymorphic CAPS markers for wild emmer wheat was based

on very limited resources, including small sets of expressed sequence tags (ESTs) and

comparative genomic mapping exploiting synteny between wheat, rice (Oryza sativa), and

Brachypodium distachyon (hereafter, Brachypodium). ESTs are typically unedited,

automatically processed, single-read sequences produced from complementary DNA (cDNA)

copies of the 3’ end of mRNA, and therefore correspond to the transcribed region of the

genome (Rudd, 2003). Cytogenetic stocks were used for EST allocation to chromosomal

“deletion bins”, which are regions delineated by neighboring deletion breakpoints, followed

by construction of chromosome deletion bin maps of ESTs (Qi et al., 2004).

Comparative mapping in plants has provided evidence for a remarkable conservation of

gene content (synteny) and order (colinearity) between related genomes and has resulted in

the new discipline of comparative genomics (Tang et al., 2008). Rice emerged as a

particularly valuable reference for comparative mapping in wheat, when its small diploid

genome become the first of the cereals to be sequenced (Goff et al., 2002; Yu et al., 2002;

International Rice Genome Sequencing Project, 2005). Large-scale EST mapping allowed

establishment of comparative wheat-rice genomic maps, which served as the basis for marker

enrichment in map-based cloning projects with wild emmer wheat. These resources enabled

in silico chromosome walking, using the rice genome sequence as a reference for mapping

wheat ESTs to the chromosome region harboring the target gene (Distelfeld et al., 2006). In

recent years, Brachypodium has perhaps replaced rice as the favorite grass model genome,

due to its small genome size (270 Mb) and recent divergence time from wheat some 32-39

million years ago. Brachypodium has become increasingly widely used for gene prediction

Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 5

and construction of synteny-based maps in wheat (Bossolini et al., 2007; Wicker et al., 2011),

complemented by other grass genomes.

The recent convergence of several technologies has dramatically changed the situation

for wheat genomics. The public database of wheat ESTs rapidly increased from 549,926 in

2004 to over 1,286,060 ESTs by 2012 (http://www.ncbi.nlm.nih.gov/dbEST/). The ability to

sort out individual wheat chromosomes by flow cytometry led to reduction in the complexity

of wheat genome analysis, making possible the development of chromosome-specific

bacterial artificial chromosome (BAC) libraries from aneuploid lines of the model wheat

genotype Chinese Spring (Dolezel et al., 2012; Safar et al., 2004; Safar et al., 2010).

Nowadays, chromosome- and chromosome-arm-specific BAC libraries are available for all

wheat chromosomes (Dolezel et al., 2012). These technologies have allowed the International

Wheat Genome Sequencing Consortium (IWGSC; http://www.wheatgenome.org/),

established with the goal to generate a reference genome sequence for hexaploid wheat

(Feuillet and Eversole, 2007), to adopt a chromosome-by-chromosome sequencing strategy

involving the construction of BAC-based physical maps as a necessary intermediate step.

Massive genomic resources have been generated by IWGSC and are now accessible at the

Unité de Recherches en Génomique Info (URGI; http://wheat-urgi.versailles.inra.fr/).

Physical maps of individual wheat chromosomes and chromosome arms are now being

established via various fingerprinting technologies (Luo et al., 2003; Philippe et al., 2012). To

anchor the physical contigs and to provide useful sequencing data, survey sequencing (~1.5 to

80-fold genome coverage) has been carried out using “next generation” sequencing (NGS) for

42 individually sorted wheat chromosome arms, followed by assembly of contigs from the

data (survey sequence contigs; SSCs). Gene content and a hypothetical gene order in the

syntenic regions of the wheat genome has been deduced by compilation of synteny

information from the completely sequenced genomes of grasses such as rice (International

Rice Genome Sequencing Project, 2005), sorghum, Sorghum bicolor (Paterson et al., 2009),

and Brachypodium (International Brachypodium Initiative, 2010) using the GenomZipper

approach (Mayer et al., 2009; Mayer et al., 2011) and deposited to URGI (http://wheat-

urgi.versailles.inra.fr/). Brenchley et al. (2012) analyzed a low-coverage, long-read (Roche

454) shotgun sequence of the hexaploid wheat genome. They created assemblies of wheat

genes in an orthologous gene family framework by using diploid wheat relatives to classify

homologous relationships. This allowed production of a genome-wide catalogue of SNPs in

the A, B and D genomes. These new resources, developed for domesticated wheat, have

contributed in parallel to the advancement of wild emmer wheat genomic research and to the

promotion of marker development.

In this chapter, we will illustrate the challenges involved in developing CAPS markers

within the complex wheat genome milieu, as well as the evolution of CAPS marker

development in tetraploid emmer wheat during the past 12 years. Initially, these challenges

were managed with minimal genomic resources, which included limited EST data, and relied

mainly on rice genome sequences as a reference model for pioneering microcolinearity

studies. Over the last decade or so, dramatic progress was achieved, aided by the availability

of survey sequences of individual wheat chromosome arms; the complete reference genome

sequence of wheat is expected to be available within several years. We provide here examples

from several genetic fine-mapping projects for stripe rust and powdery mildew resistance

genes derived from wild emmer wheat, as well as from the positional cloning of the high

grain protein QTL, Gpc-B1, and the slow rusting gene, Yr36.

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 6

GENERAL APPROACH FOR CAPS MARKER DEVELOPMENT IN WILD

EMMER WHEAT

Development of CAPS markers, in the absence of a wheat reference genome sequence,

has had to rely on conserved gene sequences, which allow the assignment of wheat ESTs into

defined chromosomal regions based on comparative genomics with other grass genomes.

Previously, before the GenomeZipper became available for all wheat chromosomes, each lab

had to pave its own way into a specific region of interest. The first step in such a comparative

study is to identify the orthologous chromosomal regions on the wheat and model grass

genomes by a homology search using the basic local alignment search tool (BLAST; Altschul

et al., 1990). Wheat sequences, such as restriction fragment length polymorphism (RFLP)

markers (Distelfeld et al., 2004) or ESTs, previously assigned to wheat deletion bins (Ben-

David et al., 2010; Qi et al., 2004), can be used for BLAST searches against rice and

Brachypodium (Ben-David et al., 2010). The following step is to BLAST the model grass

sequences covering the orthologous regions against the wheat EST database in order to detect

the syntenic wheat genes residing in the specific chromosome regions, while performing in

silico chromosome walking. This stage in the process of CAPS marker development has been

significantly facilitated by the recent construction of a GenomeZipper for all wheat

chromosomes (http://www.wheatgenome.org/). Wheat sequences assigned to chromosomal

positions along the GenomeZipper are easily extracted, and provide a high success rate in

CAPS marker development because they have a high probability of being mapped to the

region of interest. The synteny and the colinearity in the orthologous chromosomal regions

are reliably reflected by the GenomeZipper because the ordering of genes or gene-related

sequences is based on a high degree of homology with three model grass genomes, instead of

on comparisons of wheat sequences to only one of the grass genomes (Bossolini et al., 2007;

Feuillet et al., 2001). Furthermore, the assignment of loci to the various homoeologous

chromosomes of polyploid wheat is now possible due to the availability of the wheat SSCs.

Wheat sequences retrieved by homology search can be used to derive further markers. The

genomic positions of the newly developed markers are finally verified by genetic linkage

mapping.

Because of the great abundance (>80%) of repetitive sequences in the wheat genome, the

development of PCR primers is usually more efficient if conserved genic regions are targeted

for primer design (Blake et al., 2004). Introns and untranslated regions are usually more

polymorphic than exons (Haga et al., 2002). The location of introns in wheat genes can be

inferred by alignment of wheat ESTs with the genomic sequences of Brachypodium or rice

because intron positions are highly conserved between wheat genes and their orthologues in

the model grass species (Figure 1; Bossolini et al., 2007; Dubcovsky et al., 2001;

Ramakrishna et al., 2002). Nowadays, wheat introns can be also detected, in most cases, by

alignment of EST sequences against SSC data bases. Such alignments allow the design of

primer sets, which amplify one or more introns from genomic DNA of both A and B

homoeologous chromosomes (Figure 1).

Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 7

Figure 1. Development of cleaved amplified polymorphic sequences (CAPS) markers based on

comparative genomics. Conserved gene sequences, indicated in green, which matched Brachypodium

exons, were identified by alignment of homologous wheat ESTs against Brachypodium genomic

sequences. The sequences were used to design conserved primers (red boxes). The conserved primers

amplified homoeologous alleles (A and B genomes) of the same size in tetraploid T. dicoccoides. In

most cases, longer fragments were amplified by the conserved primers from T. dicoccoides genomic

DNA than expected based on EST sequences, validating the presence of introns. Sequence

polymorphism between the amplified homoeologues was used to develop B genome-specific primers

(purple boxes). Furthermore, usually these primers are designed to flank a SNP generating a specific

restriction site in one of the alleles, which can differentiate between the alternative alleles amplified

from T. dicoccoides and T. durum and can be detected by enzymatic digestion. Allelic polymorphisms

obtained by the digestion of the genome B-specific fragments with a restriction enzyme can be mapped

in the segregating population derived from a cross of T. dicoccoides with T. durum.

In polyploid wheat, PCR products amplified from genomic DNA may include multiple

fragments of similar size, which are derived from more than one of the component genomes

(Figure 1). One possible strategy to overcome this obstacle is to sequence the different

homoeoalleles and to design a GSP that amplifies only the target allele (Helguera et al.,

2000). Because direct Sanger sequencing of a mixture of PCR products will not yield

meaningful results, the way to separate amplicons corresponding to the different genomes, as

well to detect allelic polymorphism in one of the homoeologous sub-genomes, is to clone the

PCR products into a plasmid vector prior to sequencing. To distinguish between

homoeologous genomes prior to sequencing, five or six colonies, randomly selected from

each parental line, can be screened with a restriction enzyme panel (e.g. AciI, BamHI, AraIII,

EcoRV, MnlI, and NlaIII; Figure 2). Only two clones corresponding to different genomes are

sequenced for each parental line, the sequences compared, and IHPs used to design GSPs.

Nowadays, with the cost of sequencing dramatically dropping, several colonies from each

parental line can be directly sequenced and IHP and GSP detected based on alignment of

several sequences derived from each parental line (Figure 3). Traditionally, GSPs were

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 8

validated by testing them in a set of aneuploid lines, but recently it became more common,

due to its accuracy, to use DNA samples of sorted chromosome arms (Dolezel et al., 2012) to

assign the two types of clones to the A and B genomes (Figure 4A). The GSPs are then used

to amplify DNA samples of the parental lines for sequencing. A comparison of genome-

specific sequences allows the identification of allelic polymorphisms suitable for genetic

mapping. The development of CAPS markers is based on the identification of SNPs that

generate differential restriction patterns between the tested lines. Once a polymorphic

restriction site is identified, the allele-specific PCR fragments generated by the GSP are

digested with the corresponding restriction enzyme and the restriction profiles analyzed by

agarose gel electrophoresis (Figure 4B).

Figure 2. Characterization of homoeologous polymorphism by a restriction enzyme panel. PCR

products amplified from T. durum and T. dicoccoides were cloned into plasmids and transformed into

E. coli cells. PCR products were amplified from six different E. coli colonies randomly selected for

each of the parental lines (Lanes 1-6 are derived from T. durum, while 7-12 represent T. dicoccoides).

These PCR products were digested with a panel of six restriction enzymes. AciI (a) and BamHI (b)

digestions identified two types of colonies corresponding to homoeologous alleles (representing A and

B genomes) in both lines. The digestion with BamHI gave only two restriction patterns in all 12

colonies (b1,5,6,8,9 vs. b2,3,4,7,10,11,12), indicating the presence of a consistent SNP distinguishing

between the A and B homoeoalleles in both T. durum and T. dicoccoides. In contrast, the digestion with

AciI gave three different restriction patterns (a1,5,6,9; a2,3,4; a7,10,11,12; for a8, see troubleshooting

below), which may indicate the presence of an additional SNP differentiating between the T. durum and

T. dicoccoides alleles, within the same sub-genome. AraIII (c) digestion identified two cases (c2 and

c4) that may indicate the presence of possible SNPs or simple technical errors (see troubleshooting

below). EcoRV (d) digestion detected an allelic polymorphism in one of the homoeologous sub-

genomes in T. dicoccoides. MnlI (e) and NlaIII (f) digestions resulted in no polymorphism. M, DNA

ladder.

Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 9

Figure 3. Sequence alignment to design a cleaved amplified polymorphic sequence (CAPS) marker.

The alignment of sequenced fragments amplified by conserved primers (shown by light green box)

from T. dicoccoides and T. durum revealed the presence of homoeoalleles (A and B) derived from both

parental lines. The conserved primers, which were designed to match an EST exon region amplified an

intron from the genomic DNA. Inter-homoeologue sequence (IHS) polymorphisms (indicated as

colored nucleotides: red A; green T; blue G; yellow C) were used to design genome B-specific primers

(GBSP, shown by orange box). Comparison of sequences delimited by GBSP from T. dicoccoides and

T. durum revealed the presence of a SNP-generated restriction site for the restriction enzyme DraIII

(designated by a purple box) in the T. durum allele, thus enabling the development of a CAPS marker.

Digestion of the GBSP-amplified products from T. dicoccoides and T. durum with DraIII differentiate

between the alternative alleles resulting in two bands for T. durum after an agarose gel electrophoresis,

compared to only one band for T. dicoccoides. This allelic polymorphism may be used to map the

corresponding locus in a mapping population derived from the cross between T. dicoccoides and T.

durum.

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 10

Figure 4. Cleaved amplified polymorphic sequence (CAPS) marker for mapping of a specific locus to

1BS chromosome 1BS. A. Marker assignment to chromosome 1BS deletion bin 1BS19-0.31-0.50

performed by PCR with aneuploid lines of Chinese Spring (CS) corresponding to a ditelosomic 1BL-

(Dt-1BL; Endo and Gill, 1996), two sorted chromosome arms 1BS and 1AS (Dolezel et al., 2012), and

five deletion lines (1BS4, 1BS9, 1BS10, 1BS18, 1BS19; Endo and Gill, 1996). B. PCR products

digested with restriction enzyme DraIII are shown for parental lines (lanes 1 & 2) and an F2 mapping

population (lanes 3-20; L, LDN, Triticum durum allele; D, DIC, T. diccocoides allele; H heterozygous,

M, DNA ladder).

Troubleshooting: We deliberately do not present a "perfect" gel here. Instead we present

a typical gel, which demonstrates effective discrimination between the two homoeoalleles (A

vs. B) and even indicates possible allelic polymorphism in only one of the homoeologous

chromosomes (e.g. T. durum and T. dicoccoides alleles). However, this experiment suffers

from several flaws. First, the restriction pattern in lane a8 is not supported by the results

obtained with other enzymes. Colony 8 derived from T. dicoccoides should be identical to

colony 9 in all panels; therefore, we can suspect that a technical error occurred in a8. Second,

the digestion of T. durum PCR products with AraIII gave three different restriction patterns in

colonies c2, 3 and 4, which show identical restriction patterns by five other enzymes.

Although a technical error is the most likely explanation for these patterns, an alternative

explanation is that c2 or c4 represent a different homoeoallele, while c4 and c2 represent Taq

polymerase error that created de novo mutations. Therefore, only c3 represents a true

technical error (i.e. no restriction enzyme added).

In some cases, the SNP between alleles does not generate any polymorphic restriction

site. This kind of SNP could be utilized for development of PCR-based markers by an

alternative approach designated as "derived CAPS" (dCAPS; Komori and Nitta, 2005;

Michaels and Amasino, 1998). To distinguish alleles that differ by a SNP, the region of DNA

containing the base change is amplified using GSP, which contains one or two mismatches.

The introduction of these base changes into the PCR product, together with the base change

between the alleles, creates a unique restriction site in one of the alleles (Michaels and

Amasino, 1998). CAPS/dCAPS markers are then used for screening of mapping populations

(Figure 4B) and genetic mapping.

DLM

539

344195

bp L L L LLD D D D D D D DH H H H H1

1

2 4 65 7 8 9 1011 141213 1815 17163

A.

B.

2019

1BS-4 1AS1BS

1BS-18

1BS-9

1BS-19

1BS-10 CS

Dt1BL

M

500

bp

Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 11

HIGH-RESOLUTION MAPPING OF THE HIGH GRAIN PROTEIN

CONTENT QTL, GPC-B1, BY CAPS MARKERS PROVIDED A SOLID

BASIS FOR ITS POSITIONAL CLONING

High grain protein content (GPC) is important for human nutrition and has a strong

influence on pasta and bread quality (Dohlman and Hoffman, 2000). Wild emmer contains

higher GPC (170-273 g kg−1

) than do most of bread wheat cultivars (110-170 g kg−1

);

therefore, a potential approach to increase GPC in wheat is to exploit the high GPC genes

from wild wheat (Grama et al., 1983; Levy and Feldman, 1988; Nevo et al., 2002; Peleg et al.,

2008a). A promising source of high GPC was detected in a survey of T. dicoccoides,

accession FA-15-3 (Avivi, 1978). Joppa and Cantrell (1990) developed a complete set of

disomic substitution lines from each of the chromosomes of this T. dicoccoides (DIC)

accession into the tetraploid T. durum cultivar Langdon (LDN). These chromosome

substitution lines can be used to facilitate the precise mapping of quantitative trait loci (QTL).

In these populations, differences between the parental lines are restricted to a single

chromosome, decreasing the genetic variability and increasing the sensitivity of the QTL

analysis. The substitution of the complete chromosome 6B of DIC into LDN, LDN(DIC-6B),

showed the highest protein concentration. The evaluation of a mapping population of

recombinant substitution lines (RSLs) from the cross between LDN(DIC-6B) and LDN

showed that the increase in GPC in LDN(DIC-6B) was associated with a QTL located on the

short arm of chromosome 6B (Joppa et al., 1997). This QTL, designated Gpc-B1, was

mapped within a 2.7-cM region using a large set of secondary RSLs from the cross between

LDN and RSL65 (Olmos et al., 2003). Gpc-B1 was cloned by the map-based cloning

approach, using rice as an inter-genomic cloning vehicle, which enabled the saturation of the

Gpc-B1 region on wheat chromosome 6BS with useful CAPS/dCAPS markers that facilitated

the fine-mapping and cloning of the target gene (Distelfeld et al., 2004; Distelfeld et al., 2006;

Olmos et al., 2003; Uauy et al., 2006).

Significant reduction of the chromosomal interval harboring the introgressed Gpc-B1

locus was achieved by exploitation of rice and wheat microcolinearity for CAPS/dCAPS

marker development. RFLP markers, Xpsr113 and Xpsr8, spanning a 28 cM segment in

wheat 6BS that included the QTL for GPC, were used to identify the orthologous region in

rice chromosome 2 (Os2; Distelfeld et al., 2004). At that time, the wheat EST database was

not substantial enough to support "in silico" chromosome walking based on rice-wheat

synteny; therefore, two barley ESTs (BU995216 and BQ753500), homologous (E< e-118

) to

rice Os2 position AP004061, were used to develop a CAPS marker for locus Xucw71. In this

case, the conserved primers were designed within barley exons residing in the identified

ESTs, as described in Figure 1. Using these conserved primers a 1,450-bp PCR product was

amplified from durum wheat (LDN). The mixture of PCR products was then separated by

cloning into a plasmid vector and transformation into E. coli cells. DNA fragments amplified

from different E. coli colonies were tested for polymorphism with a panel of restriction

enzymes, to distinguish between the two homoeoalleles, according to the procedure described

in Figure 2. Two types of clones were identified, sequenced, and assigned to A- and B-

genomes using the 6B nulli-tetrasomic lines. The B-genome-specific primer (BGSP)

UCW71-BF (Table 1) was designed based on sequence differences between the A- and B-

genomes. This primer in combination with the conserved Xucw71 reverse primer UCW71-R

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 12

(Table 1) amplified a segment from the B genome of DIC. A comparison of B-genome

sequences of LDN and DIC revealed the presence of one SNP that generated a restriction site

for BsmI, thus allowing the development of a CAPS marker. Digestion of the amplified

product with BsmI produced fragments of 385 bp in LDN and 429 bp in DIC which were used

to map the Xucw71 locus in a mapping population of RSLs from the cross between

LDN(DIC-6B) and LDN (Table 2; Distelfeld et al., 2004).

Table 1. CAPS and dCAPS markers for loci Xucw71, Xucw79, Xuhw8, Xuhw84,

Xuhw86, and Xucw96 (Distelfeld et al., 2006)

Locus name and

marker type

Primer

name Primer sequence

Restriction

enzyme

Expected

size (bp)

in LDN

Xucw71/CAPS UCW71-BF TGGACTTTCTATTTCTCCGTACC BsmI 385

UCW71-R TCAACCCTTTTAAGCAATTTGAA

Xucw79/dCAPS UCW79-

dCAPsF

AGATAACGACCGATGCGATCTTAGTAa AccI 181

UCW79-dCAPSR

TCCTTTTTCCGATTTTCTTTGTGT

Xuhw83/CAPS UHW83-BF CATCACGGGGTGTCTAAGGT HaeIII 413

UHW83-R GCCAAGAGAGGTTAGGCAAA

Xuhw84/CAPS UHW84-BF CAGGAGGACTACAGGGAAGTCT StyI 549

UHW84-R CGCGGTTCTTCTACCTTGTT

Xuhw86/dCAPS UHW86-BF CAACTTCGATATGCTTTGTCCATb NlaIII 133 + 24

UHW86-R TGCCAATGCTACAGCTCAAC

Xucw96/CAPS

UCW96-BF GGATGATCCCATGGATTCTACA MspI 632 + 363 + 268

UCW96-R TTGGTTAATCTATATGCATACTGCAAC

dCAPS, derived CAPS; LDN, T. durum cultivar Langdon. a

The bold T is a degenerate base pair (original sequence is C) that generates a unique AccI restriction

site in DIC or a unique RsaI site in LDN. b

The bold A is a degenerate base pair (original sequence is T) that generates a unique NlaIII restriction

site in LDN.

Table 2. Graphical genotypesa of the subset of recombinant substitution lines (RSLs)

previously characterized for grain protein content (GPC). L, LDN T. durum cultivar

Langdon; D, DIC, T. dicoccoides (Distelfeld et al., 2006; Olmos et al., 2003)

RSL

Xcd

o 3

65

Xu

cw

75

Xu

cw

74

Xu

cw

73

Xu

cw

79

Xu

hw

83

Xu

hw

89

Xu

hw

86

Gp

c-B

1

Xu

hw

84

Xu

cw

71

Xu

cw

96

Xu

cw

70

Xu

cw

69

Xu

cw

67

Xu

cw

65

113 L D D D D D D D D D D D D 0 D D

116 L D D D D D D D D D D D D D D D

8 L L L D D D D D D D D D D D D D

121 L L L L L L L D D D D D D D D D

110 D D D D D D D D D D D D L L L L

117 D D D D D D D D D D D D L L L L

28 D D D D D D D D D D L L L L L L

119 D D D D D D D D D D D D D L L L a (Young and Tanksley, 1989).

Figure 5. Microcolinearity between the Gpc-B1 region in wheat chromosome 6B and rice chromosome 2. The positions of the genes in the rice genomic

sequence (top) are compared with the genetic and physical maps of the colinear region in wheat (bottom). The grey area represents the 0.2-cM region of the

wheat genetic map including the Gpc-B1 locus (Distelfeld et al., 2006).

Xu

cw8

3

X

uh

w8

9

Xu

hw

86

Xu

cw7

1 X

ucw

96

250-kb

770E02 900C08

916O17

409D13

947A13 1025F04

0.1 cM 0.1 cM

A Genome

1229O05 1130E11 866B21

678J09 431C01

884P09 153M06 976M3

1105M18 8F18

1217E11 574J23

797F22 837O18

154N17 X

uh

w8

4

445P02

B Genome

Xu

cw7

9

57H16

Rice BAC AP005647 10-kb OS

JNB

a002

6E

05

.19

-1

OS

JNB

a002

6E

05

.24

OS

JNB

a002

6E

05

.30

OS

JNB

a002

6E

05

.18

OS

JNB

a002

6E

05

.11

-2

OS

JNB

a002

6E

05

.8

Xucw90

Wheat 5L

OS

JNB

a002

6E

05

.31

Xu

cw7

3

50-kb

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 14

Wheat EST CA643341 which is homologous (E< e-24

) to rice Os2 at position AP004061,

was used to develop a dCAPS marker for locus Xucw79. Using EST-based conserved

primers, a 4.5-kb fragment from LDN and DIC was amplified and cloned. The PCR

fragments from different transformed E. coli colonies were assigned to the A and B genomes

as described above. The B-genome clones from DIC and LDN were sequenced and BGSPs

were developed. The B-genome sequences amplified by BGSPs contained no SNPs that could

generate any restriction site. Therefore, a dCAPS marker (Michaels and Amasino, 1998) was

developed by adding a degenerate T into BGSP UCW79-dCAPSF (Table 1) in the second

base from the 3’ end (the original base was C), creating a unique AccI restriction site in the

amplified product from DIC and a unique RsaI restriction site in the amplified product from

LDN. This primer, in combination with the BGSP UCW79-dCAPSR (Table 1) amplified a

181-bp fragment which, after digestion with AccI, produced a polymorphism between DIC

(156 bp + 25 bp) and LDN (181 bp). This polymorphism was used to map Xucw79 in the

Gpc-B1 RSL population (Table 2). This approach enabled the narrowing down of the position

of the Gpc-B1 locus to a 0.2-cM region flanked by CAPS and dCAPS markers, Xucw71 and

Xucw79, respectively, which corresponded to a 64-kb region in rice chromosome 2 (Figure 5;

Distelfeld et al., 2006).

Further exploitation of rice-wheat microcolinearity and CAPS marker development

allowed the construction of the physical map covering the 6BS chromosomal region that

harbors the Gpc-B1 locus. Two additional CAPS markers, Xuhw83 and Xuhw84, were

developed based on wheat ESTs BQ789353 and BE444066, respectively, and identified based

on homology with rice Os2 (Table 1). The marker Xuhw83 co-segregated with Xucw79, while

Xuhw84 co-segregated with the target locus Gpc-B1, as was shown by genetic and physical

mapping of the recombination events that flank the Gpc-B1 locus (Table 2, Figure 5). A

tetraploid wheat RSL65 BAC library, which carries a 30 cM T. diccocoides 6BS

chromosomal segment harboring the high GPC gene (Cenci et al., 2003), was hybridized with

DNA probes that represent loci Xucw71, Xuhw83, and Xuhw84. Several BAC clones

corresponding to two non-overlapping BAC contigs were detected (Figure 5). Using BAC-

end sequences (BES), additional CAPS (Xucw96) and dCAPS (Xuhw86) markers were

developed, enabling the correct orientation of the BAC contigs (Table 1, Figure 5). A

modified probe for locus Xuhw86 was designed for further steps of chromosome walking.

Hybridization of this probe with a RSL65 BAC library revealed three positive BAC clones

and closed the gap between the two previously identified BAC contigs. An allele-specific

marker Xuhw89, which was developed from BES of BAC 916O17, was mapped on the

critical RSLs and was completely linked to Xuhw83 and one crossover distal to the Gpc-B1

gene (Table 2, Figure 5). Mapping of CAPS/dCAPS markers located the Gpc-B1 gene within

a BAC contig composed of six overlapping BAC clones, which spans a region of

approximately 250 kb (Figure 5; Distelfeld et al., 2006). The complete sequence of this region

revealed five candidate genes. A high-resolution genetic map based on approximately 9000

gametes and seven new markers (three CAPS, two dCAPS, and two SSR), was used to

determine linkage between these genes and the Gpc-B1 locus. The region harboring the Gpc-

B1 was delimited by CAPS markers Xuhw106 and Xuhw109 (Uauy et al., 2006). The

annotation of this 7.4 kb region identified a single gene encoding a NAC domain protein

which was designated NAM-B1

(Uauy et al., 2006). The cloning and the functional study of the Gpc-B1 provide a direct link

Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 15

between the regulation of senescence and nutrient remobilization. This important discovery,

based on high-resolution mapping with CAPS markers, may contribute to a more efficient

breeding of cereal crops and may be translated into the development of food products with

enhanced nutritional value.

ADVANCEMENTS IN CAPS MAPPING OF DISEASE RESISTANCE

GENES DERIVED FROM WILD EMMER WHEAT

Average yield losses of 18% (Oerke, 2006) due to microbial diseases put a substantial

economic burden on wheat growers and consumers around the world. Many wheat diseases

are hard to control without the use of pesticides, resulting in risks to human health and

environmental pollution. Development of resistant cultivars is the most effective approach to

reduce these risks and to minimize yield losses due to diseases. The wild emmer wheat gene

pool provides a valuable source of natural resistance for the major diseases of wheat (Cheng

et al., 2010; Nevo et al., 2002; Peng et al., 1999; The et al., 1993). Among T. dicoccoides

populations in Israel and its vicinity, there are many genotypes that are highly resistant to

yellow rust (Cheng et al., 2010; Gerechter-Amitai and Van Silfhout, 1989; Nevo et al., 2002;

Peng et al., 1999; The et al., 1993), powdery mildew (Murphy et al., 2009), glume blotch

(Chu et al., 2008), leaf rust (Moseman et al., 1985; Nevo et al., 1986), and Fusarium

graminearum (Buerstmayr et al., 2003). CAPS markers are commonly used in wild emmer

genomic studies to achieve high-resolution mapping of resistance loci, via comparative

genomic analysis, as a basis for map-based cloning of these valuable genes. Furthermore,

genetic mapping of the resistance loci derived from T. dicoccoides by CAPS can facilitate

their introgression into elite breeding materials via marker-assisted selection.

POSITIONAL CLONING OF THE SLOW-RUSTING STRIPE RUST

RESISTANCE GENE, YR36, DERIVED FROM WILD EMMER WHEAT

Map-based cloning of the high-temperature adult-plant (HTAP) stripe rust resistance

gene, Yr36, derived from T. dicoccoides accession FA15-3 from Israel (Avivi, 1978; Uauy et

al., 2005) was accomplished by means of CAPS markers developed based on a comparative

genomic analysis of wheat-rice microcolinearity (Fu et al., 2009). HTAP resistance is

conferred by a particular class of adult-plant resistance genes that is effective after stem

elongation and when average night temperatures remain above 10°C and day temperatures are

between 25°C and 30°C (Line and Chen, 1995; Milus and Line, 1986a; Milus and Line,

1986b; Qayoum and Line, 1985). HTAP genes are non-race-specific resistance genes, which

are expressed at later stages of plant development, provide a broader range of resistance to

pathogens, and tend to be more durable than race-specific seedling resistance genes (Line and

Chen, 1995).

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 16

High-resolution map of the Yr36 gene region was developed using a large F2 mapping

population (4500 F2 plants) obtained by crossing the susceptible T. durum cv Langdon (LDN)

with the resistant isogenic recombinant substitution line RSL65. This line, carries a 6BS

chromosome segment introgressed from T. dicoccoides, which harbors Yr36 in the LDN

genetic background (Uauy et al., 2005). On the basis of gene-related sequences obtained from

the rice colinear region (Distelfeld et al., 2004), eight CAPS markers (Table 3) were

developed to construct a high-density map of Yr36, in which Yr36 was mapped to 0.14 cM

interval delimited by CAPS markers Xucw113 and Xucw111 (Table 3; Fu et al., 2009).

Screening of a RSL65-specific BAC library, which carries Yr36 in an LDN genetic

background (Cenci et al., 2003), with the distal CAPS marker Xucw113 yielded six BAC

clones. BESs were used to screen the library and extend the contig by chromosome walking.

Two BAC clones were sequenced and a contiguous 314-kb sequence, including the flanking

co-dominant markers CAPS Xucw113 and sequence-tagged-site (STS) Xucw127 (LDN: 110-

bp and RSL65: 105-bp), was obtained. Using this sequence, new dominant markers present

only in RSL65 were developed, and the Yr36 resistance gene was mapped between Xucw129

and Xucw148 (0.02 cM; Fu et al., 2009). The complete 186-kb Yr36 region flanked by

markers Xucw129 and Xucw148 was absent in LDN.

PCR-based allele-specific markers can be used in breeding programs to accelerate the

deployment of Yr36 in commercial bread wheat varieties. Although the RSL65 specific

dominant markers, Xucw129 and Xucw148, are useful for selecting progenies that carry Yr36,

they are not appropriate for differentiating between progenies that are heterozygous for Yr36

from the homozygous ones. This differentiation is critical for selecting plants homozygous for

Yr36 in F2 segregating populations or after self-pollination of the heterozygous progenies

from the previous cycle of a backcrossing program. Therefore, CAPS, dCAPS, and STS

markers developed in the course of the Yr36 cloning (Table 3) are useful for selecting

progenies that are homozygous for Yr36 and thus expected to facilitate the introgression of

Yr36 into new bread wheat varieties.

A pair of genes duplicated in tandem, designated Wheat Kinase START 1 and 2 (WKS1

and WKS2), was identified by sequence annotation and was subjected to further analysis.

Functional analysis by EMS mutagenesis using the TILLING (targeting induced local lesion

in genome) approach (McCallum et al., 2000) suggested that WKS1 corresponds to Yr36 (Fu

et al., 2009). Functional analysis of several independent TILLING mutants demonstrated that

both the kinase and the START domains are necessary for the resistance response. The

identity between WKS1 and Yr36 was also validated by genetic transformation of WKS1 into a

susceptible wheat variety. WKS1 alone was proven to be sufficient to improve resistance of

susceptible wheat varieties. WKS1 was detected in only ~24% of the wild emmer wheat

accessions tested by Fu et al.. (2009) and was not detected in any of the tested bread or pasta

wheat varieties. These findings suggest that WKS1 was not incorporated into the initial

domesticated forms. Since this gene is absent from almost all modern commercial varieties

(except for lines that already contain 6B introgression from T. dicoccoides), the introgression

of Yr36 into elite cultivated germplasm could have a broad impact in improving the resistance

to stripe rust (Fu et al., 2009).

Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 17

Table 3. CAPS, dCAPS and STS markers used to produce the Yr36 high resolution

genetic and physical maps. Markers are listed from the telomeric to the centromeric

location (Fu et al., 2009)

Locus Primers Restriction

enzyme

Polymorphism

(bp) Rice homolog

Xucw110/ CAPS GGAGCAGCCACATCGTCG MspI La ≈ 2000 Os02g0139200

GCCTGCTCCAACAACCATC

Xucw70/ CAPS GTCTGTCCATGGGTTCTC DpnII L ≈ 1850 Os02g0139300

GTCATGAAGCCTTGGTTGAAG Db ≈ 850

Xucw112/ CAPS GGAGTGGAACCAGAGGAGC HaeIII L ≈ 390 Os06g0703500

ATGATGTGCACCATGCGG D ≈ 300

Xucw113/ CAPS GCTGGAGGTGAGTGGTGAAT TaqI L = 252 Os02g0139500

AATCTCCTCCCTTCGATGCT D = 175

Xucw128/STSC TTAGATGGAGTCCCGTGGAG none L ≈ 195 -

TGAAGCCAGCAATGAAGTTG D = 189

Xucw129/D dominant

AAGGACTCTGCTCCTGACGA none D = 1452 -

GAAGATGCTCTGAACGCACA

Xucw148/D dominant

CCCTTTGTGCCACATTTCTT RsaI D = 462d -

GGCAGGTGGAAGTCAACATT

Xucw127/STS GTACGTCCTGCTCACCATCA none L = 110 -

AGAAGAACAACGGAGGACGA D = 105

Xucw111/ CAPS ACCCGTAAGATGCAATAACTTG RsaI L ≈ 306 Os02g0139700

GCAGGACTGCTCTTGAAG D = 215

Xucw69/ dCAPS AGTTGTCATGTAATAGGTTGTACC SphI L = 140 Os02g0141300

ATACATCAGTATKTATGTGGCATGe D = 120

Xucw103/dCAPS CTTTGTTTCCTGTATACGAATGCTTT PstI &

XmnIf

L = 217 Os02g0142500

AGAAGAATTTACAAATACACAGC D = 239

Xucw65/ CAPS GCATGTTTCAGTTTGGTTATCA NcoI L = 418 Os02g0146600

CTCATCATCACATCACAAAGGAA D = 684

Xucw102/dCAPS

AACATAAGAGGGAGGTCGAG DraIII L = 205 Os02g0148600

GAACAAGAGCACAGCACGTTGT D = 188 a L, T.durum cv Langdon.

b D, T. dicoccoides accession FA15-3.

c Marker developed, based on BAC sequence of an RSL65 specific BAC-library.

d The amplification product is 2.68 kb, and the polymorphic digested band is 462 bp.

e Bold letters indicate degenerate nucleotides that were introduced to generate polymorphic restriction

sites. f Polymorphism was detected by XmnI. PstI was used to reduce fragment size for convenient

visualization on polyacrylamide gel.

AN IMPROVED APPROACH FOR GSP DEVELOPMENT BASED ON

CHROMOSOME-SPECIFIC GENOMEZIPPER IN MAPPING OF POWDERY

MILDEW RESISTANCE GENES

The recent wheat genomic resources established by the IWGSC have greatly facilitated

the CAPS marker development process by providing a large amount of wheat genomic

sequence data derived from defined chromosome arms (http://www.wheatgenome.org/).

Furthermore, the availability of the GenomeZipper for individual wheat chromosomes allows,

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 18

in most cases, the identification of genic sequences belonging to specific chromosome

intervals based on their order along the GenomeZipper. Moreover, comparisons of

homoeoalleles from the A and B genomes allow identification of IHP and development of

GSP bioinformatically, thus modifying and simplifying the process of GSP identification

during CAPS marker development for wheat. The efficiency of the improved approach of

GSP identification can be demonstrated by the recent advancements in the mapping of

powdery mildew (Pm) resistance genes derived from wild emmer wheat.

Two novel Pm resistance genes, temporarily designated PmG16 and PmG3M, derived

from wild emmer wheat accessions G18-16 and G-305-3M, were recently identified and

assigned to chromosomes 7AL and 6BL, respectively, in mapping populations derived from

crosses of the resistant T. dicoccoides accessions with the susceptible T. durum cv Langdon

(LDN; Ben-David et al., 2010; Xie et al., 2012). Chromosomal assignment and construction

of the primary genetic maps for these two genes were conducted by the screening of publicly

available molecular markers, including markers derived from the whole genome genetic maps

of wild emmer wheat developed by our group (e.g. Peleg et al., 2008b; Peng et al., 2000).

These marker resources included: SSR, EST-SSR, STS, inter-simple sequence repeat (ISSR),

sequence-tagged microsatellite (STM), resistance gene analog (RGA), target region

amplification polymorphism (TRAP), and diversity array technology (DArT) markers (Ben-

David et al., 2010; Xie et al., 2012). Due to the relatively low polymorphism between the two

T. turgidum species and lack of linkage to the locus of interest, this laborious approach

resulted in the mapping of a very small proportion of the screened markers. For example, the

screening of 225 SSRs mapped to the A and B genomes of wheat (Ganal and Röder, 2007;

Röder et al., 1998) did not yield polymorphic markers linked to PmG3M locus, while the

screening of 320 RGA primer pair combinations (Xie et al., 2012) detected only seven (2.1%)

polymorphic markers that were linked to the target gene. A similar rate of polymorphism and

linkage (1.7%, 5 out 288) was obtained by the screening of TRAP markers (Liu et al., 2005).

It should be noted that each RGA and/or TRAP primer combination amplifies a profile of 20-

50 PCR bands each, of which only one band is eventually converted into a dominant marker.

Therefore, the real rate of success in detecting polymorphism using these methods is 20-50

times lower. After localization of Pm genes on wheat chromosomes, additional markers

mapped to these chromosomes were screened for polymorphism and linkage. Five SSR

markers derived from three 6BL SSR maps (Röder et al., 1998; Somers et al., 2004; Sourdille

et al., 2004) and one EST-SSR (Mullan et al., 2005) were mapped to the PmG3M region.

Eight of the 46 markers (17%) mapped to chromosome 7AL of wild emmer wheat by Peleg et

al., (2008b) were found to be closely linked to the PmG16 locus (Ben-David et al., 2010).

One CAPS marker was developed and mapped to the PmG16 region. As a consequence of the

described mapping efforts, the PmG16 locus was mapped to a 3.6 cM interval on the distal

part of 7AL, while the size of the chromosomal interval that contains PmG3M on the distal

part of chromosome 6BL ranged from 9.2 to 22.3 cM on various genetic maps developed

using different mapping populations (Ben-David et al., 2010; Xie et al., 2012). Further efforts

aimed at constructing a high-resolution map of the PmG3M gene are focused mainly on the

development of CAPS markers by a comparative genomics approach. In total, 176 wheat

ESTs physically mapped to chromosome 6BL (http://wheat.pw.usda.gov/wEST/ binmaps/)

were compared by individual BLAST searches to rice chromosome 2 (Os2) and

Brachypodium chromosome 3 (Bd3). Nine of these ESTs were successfully converted into

Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 19

genetic markers, including three STS and six CAPS markers that were mapped to the PmG3M

gene region (Ben David, 2011).

Further saturation of the PmG3M genetic map was performed by an improved method for

CAPS marker development based on the currently available group 6 GenomeZipper and the

6BL survey sequences (http://wheat-urgi.versailles.inra.fr/Seq-Repository). EST-derived

markers spanning a 6.5 cM interval, which harbors PmG3M, were used as anchors to the

corresponding region on 6BL GenomeZipper delimiting a 1.06 Mb segment (scaled according

to Bd3) containing 58 wheat SSCs (http://www.wheatgenome.org/). In order to minimize

mapping efforts, the 1.06 Mb GenomeZipper interval was divided into several fragments, and

nine SSCs from each fragment were chosen for CAPS marker development. The

homoeologues SSCs were obtained for the A and B genomes from the 6AL and 6BL survey

sequences. In total, 32 conserved GSP sets were designed, based on the sequence

polymorphisms identified between the A and B genomes, using the procedure demonstrated

in Figure 3. Screening of nulli-tetrasomic lines and sorted 6BL and 6AL chromosomes

revealed that 34% (11 of 32) of the primers developed by this approach were specific to the B

genome, 50% (16 of 32) amplified the same fragment from both the A and B genomes, while

five of them yielded no amplification products (Bocharova et al., unpublished). These GSPs

are now being used to develop CAPS markers according to the procedure described in Figure

4. The fragments amplified from genomic DNA of the two parental lines will be sequenced,

and SNP-generating restriction sites will be identified. Digestion of the amplified products

will be used to map these loci, by graphical genotyping, in a mapping population of

recombinant inbred lines (RIL) from the cross of a resistant T. dicoccoides with a susceptible

T. durum line. The first CAPS marker mapped using this approach reduced the chromosomal

interval that contains PmG3M from 6.5 cM to 5.5 cM (Bocharova et al., unpublished). The

mapping of additional CAPS markers is underway to delimit the PmG3M to a smaller

chromosomal interval, providing a solid foundation for positional cloning of the target Pm

gene.

UTILIZATION OF 1BS PHYSICAL MAP FOR CAPS MARKER

DEVELOPMENT TO TARGET STRIPE RUST RESISTANCE GENES

DERIVED FROM T. DICOCCOIDES

CAPS marker development using colinearity was found to be highly efficient in the

mapping of two novel stripe rust resistance genes, Yr15 and YrH52, derived from

chromosome 1BS of wild emmer wheat. High-resolution and physical mapping of these genes

significantly benefit from the availability of a complete physical map of chromosome 1BS of

bread wheat constructed by our group within the framework of the European consortium

TriticeaeGenome (Raats et al., 2013).

Yr15 and YrH52 were assigned to chromosome 1BS, and primary genetic maps of these

genes were constructed with the aid of marker systems including amplified fragment length

polymorphism (AFLP), random amplified polymorphic DNA (RAPD), and SSRs (Peng et al.,

1999; Peng et al., 2000; Sun et al., 1997). Mapping of nucleolar organizing region (Nor)1 as

an RFLP probe allowed physical allocation of Yr15 and YrH52 to the deletion bin map of

chromosome 1BS. Fifteen wheat ESTs mapped to a specific deletion bin

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 20

(http://wheat.pw.usda.gov/wEST/binmaps/) provided a source for the development of four

new CAPS markers. Mapping of these markers in large (>4000) F2 populations segregating

for these genes has lead to a significant reduction of the genetic intervals spanning Yr15 and

YrH52 genes from 25.9 and 39.6 cM respectively to 5.8 and 3.0 cM. Three of these EST-

based CAPS markers were used as anchors to the orthologous region on rice chromosome

Os5. Homologue searches with sequences of rice BACs covering this orthologous found more

than 20 wheat ESTs, which were used to develop additional CAPS markers (Yaniv et al.,

unpublished). The syntenic regions on rice chromosome 5 (Os5), Brachypodium chromosome

2 (Bd2), sorghum chromosome 9 (Sb9), and the wheat chromosome 1BS region containing

the two Yr genes were identified using the GenomeZipper (Mayer et al., 2009; Mayer et al.,

2011). Orthologous regions of 824 kb in rice, 876 kb in Brachypodium and 889 kb in

sorghum were delimited by the closest flanking markers. Wheat ESTs matching orthologous

rice, Brachypodium and sorghum genes were used to develop and map six additional CAPS

markers, resulting in a dramatic reduction of the chromosomal intervals spanning the Yr genes

to 0.2 cM and 1.1 respectively for Yr15 and YrH52 (Yaniv et al., unpublished, Raats et al.,

unpublished).

The construction of the BAC-contig-based physical map for chromosome 1BS of bread

wheat, T. aestivum cv. Chinese Spring (Raats et al., 2013), together with the availability of

727 Mb generated by Roche 454 sequence platform (Wicker et al., 2011) and 207 Mb of

survey sequences (http://www.wheatgenome.org/), of 1BS reinforced the fine-mapping

efforts of the Yr genes derived from T. dicoccoides. The assembly of the 1BS physical map by

the linear topology contig (LTC) program (Frenkel et al., 2010) resulted in 57 very long BAC

scaffolds covering 77.4% of 1BS. In total, 2,133 gene-derived markers were integrated into

the 1BS physical map by direct molecular (PCR and microarray) or in silico analyses (Raats

et al., 2013). Screening of the 1BS BAC library with CAPS markers obtained from high

resolution genetic maps of the two Yr genes revealed long scaffolds (8.4 Mb and 14.3 Mb)

covering the corresponding Yr gene regions. Assignment of Yr genes to 1BS BAC scaffolds

provides immediate access to a great amount of wheat genomic sequences and markers with

known chromosomal positions, including BES, wheat sequence contigs, wheat unigenes and

PCR-based markers.

Annotation of wheat genomic sequence contigs mapped to this region by comparisons

(BLAST) against the gene set from Brachypodium and wheat ESTs led to precise predictions

of conserved genic regions and thus to the accurate construction of primers and rapid

development of additional CAPS markers, reducing the interval containing the Yr15 gene to

less than 1 Mb (Yaniv et al., unpublished). The sequencing of these clones generated 0.8 Mb

of sequence data that were exploited for the development of additional CAPS markers (Yaniv

et al., unpublished). The availability of wheat genomic sequences allows the utilization of the

abundant repetitive sequence fraction in this specific genome region for CAPS marker

development. The potential of the repetitive fraction of genomic sequences for developing

genome-specific molecular markers, based on particular insertion site-based polymorphisms

(ISBPs), was demonstrated by Paux et al. (2006, 2010). The mining of 0.8 Mb 1BS

chromosome genomic sequences by IsbpFinder (Paux et al., 2010) resulted in the

identification of many ISBP primer sets; two of them were used to develop genome B-

specific CAPS markers. The Yr15 gene was mapped to the 0.15 cM region including four

markers that co-segregat with the gene. The screening of T. dicoccoides accession-specific

Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 21

BAC libraries with CAPS markers derived from high-resolution physical map of Yr15 and

YrH52 gene regions on chromosome 1BS of CS has a potential to directly land on the target

site, skipping the laborious chromosome walking stage.

CONCLUSION

Wild emmer is considered to be the progenitor of cultivated bread and durum wheats,

and, as such, its gene pool is an excellent source for their improvement. The dissected

environments of the Fertile Crescent represent wide ecological amplitude that harbor a broad

phenotypic and genetic diversity of wild emmer populations which can provide great value to

wheat breeding for many traits, ranging from growth habit to disease resistance. However,

identification and isolation of the genes responsible for a trait of interest in wild emmer and

other species in the genus as a whole is challenging because of the combined complexities of

polyploidy and large genomes.

In this chapter, we have described the utilization of CAPS markers for high resolution

mapping and positional cloning of economically important genes derived from wild emmer.

The feasibility of the CAPS/dCAPS marker method for in silico chromosome walking, based

on wheat-rice synteny, was demonstrated in the positional cloning of the GpcB1 and Yr36

genes (Uauy et al.. 2006; Fu et al.. 2009), and in high resolution and physical mapping of Yr

and Pm resistance genes derived from wild emmer wheat. CAPS markers are highly useful

tools in overcoming the difficulties of fine-mapping and positional cloning in Triticum. The

general approach for fine mapping is to begin with two markers, perhaps 3 to 5 cM to either

side of the gene of interest for the screening of large populations, and then to proceed with the

addition of markers derived from EST- or gene-derived markers. For the development of

additional CAPS markers in a region, generally a long PCR product, up to 2 kb and including

intronic sequences, is best because it maximizes the likelihood of revealing polymorphism.

Development of locus and homoeologue-specific primers often requires the screening of

several primer sets. The use of genome-specific chromosome preparations is highly useful for

testing primer discrimination.

Of the two main challenges in developing sufficient CAPS markers for polyploid

Triticum, one is to avoid cross-amplification in the PCR of targets in paralogs from the same

genome and from homologs and paralogs in the homoeologous chromosomes of the other

genome(s). This problem can only be overcome by sequence comparisons of homoeologous

chromosomes and screening of sufficient primer pairs and target regions. The other main

challenge is to develop sufficient markers to achieve the density required for positional

cloning. The availability of annotated whole-genome sequences from species with largely

collinear gene order on syntenic chromosomes, including Brachypodium, rice and sorghum,

has greatly increased the efficiency of developing candidates for CAPS markers in Triticum.

Moreover, the emergence of physical and genetic maps linked to deep EST resources, such as

for barley, has benefited CAPS development in Triticum. The current genome projects in

Triticum will ultimately provide the best basis for efficient marker saturation for positional

cloning.

Although high-throughput development and genotyping of SNP markers has progressed

to a significant degree in wheat, resulting in the development of DNA chips enabling the

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 22

construction of genetic maps carrying several hundred markers (Feuillet et al., 2012;

http://wheat.pw.usda.gov/GG2/index.shtml), CAPS markers remain the method of choice in

gene mapping projects. One of the main advantages of the CAPS/dCAPS method is that it can

potentially utilize any sequence polymorphism in the development of PCR-based markers. In

addition, the CAPS/dCAPS marker approach is relatively inexpensive and easy to score. The

CAPS/dCAPS method does not require special techniques or equipment, thus fulfilling the

needs of gene mapping projects that rely on screening relatively of few lines or cultivars with

a limited number of markers. For alleles carrying multiple polymorphisms with respect to a

polyploid introgression host, CAPS markers can be more reliable than SSRs and SNP assays

on high-throughput platforms.

CAPS markers can serve, due to their co-dominant nature, to investigate whether a

sample contains a mixture of different cultivars, to determine the allelic state at the locus of

interest in germplasm collections, and as markers in backcross breeding projects. The

potential disadvantage of dominant markers is frequently the confusion in distinguishing

between a non-specific negative reaction and a failed or faint reaction in various experimental

or laboratory conditions. In contrast, specific differences between individuals can clearly be

detected with a co-dominant CAPS marker system. Given the high level of accuracy observed

in germplasm screening (Helguera et al., 2000; Okoń et al., 2012) and gene introgression

(Chen et al., 2003; Helguera et al., 2005; Mago et al., 2011; Seyfarth et al., 1999), CAPS

markers provide breeders with an easy to score selection tool for economically important

genes of wheat.

In summary, although the development and genotyping of high-throughput markers has

progressed significantly in wheat, CAPS markers remain the method of choice for fine

genetic dissection and positional cloning of genes derived from T. dicoccoides and other

species in the genus because they provide a simple way to analyze complex genomes.

ACKNOWLEDGEMENTS

The authors wish to thank the International Wheat Genome Sequencing Consortium for

generating the wheat chromosome survey sequences and making them available to us for

analysis. This work was supported by the European Community’s Seventh Framework

Programme TriticeaeGenome (grant number FP7-212019), the Israel Science Foundation

(ISF) grant 205/08 and the Binational Agricultural Research and Development Fund (BARD)

grant IS-4628-13. Dina Raats is grateful for the Eshkol Fellowship awarded by the Israeli

Ministry of Science.

REFERENCES

Aaronsohn, A. (1910). Agricultural and botanical explorations in Palestine. Bulletin of Plant

Industry, 180, 1-63.

Akhunov, E., Akhunova, A., Linkiewicz, A. M., Dubcovsky, J., Hummel, D., Lazo, G., Chao,

S., Anderson, O. D., David, J. & Qi, L. (2003). Synteny perturbations between wheat

homoeologous chromosomes caused by locus duplications and deletions correlate with

recombination rates. Proceedings of the National Academy of Sciences of the USA, 100,

10836-10841.

Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 23

Akhunov, E., Akhunova, A., Anderson, O., Anderson, J., Blake, N., Clegg, M., Coleman-

Derr, D., Conley, E., Crossman, C. & Deal, K. (2010). Nucleotide diversity maps reveal

variation in diversity among wheat genomes and chromosomes. BMC Genomics, 11, 702.

Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. (1990). Basic local

alignment search tool. Journal of Molecular Biology, 215, 403-410.

Avivi, L. (1978). High grain protein content in wild tetraploid wheat Triticum dicoccoides

Korn. Proceedings of the 5th International Wheat Genetic Symposium, New Delhi,

372-380.

Barker, G. L. & Edwards, K. J. (2009). A genome-wide analysis of single nucleotide

polymorphism diversity in the world's major cereal crops. Plant Biotechnology Journal,

7, 318-325.

Ben-David, R. (2011). Molecular mapping of powdery mildew resistance genes derived from

the Triticum turgidum gene pool. PhD Thesis, University of Haifa, Haifa, Israel.

Ben-David, R., Xie, W., Peleg, Z., Saranga, Y., Dinoor, A. & Fahima, T. (2010).

Identification and mapping of PmG16, a powdery mildew resistance gene derived from

wild emmer wheat. Theoretical and Applied Genetics, 121, 499-510.

Bennett, M. D. & Smith, J. (1976). Nuclear DNA amounts in angiosperms. Philosophical

Transactions of the Royal Society of London. Biological Sciences, 274, 227-274.

Blake, N., Sherman, J., Dvorak, J. & Talbert, L. (2004). Genome-specific primer sets for

starch biosynthesis genes in wheat. Theoretical and Applied Genetics, 109, 1295-1302.

Bonfil, D. J. & Kafkafi, U. (2000). Wild wheat adaptation in different soil ecosystems as

expressed in the mineral concentration of the seeds. Euphytica, 114, 123-134.

Bossolini, E., Wicker, T., Knobel, P. A. & Keller, B. (2007). Comparison of orthologous loci

from small grass genomes Brachypodium and rice: implications for wheat genomics and

grass genome annotation. The Plant Journal, 49, 704-717.

Brenchley, R., Spannagl, M., Pfeifer, M., Barker, G. L. A., D’Amore, R., Allen, A. M.,

McKenzie, N., Kramer, M., Kerhornou, A. & Bolser, D. (2012). Analysis of the bread

wheat genome using whole-genome shotgun sequencing. Nature, 491, 705-710.

Buckler, E. S., Thornsberry, J. M. & Kresovich, S. (2001). Molecular diversity, structure and

domestication of grasses. Genetical Research, 77, 213-218.

Buerstmayr, H., Stierschneider, M., Steiner, B., Lemmens, M., Griesser, M., Nevo, E. &

Fahima, T. (2003). Variation for resistance to head blight caused by Fusarium

graminearum in wild emmer (Triticum dicoccoides) originating from Israel. Euphytica,

130, 17-23.

Cenci, A., Chantret, N., Kong, X., Gu, Y., Anderson, O. D., Fahima, T., Distelfeld, A. &

Dubcovsky, J. (2003). Construction and characterization of a half million clone BAC

library of durum wheat (Triticum turgidum ssp. durum). Theoretical and Applied

Genetics, 107, 931-939.

Chen, X., Soria, M. A., Yan, G., Sun, J. & Dubcovsky, J. (2003). Development of sequence

tagged site and cleaved amplified polymorphic sequence markers for wheat stripe rust

resistance gene. Crop Science, 43, 2058-2064.

Cheng, J., Yan, J., Sela, H., Manisterski, J., Lewinsohn, D., Nevo, E. & Fahima, T. (2010).

Pathogen race determines the type of resistance response in the stripe rust – Triticum

dicoccoides pathosystem. Physiologia Plantarum, 139, 269-279.

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 24

Chu, C., Xu, S., Faris, J., Nevo, E. & Friesen, T. (2008). Seedling resistance to tan spot and

Stagonospora nodorum leaf blotch in wild emmer wheat (Triticum dicoccoides). Plant

Disease, 92, 1229-1236.

Distelfeld, A., Uauy, C., Olmos, S., Schlatter, A. R., Dubcovsky, J. & Fahima, T. (2004).

Microcolinearity between a 2-cM region encompassing the grain protein content locus

Gpc-6B1 on wheat chromosome 6B and a 350-kb region on rice chromosome 2.

Functional and Integrative Genomics, 4, 59-66.

Distelfeld, A., Uauy, C., Fahima, T. & Dubcovsky, J. (2006). Physical map of the wheat high-

grain protein content gene Gpc-B1 and development of a high-throughput molecular

marker. New Phytologist, 169, 753-763.

Dohlman, E. & Hoffman, L. (2000). The new agricultural trade negotiations: background and

issues for the US wheat sector. Wheat Situation and Outlook Yearbook, WHS-2000, 35-

46.

Dolezel, J., Vrana, J., Safar, J., Bartos, J., Kubalakova, M. & Simkova, H. (2012).

Chromosomes in the flow to simplify genome analysis. Functional and Integrative

Genomics, 12, 397-416.

Dubcovsky, J., Ramakrishna, W., SanMiguel, P. J., Busso, C. S., Yan, L., Shiloff, B. A. &

Bennetzen, J. L. (2001). Comparative sequence analysis of colinear barley and rice

bacterial artificial chromosomes. Plant Physiology, 125, 1342-1353.

Dvorak, J., Terlizzi, P., Zhang, H. & Resta, P. (1993). The evolution of polyploid wheats:

identification of the A genome donor species. Genome, 36, 21-31.

Dvorak, J. & Akhunov, E. (2005). Tempos of gene locus deletions and duplications and their

relationship to recombination rate during diploid and polyploid evolution in the Aegilops-

Triticum alliance. Genetics, 171, 323-332.

Dvorak, J., Akhunov, E., Akhunov, A., Deal, K. R. & Luo, M. (2006). Molecular

characterization of a diagnostic DNA marker for domesticated tetraploid wheat provides

evidence for gene flow from wild tetraploid wheat to hexaploid wheat. Molecular

Biology and Evolution, 23, 1386-1396.

Endo, T. R. & Gill, B. S. (1996). The deletion stocks of common wheat. Journal of Heredity,

87, 295-307.

Fahima, T., Roder, M. S., Grama, A. & Nevo, E. (1998). Microsatellite DNA polymorphism

divergence in Triticum dicoccoides accessions highly resistant to yellow rust. Theoretical

and Applied Genetics, 96, 187-195.

Feldman, M. & Sears, E. R. (1981). The wild gene resources of wheat. Scientific American,

244, 102-112.

Feldman, M., Lupton, F. G. H., Miller, T. E. & Feldman, M. (1995). Wheats. In: Smartt J,

Simmonds NW (Eds). Evolution of Crops, Vol. 2, London: Longman Scientific, 184-192.

Feuillet, C., Penger, A., Gellner, K., Mast, A. & Keller, B. (2001). Molecular evolution of

receptor-like kinase genes in hexaploid wheat. Independent evolution of orthologs after

polyploidization and mechanisms of local rearrangements at paralogous loci. Plant

Physiology, 125, 1304-1313.

Feuillet, C. & Eversole, K. (2007). Physical mapping of the wheat genome: A coordinated

effort to lay the foundation for genome sequencing and develop tools for breeders. Israel

Journal of Plant Sciences, 55, 307-313.

Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 25

Feuillet, C., Stein, N., Rossini, L., Praud, S., Mayer, K., Schulman, A., Eversole, K. &

Appels, R. (2012). Integrating cereal genomics to support innovation in the Triticeae.

Functional and Integrative Genomics, 12, 573-583.

Frenkel, Z., Paux, E., Mester, D., Feuillet, C. & Korol, A. (2010). LTC: a novel algorithm to

improve the efficiency of contig assembly for physical mapping in complex genomes.

BMC Bioinformatics, 11, 584.

Fu, D., Uauy, C., Blechl, A., Epstein, L., Chen, X. M., Distelfeld, A., Sela, H., Fahima, T. &

Dubcovsky, J. (2009). A novel kinase-START gene confers temperature-dependent

resistance to wheat stripe rust. Science, 323, 1357-1360.

Ganal, M. W. & Röder, M. S. (2007). Microsatellite and SNP markers in wheat breeding. In:

Varshney R, Tuberosa R (Eds). Genomics-Assisted Crop Improvement, Vol. 2, Springer:

Dordrecht, Netherlands, 1-24.

Gerechter-Amitai, Z. K. & Stubbs, R. W. (1970). A valuable source of yellow rust resistance

in Israeli populations of wild emmer, Triticum dicoccoides Koern. Euphytica, 19, 12-21.

Gerechter-Amitai, Z. & Silfhout, C. H. (1984). Resistance to powdery mildew in wild emmer

(Triticum dicoccoides Körn.). Euphytica, 33, 273-280.

Gerechter-Amitai, Z. & Van Silfhout, C. (1989). Race-specificity of temperature-sensitive

genes for resistance to Puccinia striiformis in Triticum dicoccoides. Euphytica, 43, 7-14.

Goff, S. A., Ricke, D., Lan, T. H., Presting, G. & Wang, R. et al. (2002). A draft sequence of

the rice genome (Oryza sativa L. ssp. japonica). Science, 296, 92-100.

Grama, A., Gerechter-Amitai, Z. K. & Blum, A. (1983). Wild emmer as a donor of genes for

resistance to stripe rust and for high protein content. In: Sakamoto S (Ed). Proceedings of

the 6th International Wheat Genetics Symposium. Kyoto, Japan: Plant Germplasm

Institute, University of Kyoto, 187-192.

Haga, H., Yamada, R., Ohnishi, Y., Nakamura, Y. & Tanaka, T. (2002). Gene-based SNP

discovery as part of the Japanese Millennium Genome Project: identification of 190 562

genetic variations in the human genome. Journal of Human Genetics, 47, 0605-0610.

Harlan, J. R. & Zohary, D. (1966). Distribution of wild wheat and barley. Science, 153,

1074-1080.

Haudry, A., Cenci, A., Ravel, C., Bataillon, T., Brunel, D., Poncet, C., Hochu, I., Poirier, S.,

Santoni, S. & Glemin, S. (2007). Grinding up wheat: a massive loss of nucleotide

diversity since domestication. Molecular Biology and Evolution, 24, 1506-1517.

Helguera, M., Khan, I. & Dubcovsky, J. (2000). Development of PCR markers for the wheat

leaf rust resistance gene Lr47. Theoretical and Applied Genetics, 100, 1137-1143.

Helguera, M., Vanzetti, L., Soria, M., Khan, I., Kolmer, J. & Dubcovsky, J. (2005).

PCR markers for leaf rust resistance gene and their use to develop isogenic hard red

spring wheat lines. Crop Science, 45, 728-734.

Hollister, J. D. & Gaut, B. S. (2009). Epigenetic silencing of transposable elements: a trade-

off between reduced transposition and deleterious effects on neighboring gene

expression. Genome Research, 19, 1419-1428.

Huang, S., Sirikhachornkit, A., Su, X., Faris, J., Gill, B., Haselkorn, R. & Gornicki, P. (2002).

Genes encoding plastid acetyl-CoA carboxylase and 3-phosphoglycerate kinase of the

Triticum/Aegilops complex and the evolutionary history of polyploid wheat. Proceedings

of the National Academy of Sciences of the USA, 99, 8133-8138.

International Brachypodium Initiative. (2010). Genome sequencing and analysis of the model

grass Brachypodium distachyon. Nature, 463, 763-768.

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 26

International Rice Genome Sequencing Project. (2005). The map-based sequence of the rice

genome. Nature, 436, 793-800.

Joppa, L. & Williams, N. (1988). Langdon durum disomic substitution lines and aneuploid

analysis in tetraploid wheat. Genome, 30, 222-228.

Joppa, L. & Cantrell, R. (1990). Chromosomal location of genes for grain protein content of

wild tetraploid wheat. Crop Science, 30, 1059-1064.

Joppa, L., Du, C., Hart, G. E. & Hareland, G. A. (1997). Mapping gene(s) for grain protein in

tetraploid wheat (Triticum turgidum L.). using a population of recombinant inbred

chromosome lines. Crop Science, 37, 1586-1589.

Kato, K., Mori, Y., Beiles, A. & Nevo, E. (1997). Geographical variation in heading traits in

wild emmer wheat, Triticum dicoccoides. I. Variation in vernalization response and

ecological differentiation. Theoretical and Applied Genetics, 95, 546-552.

Komori, T. & Nitta, N. (2005). Utilization of the CAPS/dCAPS method to convert rice SNPs

into PCR-based markers. Breeding Science, 55, 93-98.

Krugman, T., Chagué, V., Peleg, Z., Balzergue, S., Just, J., Korol, A. B., Nevo, E., Saranga,

Y., Chalhoub, B. & Fahima, T. (2010). Multilevel regulation and signaling processes

associated with adaptation to terminal drought in wild emmer wheat. Functional and

Integrative Genomics, 10, 167-186.

Krugman, T., Peleg, Z., Quansah, L., Chagué, V., Korol, A. B., Nevo, E., Saranga, Y., Fait,

A., Chalhoub, B. & Fahima, T. (2011). Alteration in expression of hormone-related genes

in wild emmer wheat roots associated with drought adaptation mechanisms. Functional

and Integrative Genomics, 11, 565-583.

Levy, A. & Feldman, M. (1988). Ecogeographical distribution of HMW glutenin alleles in

populations of the wild tetraploid wheat Triticum turgidum var. dicoccoides. Theoretical

and Applied Genetics, 75, 651-658.

Line, R. F. & Chen, X. (1995). Successes in breeding for and managing durable resistance to

wheat rusts. Plant Disease, 79, 1254-1255.

Liu, Z., Anderson, J., Hu, J., Friesen, T., Rasmussen, J. & Faris, J. (2005). A wheat

intervarietal genetic linkage map based on microsatellite and target region amplified

polymorphism markers and its utility for detecting quantitative trait loci. Theoretical and

Applied Genetics, 111, 782-794.

Luo, M. C., Thomas, C., You, F. M., Hsiao, J., Ouyang, S., Buell, C. R., Malandro, M.,

McGuire, P. E., Anderson, O. D. & Dvorak, J. (2003). High-throughput fingerprinting of

bacterial artificial chromosomes using the snapshot labeling kit and sizing of restriction

fragments by capillary electrophoresis. Genomics, 82, 378-389.

Mago, R., Brown-Guedira, G., Dreisigacker, S., Breen, J., Jin, Y., Singh, R., Appels, R.,

Lagudah, E., Ellis, J. & Spielmeyer, W. (2011). An accurate DNA marker assay for stem

rust resistance gene Sr2 in wheat. Theoretical and Applied Genetics, 122, 735-744.

Mayer, K. F. X., Taudien, S., Martis, M., Simkova, H., Suchankova, P., Gundlach, H.,

Wicker, T., Petzold, A., Felder, M., Steuernagel, B., Scholz, U., Graner, A., Platzer, M.,

Dolezel, J. & Stein, N. (2009). Gene content and virtual gene order of barley

chromosome 1H. Plant Physiology, 151, 496-505.

Mayer, K. F. X., Martis, M., Hedley, P. E., Simkova, H., Liu, H., Morris, J. A., Steuernagel,

B., Taudien, S., Roessner, S. & Gundlach, H. (2011). Unlocking the barley genome by

chromosomal and comparative genomics. Plant Cell, 23, 1249-1263.

Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 27

McCallum, C. M., Comai, L., Greene, E. A. & Henikoff, S. (2000). Targeted screening for

induced mutations. Nature Biotechnology, 18, 455-457.

McFadden, E. S. & Sears, E. R. (1946). The origin of Triticum spelta and its free-threshing

hexaploid relatives. Journal of Heredity, 37, 81-89.

Michaels, S. D. & Amasino, R. M. (1998). A robust method for detecting single-nucleotide

changes as polymorphic markers by PCR. The Plant Journal, 14, 381-385.

Milus, E. & Line, R. (1986a). Gene action for inheritance of durable, high-temperature, adult-

plant resistance to stripe rust in wheat. Phytopathology, 76, 435-411.

Milus, E. & Line, R. (1986b). Number of genes controlling high-temperature, adult-plant

resistance to stripe rust in wheat. Phytopathology, 76, 93-96.

Morrell, P. L., Toleno, D. M., Lundy, K. E. & Clegg, M. T. (2006). Estimating the

contribution of mutation, recombination and gene conversion in the generation of

haplotypic diversity. Genetics, 173, 1705-1723.

Moseman, J. G., Nevo, E., Gerechter-Amitai, Z. K., El-Morshidy, M. A. & Zohary, D.

(1985). Resistance of Triticum dicoccoides collected in Israel to infection with Puccinia

recondita tritici. Crop Science, 25, 262-265.

Mullan, D. J., Platteter, A., Teakle, N. L., Appels, R., Colmer, T. D., Anderson, J. M. &

Francki, M. G. (2005). EST-derived SSR markers from defined regions of the wheat

genome to identify Lophopyrum elongatum specific loci. Genome, 48, 811-822.

Murphy, L. R., Santra, D., Kidwell, K., Yan, G., Chen, X. & Campbell, K. G. (2009).

Linkage maps of wheat stripe rust resistance genes and for use in marker-assisted

selection. Crop Science, 49, 1786-1786.

Nevo, E., Gerechter-Amitai, Z., Beiles, A. & Golenberg, E. M. (1986). Resistance of wild

wheat to stripe rust: Predictive method by ecology and allozyme genotypes. Plant

Systematics and Evolution, 153, 13-30.

Nevo, E., Korol, A. B., Beiles, A. & Fahima, T. (2002). Evolution of wild emmer and wheat

improvement: Population genetics, genetic resources, and genome organization of

wheat's progenitor, Triticum dicoccoides. Berlin, Germany: Springer-Verlag.

Oerke, E. C. (2006). Crop losses to pests. The Journal of Agricultural Science, 144, 31-43.

Okon, S., Kowalczyk, K. & Miazga, D. (2012). Identification of Ppd-B1 alleles in common

wheat cultivars by CAPS marker. Russian Journal of Genetics, 48, 532-537.

Olmos, S., Distelfeld, A., Chicaiza, O., Schlatter, A. R., Fahima, T., Echenique, V. &

Dubcovsky, J. (2003). Precise mapping of a locus affecting grain protein content in

durum wheat. Theoretical and Applied Genetics, 107, 1243-1251.

Paterson, A. H., Bowers, J. E., Bruggmann, R., Dubchak, I., Grimwood, J., Gundlach, H.,

Hellsten, U., Mitros, T. & Poliakov, A. (2009). The Sorghum bicolor genome and the

diversification of grasses. Nature, 457, 551-556.

Paux, E., Roger, D., Badaeva, E., Gay, G., Bernard, M., Sourdille, P. & Feuillet, C. (2006).

Characterizing the composition and evolution of homoeologous genomes in hexaploid

wheat through BAC- end sequencing on chromosome 3B. The Plant Journal, 48,

463-474.

Paux, E., Sourdille, P., Salse, J., Saintenac, C. & Choulet, F. et al. (2008). A physical map of

the 1-gigabase bread wheat chromosome 3B. Science, 322, 101-104.

Paux, E., Faure, S., Choulet, F., Roger, D., Gauthier, V., Martinant, J. P., Sourdille, P.,

Balfourier, F., Le, P. M. C., Chauveau, A., Cakir, M., Gandon, B. & Feuillet, C. (2010).

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 28

Insertion site-based polymorphism markers open new perspectives for genome saturation

and marker-assisted selection in wheat. The Plant Biotechnology Journal, 8, 196-210.

Peleg, Z., Fahima, T., Abbo, S., Krugman, T., Nevo, E., Yakir, D. & Saranga, Y. (2005).

Genetic diversity for drought resistance in wild emmer wheat and its ecogeographical

associations. Plant, Cell and Environment, 28, 176-191.

Peleg, Z., Saranga, Y., Yazici, A., Fahima, T., Ozturk, L. & Cakmak, I. (2008a). Grain zinc,

iron and protein concentrations and zinc-efficiency in wild emmer wheat under

contrasting irrigation regimes. Plant and Soil, 306, 57-67.

Peleg, Z., Fahima, T., Abbo, S., Krugman, T. & Saranga ,Y. (2008b). Genetic structure of

wild emmer wheat populations as reflected by transcribed versus anonymous SSR

markers. Genome, 51, 187-195.

Peleg, Z., Fahima, T., Krugman, T., Abbo, S., Yakir, D., Korol, A. B. & Saranga, Y. (2009).

Genomic dissection of drought resistance in durum wheat × wild emmer wheat

recombinant inbreed line population. Plant, Cell and Environment, 32, 758-779.

Peng, J., Korol, A. B., Fahima, T., Röder, M. S., Ronin, Y. I., Li, Y. C. & Nevo, E. (2000).

Molecular genetic maps in wild emmer wheat, Triticum dicoccoides: genome-wide

coverage, massive negative interference, and putative quasi-linkage. Genome Research,

10, 1509-1531.

Peng, J. H., Fahima, T., Röder, M. S., Li, Y. C., Dahan, A., Grama, A., Ronin, Y. I., Korol,

A. B. & Nevo, E. (1999). Microsatellite tagging of the stripe-rust resistance gene YrH52

derived from wild emmer wheat, Triticum dicoccoides, and suggestive negative crossover

interference on chromosome 1B. Theoretical and Applied Genetics, 98, 862-872.

Philippe, R., Choulet, F., Paux, E., van Oeveren, J., Tang, J., Wittenberg, A. H., Janssen, A.,

van Eijk, M. J., Stormo, K. & Alberti, A. (2012). Whole genome profiling provides a

robust framework for physical mapping and sequencing in the highly complex and

repetitive wheat genome. BMC Genomics, 13, 47.

Qayoum, A. & Line, R. (1985). High-temperature, adult-plant resistance to stripe rust of

wheat. Phytopathology, 75, 1121-1125.

Qi, L., Echalier, B., Chao, S., Lazo, G., Butler, G., Anderson, O., Akhunov, E., Dvorak, J.,

Linkiewicz, A. & Ratnasiri, A. (2004). A chromosome bin map of 16,000 expressed

sequence tag loci and distribution of genes among the three genomes of polyploid wheat.

Genetics, 168, 701-712.

Raats, D., Frenkel, Z., Krugman, T., Dodek, I., Sela, H., et al. (2013). The physical map of

wheat chromosome 1BS provides insights into its gene space organization and evolution.

Genome Biology, 14, R138. DOI: 10.1186/gb-2013-14-12-r138.

Ramakrishna, W., Dubcovsky, J., Park, Y., Busso, C., Emberton, J., SanMiguel, P. &

Bennetzen, J. L. (2002). Different types and rates of genome evolution detected by

comparative sequence analysis of orthologous segments from four cereal genomes.

Genetics, 162, 1389-1400.

Röder, M. S., Korzun, V., Wendehake, K., Plaschke, J., Tixier, M. H., Leroy, P. & Ganal, M.

W. (1998). A microsatellite map of wheat. Genetics, 149, 2007-2023.

Rudd, S. (2003). Expressed sequence tags: alternative or complement to whole genome

sequences? Trends in Plant Science, 8, 321-329.

Safar, J., Bartos, J., Janda, J., Bellec, A., Kubalakova, M., Valarik, M., Pateyron, S.,

Weiserova, J., Tuskova, R. & Cihalikova, J. (2004). Dissecting large and complex

Application of CAPS Markers for Genomic Studies in Wild Emmer Wheat 29

genomes: flow sorting and BAC cloning of individual chromosomes from bread wheat.

The Plant Journal, 39, 960-968.

Safar, J., Simkova, H., Kubalakova, M., Cihalikova, J., Suchankova, P., Bartos, J. & Dolezel,

J. (2010). Development of chromosome-specific BAC resources for genomics of bread

wheat. Cytogenetics and Genome Research, 129, 211-223.

Seyfarth, R., Feuillet, C., Schachermayr, G., Winzeler, M. & Keller, B. (1999). Development

of a molecular marker for the adult plant leaf rust resistance gene Lr35 in wheat.

Theoretical and Applied Genetics, 99, 554-560.

Somers, D. J., Isaac, P. & Edwards, K. (2004). A high-density microsatellite consensus map

for bread wheat (Triticum aestivum L.). Theoretical and Applied Genetics, 109,

1105-1114.

Sourdille, P., Singh, S., Cadalen, T., Brown-Guedira, G., Gay, G., Qi, L., Qi, L. L., Dufour,

P., Murigneux, A. & Bernard, M. (2004). Microsatellite-based deletion bin system for the

establishment of genetic-physical map relationships in wheat (Triticum aestivum L.).

Functional and Integrative Genomics, 4, 12-25.

Sun, G. L., Fahima, T., Korol, A. B., Turpeinen, T., Grama, A., Ronin, Y. I. & Nevo, E.

(1997). Identification of molecular markers linked to the Yr15 stripe rust resistance gene

of wheat originated in wild emmer wheat, Triticum dicoccoides. Theoretical and Applied

Genetics, 95, 622-628.

Tajima, F. (1983). Evolutionary relationship of DNA sequences in finite populations.

Genetics, 105, 437-460.

Tang, H., Bowers, J. E., Wang, X., Ming, R., Alam, M. & Paterson, A. H. (2008). Synteny

and collinearity in plant genomes. Science, 320, 486-488.

Tanksley, S. D. & McCouch, S. R. (1997). Seed banks and molecular maps: unlocking

genetic potential from the wild. Science, 277, 1063-1066.

The, T. T., Nevo, E. & McIntosh, R. A. (1993). Responses of Israeli wild emmers to selected

Australian pathotypes of Puccinia species. Euphytica, 71, 75-81.

Trick, M., Adamski, N. M., Mugford, S. G., Jiang, C., Febrer, M. & Uauy, C. (2012).

Combining SNP discovery from next-generation sequencing data with bulked segregant

analysis (BSA) to fine-map genes in polyploid wheat. BMC Plant Biology, 12, 14.

Uauy, C., Brevis, J. C., Chen, X., Khan, I., Jackson, L., Chicaiza, O., Distelfeld, A., Fahima,

T. & Dubcovsky, J. (2005). High-temperature adult-plant (HTAP) stripe rust resistance

gene Yr36 from Triticum turgidum ssp. dicoccoides is closely linked to the grain protein

content locus Gpc-B1. Theoretical and Applied Genetics, 112, 97-105.

Uauy, C., Distelfeld, A., Fahima, T., Blechl, A. & Dubcovsky, J. (2006). A NAC gene

regulating senescence improves grain protein, zinc, and iron content in wheat. Science,

314, 1298-1301.

Wicker, T., Mayer, K. F. X., Gundlach, H., Martis, M., Steuernagel, B., Scholz, U., Šimková,

H., Kubaláková, M., Choulet, F. & Taudien, S. (2011). Frequent gene movement and

pseudogene evolution is common to the large and complex genomes of wheat, barley,

and their relatives. Plant Cell, 23, 1706-1718.

Wright, S. I., Bi, I. V., Schroeder, S. G., Yamasaki, M., Doebley, J. F., McMullen, M. D. &

Gaut, B. S. (2005). The effects of artificial selection on the maize genome. Science, 308,

1310-1314.

Xie, W., Ben-David, R., Zeng, B., Distelfeld, A., Röder, M. S., Dinoor, A. & Fahima, T.

(2012). Identification and characterization of a novel powdery mildew resistance gene

Dina Raats, Elitsur Yaniv, Assaf Distelfeld et al. 30

PmG3M derived from wild emmer wheat, Triticum dicoccoides. Theoretical and Applied

Genetics, 124, 911-922.

Young, N. D. & Tanksley, S. D. (1989). Restriction fragment length polymorphism maps and

the concept of graphical genotypes. Theoretical and Applied Genetics, 77, 95-101.

Yu, J., Hu, S., Wang, J., Wong, G. K. S., Li, S., Liu, B., Deng, Y., Dai, L., Zhou, Y. &

Zhang, X. (2002). A draft sequence of the rice genome (Oryza sativa L. ssp. indica).

Science, 296, 79-92.