Nucleic Acids Research, 1994, Vol. 22, No. 12 2417-2422

Apo CIII gene transcription is regulated by a cytokineinducible NF-xB element

Peter J.Gruber3'+, Adrian Torres-Rosado1l2 §, Michael L.Wolak1'2 and Todd Leff',23,*1Department of Biotechnology, Parke-Davis, 2800 Plymouth Rd, Ann Arbor, Ml 48105,2Department of Biological Chemistry, University of Michigan, Ann Arbor, Ml 48104 and 3BiochemicalGenetics and Metabolism, The Rockefeller University, New York, NY 10021, USA

Received October 28, 1993; Revised December 22, 1993 and Accepted May 17, 1994

ABSTRACT

Overproduction of Apo Cil causes elevated plasmatriglyceride levels in transgenic animals and isassociated with hypertriglyceridemia in humans. Theregulation of apo Cil production is likely to play animportant role in controlling plasma triglyceride levels.As an initial step in determining the role oftranscriptional regulation in the production of apo CilIand in triglyceride metabolism, we have begun tocharacterize the activity of specific transcriptionalregulatory elements in the Cil promoter. In the currentstudy, we have identified and characterized an NF-xBregulatory element located 150 nucleotides upstreamfrom the transcriptional start site of the apo Clil gene.Purified NF-xB, as well as an NF-xB protein in HepG2cell nuclear extracts, bound specifically to thissequence element. The hepatic protein was induced byphorbol ester (PMA), and reacted with antibodies to thep50 and p65 subunits of NF-xB. The NF-xB elementconferred PMA and ILl -, inducible transcriptionalactivity to a heterologous promoter/reporter constructwhen transfected into HepG2 cells. Analysis of the fulllength Cil promoter demonstrated that the inducibleactivity of the NF-xB element was suppressed bysequences in the apo Cil enhancer element locatedapproximately 500 nucleotides upstream of the NF-xBbinding site. A deletion removing the enhancer restoredthe PMA inducible activity of the NF-xB binding site.These results indicate that apo Cil gene expression isregulated by NF-xB, and suggest that apo CilIproduction may be modulated by cellular signals, likeinflammatory cytokines, that activate NF-kB.

INTRODUCTIONApo CHI is a component of very low density lipoprotein (VLDL)which is the major carrier of triglycerides in plasma (1). Althoughthe metabolic function of apo CII is not clearly understood,several lines of evidence suggest a key role in the regulation ofplasma triglyceride levels. The most direct evidence is fromstudies with transgenic mice which have shown that over-

*To whom correspondence should be addressed at: Department of Biotechnology,

expression of a human apo CIII transgene can causehypertriglyceridemia (2,3). Triglyceride levels were proportionalto the level of transgene expression and as little as 30-40%excess apo CIII could double the triglyceride levels. In additionto the transgenic mouse studies, a number of other lines ofevidence link apo CIII to the control of triglyceride metabolism.In humans, studies have shown a strong association of a geneticpolymorphism in the apo CHI locus with elevated triglyceridelevels in several populations (4-8). Clinical studies have reportedthat some hypertriglyceridemic patients have elevated apo CHIlevels (9,10) and increased apo CIII production rates (11,12).In addition, it has been suggested on the basis of in vitro andin vivo data that apo CHI raises triglyceride levels by inhibitingthe removal of VLDL remnants from the circulation (3,13,14),and/or by inhibiting the activity of lipoprotein lipase (LPL), theenzyme that hydrolyzes triglycerides carried by VLDL particles(15). Taken together, these studies indicate that the apo CHIproduction rate is an important determinant of plasma triglyceridelevels. If production rate is influenced by transcriptional activity,then the regulation of apo CHI transcription by metabolic signalsmay play an important role in the modulation of triglyceridemetabolism. As an initial step in testing this hypothesis weexamined the apo CHI promoter for candidate regulatory elementsthat might be involved in transcriptional response to cellular signaltransduction pathways.

In the current manuscript, we demonstrate that the apo CIIIgene promoter contains a binding site for the inducibletranscription factor NF-xB. NF-xB mediates transcriptionalresponses to a variety of signals depending on the cellularenvironment and physiological situation. The presence of an NF-xB regulatory element in the CIII promoter implies that CHItranscriptional activity is temporally regulated by specific cellularsignals. The NF-xB binding site in the CII promoter (designatedC3N1) binds to purified NF-xB as well as to an NF-xB proteinin HepG2 cell nuclear extracts. Transcriptional analysis of theisolated C3N1 sequence in transfected HepG2 cells showed thatthe C3N1 element was inducible by phorbol ester (PMA) andthe inflammatory cytokine interleukin-1I3 (IL-1,8). In contrast tothe inducibility of the isolated C3N1 region, the apo CHIpromoter (containing the same sequence in its natural context)

Parke-Davis, 2800 Plymouth Rd, Ann Arbor, MI 48105, USA

Present addresses: 'Department of Surgery, Johns Hopkins Hospital, 401 North Wolfe Street, Baltimore, MD 21287-4618, USA and §Abbot Diagnostic Inc.,PO box 278, Barceloneta, Puerto Rico 00617

1994 Oxford University Press

2418 Nucleic Acids Research, 1994, Vol. 22, No. 12

was not inducible by PMA. However, when sequences in theapo CIII enhancer, located 500 nucleotides upstream of the NF-xB site were deleted, the inducibility of the C3N1 element wasrecovered. These results indicate that the regulation of apo CIItranscription by NF-xB is complex, involving multiple regulatoryelements, and suggests that the apo Cm production rate mightbe influenced by cellular signals that modulate NF-xB.

MATERIALS AND METHODSPlasmid constructionsThe vector pXT was derived from the CAT expression vectorpCT (16) and contains the adenovirus major late promotersequences from -50 to +33 linked directly to 60 nucleotidesof the SV40 early region noncoding leader sequence (SV40sequences 5235-5175). Synthetic oligonucleotides representingboth strands of the C3N1 sequence were prepared in an AppliedBiosystems synthesizer. After hybridization, this fragment wasinserted into a unique SalI site in pXT located 60 nt upstreamof the adenovirus promoter transcriptional start site to createpXN1. The sequence of the C3N1 oligonucleotide was TAGGG-ATTTCCCAACTCTCGGG (underline indicates NF-xB sitehomology). Multiple copies of this fragment were tandemly linkedby self ligation and inserted into the same site of pXT to createpXN2 and pXN4 (contained two and four copies of the C3N1fragment respectively). The positive control pXkB contained twotandemly linked copies of a double stranded oligonucleotidederived from the sequence of the NF-xB binding site in the PRDIIelement of the ,B-interferon gene promoter (17,18). The sequenceof this oligo was 5'-GATCTGTGGGAAATTCCGTGGG-AAATTCCGGATC-3', and contained two binding sites for NF-xB (underlined). Thus pXkB contained four copies of theNFS0023-xB binding site.The plasmid pM854 consisted of the human apo CII promoter

(-854 to +22) linked to the chloramphenicol acetyl transferase(CAT) gene. pM854 differs from its parent construction pKT-apo CIII (19,20) by three single nucleotide substitutions at -94(C to G), -96 (C to G), and - 125 (C to A). This created uniquerestriction endonuclease sites at - 126 (NdeI) and -96 (XwoI).These changes did not effect the transcriptional activity of theapo CEII promoter (unpublished observations and 21). pM169was made from pM854 by deletion of the KpnI- TthIlll fragmentbetween -854 and - 169, leaving the remainder of the apo CHIpromoter from - 169 to +22. pM169b is the same as pM 169except for a mutation of the C3N1 element (TAGGGATTTCCC-AA changed to TAGGtcggtaCCAA). pM169c is identical topM169 except for a mutation in the C3N2 element that changed11 nucleotides in the center of the N2 element. The wild-typesequence is -149 AACTCTCCCGCCCGCTTGCT -130, themutant sequence is -149 AACTCTCgtagctaagcGCT - 130. ThepM 125 plasmid was made from pM854 by removing theKpnI-NdeI fragment (-854 to - 126). pM169h was constructedfrom pM854 by removal of the internal StuI- Tth]III fragment(-690 to -169). All constructions were confirmed by DNAsequencing.

Nuclear extracts and mobility shift assaysHepG2 cells at approximately 80% confluence were grown inserum free medium for 24 h and then treated with PMA (100ng/ml) in DMSO or with DMSO alone for an additional 8 h.Cells were harvested by scraping and nuclear extracts prepared

kind gift of Dr David Baltimore, Rockefeller University. Purifiedrecombinant human NF-xB (p50 subunit) was prepared frombacteria containing a partial p105 cDNA clone in the expressionvector pGEX-2T (Pharmacia Biotech, Inc.). The fusion protein,p5O amino acids 2-293 linked to glutathione-S-transferase, was

purified from bacterial lysates using a glutathione affinity columnas described by the manufacturer.The double stranded oligonucleotides were end labeled with

32P by T4 polynucleotide kinase. Binding reactions for mobilityshift experiments were carried out in 20 mM HEPES pH 7.9,60 mM KCl, 4% Ficoll, 1 mM MgCl2, 0.06% NP40, 1 mMDTT, 1 mg poly(dI-dC), 10,000-20,000 c.p.m. of labeled probe(approximately 0.5 ng) and either 1-5 ,ug of nuclear extract or10-200 ng of purified protein. After the addition of nuclearextract or purified protein the reactions were incubated for 15minutes at room temperature. Some reactions contained antibodiesto p5O or p65 subunits (Santa Cruz Biotechnology) which wereused according to the manufacture's instructions. Reactions wereanalyzed on 7.5% polyacrylamide, 1/4 x TBE gels run at 100V for 2-4 h at room temperature. The gels were dried andautoradiographed.

Oligonucleotides used as probes in the mobility shift assay weresynthesized in an Applied Biosystems synthesizer. Doublestranded probes were made by hybridization of complementarysingle stranded oligonucleotides and purification of the doublestranded products on non-denaturing polyacrylamide gels. TheNF-xB probe used in the gel mobility shift assay was derivedfrom the PRDII regulatory element from the human (3-interferonpromoter (17,18) with the sequence (5'-GATCTGTGGG-AAATTCCGTGGGAAATTCCGGATC-3'). The sequence ofthe wild-type C3N1 specific probe is (5'-CAGTCTCCTAGGG-ATTTCCCAACTCTC-3'). The sequence of the mutated C3N1probe is (5'-CAGTCTCCTAGGtcggTaCCAACTCTC-3').Probes were labeled with 32P by T4 polynucleotide kinase andy-32P-ATP as described (24).

Transfections and CAT assay

HepG2 cells were obtained from ATCC (Rockville, Maryland)and maintained in MEM supplemented with 10% fetal bovineserum. Transient transfections were performed by the calciumphosphate co-precipitation method as described (19), using 10mg apo CImI/CAT expression vector plasmid, 2 mg of pXGH5as an internal standard, and 10 mg of sonicated salmon spermDNA per 60 mm plate. pXGH5 (Nichols Diagnostics) containsthe human growth hormone coding sequence under the controlof the CMV promoter. Cells were transfected at 30% confluencein media containing serum. The precipitate was removed fromcells after 16 h by rinsing the plates with serum free media. Justprior to the removal of the precipitate, the media was sampledfor growth hormone determination (Nichols Diagnostics, 'AllegrohGH assay kit'). The cells were grown for an additional 12 hin serum free media, and then treated with either 100 ng/ml PMA(Sigma), 200 units/ml IL1-,B (Genzyme), or 200 units/ml TNF-a (Genzyme) for 24 hr. Chloramphenicol acetyl transferaseactivity of equal amounts of cytosolic proteins (Biorad proteinassay system, Biorad) was determined by acetylation of 14C-chloramphenicol (Amersham) followed by thin layerchromatography as described (25). Thin layer chromatogramswere quantified by scintillation counting of spots or by imagingon a Betascope (Betagen). Experiments that showed variationsin transfection efficiency exceeding 15%, as judged by human

as described (22,23). NF-xB purified from rabbit lung was a growth honnone assay, were not used.

Nucleic Acids Research, 1994, Vol. 22, No. 12 2419

RESULTS

Inspection of the apo CII promoter sequence revealed thepresence of a putative NF-xB regulatory element 150 nt upstreamfrom the start of transcription (Fig. 1). This sequence, referredto as C3N1, contains an 9/10 match with the PRDII element inthe ,B-interferon gene promoter (19), a well characterized NF-xB regulatory element (17,18,26), and is identical to an NF-xBelement found in the angiotensinogen gene (Fig. 1). In additionto its homology to other NF-xB elements, the human C3N1sequence is highly conserved in the apo CIII promoters frommouse, rat and pig (20,27,28).To determine if hepatic cells contain an NF-xB like protein

that binds to the C3N1 element, a gel mobility shift assay was

carried out with extracts made from HepG2 cells treated withthe phorbol ester PMA, a potent inducer of NF-xB in a varietyof cell types (29,30). A PMA inducible protein was observedbinding to a 110 nt long fragment of the CHI promoter thatcontains the C3N1 element (Fig. 2). The DNA binding activityof this protein was competed by a 27 nt oligonucleotiderepresenting the C3N1 element sequence, but was not competedby a mutated version of this oligo. This PMA inducible proteinwas also observed when the 27 nt C3N1 oligonucleotide was itselfused as a probe in the gel mobility shift assay (Fig. 3a). ThisC3N1 binding protein co-migrated with a PMA inducible protein

Human apo CIII promoter

-854 -700 -5001 1~~~~~~~~~~~~~~~~~~~~~~~~~~~

-200 -100 +1

nu~~~~~~1 El nlw-~~~~~~~L ni*-- f e

D Enhancer C3N1 N2 P

B NF-kB binding site sequence similarities

Gone Element Sequence

apo Cill C3N1 GGGATTTCCC

Angiotensinogen APRE GGGATTTCCC

Serum Amyloid A -82 to -91 GGGACTTTCC

,B-Interferon PRDII GGGAAATTCC

Ig kappa light chain KB site GGGACTTTCC

Consensus GGGRNNYYCC

Figure 1. NF-xB binding site homology in the human apo CIII promoter. (A) Theregulatory structure of the apo CIII promoter showing the transcriptional startsite (+ 1) and protein binding sites (rectangles). The map summarizes previouslypublished work (19,20,31) and unpublished observations. The region of the apoCHI promoter from -210 to -110 was shown to have a negative effect on basaltranscriptional activity (20) and to contain two protein binding sites, C3N1 (-159to - 150, dark gray box), and immediately downstream, C3N2 (-147 to - 125,N2). The other region referred to in the text, the enhancer (-782 to -690),is indicated. The P element and the D element are positive acting regulatoryelements that bind to constitutive transcription factors (19,20). (B) Comparisonof the C3N1 element sequence to selected NF-xB binding site sequences. TheC3N1 sequence and the PRDII sequence are a 9 out of 10 match when the oppositestrand of the CIII sequence is used for the comparison. The consensus sequenceis derived from a larger group of sequences than shown (22). References foreach sequence are: apo CHI (20), angiotensinogen (37), serum amyloid, (45),(3-interferon (17), kappa light chain (48).

that bound to probes representing the PRDII and kappa light chaingene NF-xB sites (Fig. 3a). When antibodies to the p50 or thep65 subunits of NF-xB were included in the DNA bindingreactions, super-shifted bands were seen in both cases (Fig. 3b).These results confirm that the C3N1 binding activity in PMAtreated extracts is NF-xB, and that at least a portion of this activitycontains the p50 and p65 subunits of the NF-xB protein. Thedegree of induction of NF-xB activity by PMA in theseexperiments ranged from about 6- to 15-fold, as judged bydensitometric scanning of the autoradiograms. This degree ofstimulation is consistent with that observed in other studies inHepG2 cells (43). The binding of NF-xB to the C3N1 regionwas confirmed by a gel mobility shift assay using purified NF-xB proteins and C3N1 site DNA probe. The results (Fig. 3c)confirm that NF-xB binds to the C3N1 element, although witha somewhat lower affinity than it binds to the kappa light chainelement. A similar binding specificity was observed with purifiedrecombinant human NF-xB p50 homodimers (Fig. 3d). Together,these results demonstrate that the C3N1 element is a binding sitefor at least two forms of NF-xB.The transcriptional activity of the C3N1 element was examined

using a heterologous promoter/reporter construct containing theC3N1 sequence inserted upstream of a minimal promoter. Whentransfected into HepG2 cells, the minimal promoter vector wasnot inducible by IL-,3, TNF-ca or by PMA, while the constructioncontaining four copies of the C3N1 element (pXN4) was stronglyinduced by PMA (11.2-fold) and IL1-,B (5.3-fold), but onlyweakly by TNF-ct (1.9-fold) (Fig. 4). A positive controlconstruction (pXkB), containing four copies of the PRDII NF-xB binding element, showed very similar transcriptional responseto PMA and cytokine treatment (12.0-fold stimulation by PMAand a 6.3-fold stimulation by IL1-(3) (Fig. 4). Both constructionswere also PMA inducible when transfected into HeLa cells, anepithelial cell line that is well characterized with regard to NF-xB activity. In HeLa cells, transcription from pXN4 was induced13.7-fold, and transcription from pXkB was induced 14.5-foldby PMA treatment, relative to the control plasmid pXLO (datanot shown).

N1/N2 region Probe

- - - Ni - Ni Comp

- + + + + + PMA

HepG2 NE

Figure 2. Binding of a PMA inducible protein to the C3N1 element. Gel mobilityshift analysis of HepG2 cell nuclear proteins binding to a 112 nt fragment ofthe apo CIII promoter (-196 to -84) containing the C3N1 and C3N2 elements.Some nuclear extracts were prepared from cells treated with PMA as indicated.Competition experiments were carried out with a 100 fold molar excess ofoligonucleotides representing either the C3N1 element (NI) or a mutated versionof the C3N1 element (Ni').

A

2420 Nucleic Acids Research, 1994, Vol. 22, No. 12

The construction pXN2, contains two copies of the C3N1element. When this plasmid was transfected into HepG2 cellsits transcriptional activity was significantly stimulated by PMAtreatment, although to a lower level then the constructioncontaining four copies of the C3N1 element (3.1-fold vs.11.2-fold). Transcriptional activity of PXN2 was also stimulatedby PMA treatment in HeLa cells (4.7-fold, data not shown).pXN2 was not significantly stimulated by either cytokine inHepG2 cells. The construction pXN1, containing a single copyof the C3N1 element, was not significantly stimulated by PMAor either cytokine (Fig. 4) and was only slightly stimulated(2-fold) by PMA in HeLa cells. This requirement for multiplecopies of a regulatory element in a heterologous construct hasbeen observed for other NF-xB elements (18) and may reflecta general lack of transcriptional efficiency in heterologousconstructs. These results confirm the DNA binding experimentsand demonstrate that the C3N1 element can also function as an

.4b

*1*~~~~~~~A6

-e '

*.:B -F

inducible transcriptional regulatory element that can be activatedby PMA and IL1-B.Although the C3N1 element clearly functions as an inducible

regulatory element when isolated in a heterologous sequenceenvironment, its exact function in the overall regulation of apoCIm transcriptional activity was not known. As an initial steptoward characterizing the role of the C3N1 element in thetranscriptional regulation of the apo CHI promoter, we measuredthe effect of PMA treatment on the wild-type apo CIIIpromoter/CAT expression plasmid pM854. Surprisingly, in spiteof the inducibility of the isolated C3N1 element, the full lengthapo CIII promoter was not stimulated by PMA treatment (Fig.5). To determine if neighboring sequences in the promoter wereblocking the activity of the C3N1 element, we measured the PMAresponsiveness of several deletions of the apo CII promoter. Infact, when the upstream region of the promoter from -854 to- 169 was deleted, the resulting construct, pM 169, was induced7-fold by PMA treatment (Fig. 5). This induction required the44 nucleotides surrounding the C3N1 site, as the further deletionof this fragment abolished PMA inducibility (pM125, Fig. 5).These results demonstrate that the apo CHI promoter containsa PMA responsive region located between -169 and -125(containing the C3N1 element), and that the PMA responsivetranscriptional activity of this region is suppressed by sequencesfurther upstream in the promoter.To further characterized the PMA induction, internal mutations

were made in the C3N1 site or in the N2 protein binding sitelocated between - 169 and - 125. The C3N2 mutant (pM 169c)was as responsive as the wild-type pM169 (7-fold stimulation),while the C3N1 mutant (pM169b) showed a muted (3-fold)

ice5.

,I

:1 11L,,, A

----X -rUC TAA CAT pXT_-_.-

Hepu.2 rN-

Figure 3. Interaction of NF-xB with the C3N1 element. Gel mobility shift assaysshowing the interaction of NF-xB proteins with labeled oligonucleotide probesrepresenting NF-xB binding sites from the apo Cm, x light chain and ,3-interferongenes. (A) HepG2 nuclear extracts prepared from cells treated with PMA (-,untreated; +, treated) were incubated with labeled probes representing NF-xBbinding sites from (3-interferon gene promoter (PRDII), the kappa light chaingene enhancer (kB), the apo cm promoter C3N1 element (Ni). A proberepresenting the binding site for the Oct-I transcription factor was included asa control (Oct-i). (B) Gel mobility shift reactions with the C3N1 oligonucleotideprobe and HepG2 cell nuclear extracts were carried out in the presence of antibodiesto the p50 or p65 subunits of NF-xB, as indicated. Extracts from HepG2 cellstreated with PMA, as indicated. (C) Binding of equal amounts of purified rabbitlung NF-xB to oligonucleotide probes representing the kappa light chain geneenhancer (kB), the C3NI element (Ni), and a mutated version of the C3NI element(Ni'). (D) Binding of 200 ng of purified recombinant NF-xB p50 homodimers(from p50-GST fusion protein expressed in bacteria) to oligonucleotide probesrepresenting the kappa light chain gene enhancer (kB), the C3Ni element (NI),and a mutated version of the C3NI element (Ni'). Arrows indicate NF-xB/DNAcomplexes.

pXN1

pXN2

pXN4I=7

pXKB11J 20 30

Relabve CAT actvity

Activationof TranscriptionPMA TNF ILl

1.0 1.0 1.0

2.0 1.1 0.8

3.1* 0.8 1.32

1 1.2* 1.9 5-3*

12.0* 2.8 6.3*

Figure 4. Transcriptional activity of the C3NI element in HepG2 cells.Heterologous promoter/CAT constructs containing copies of the C3Ni element(pXNl, pXN2, pXN4) or the NF-xB element from the kappa light chain gene(pXkB) were transfected into HepG2 cells. Transfected cells were treated withmedia alone (NT), PMA, TNF-a, or ILI-0 for 24 h. CAT activity was measuredand normalized to the hGH internal standard (see Materials and Methods). Bargraphs represent the averages of corrected CAT activity measurements for eachconstruction and each treatment. Each value is the average of 3 -6 experiments.Error bars indicate standard errors. Numbers on the right side indicate the activationof transcription by each of each treatments relative to the activation of the controlconstruction, pXT, by the same treatment. Asterisks indicate values that aresignificantly different (P < 0.05) from control (pXT).

Nucleic Acids Research, 1994, Vol. 22, No. 12 2421

response to PMA (Fig. 5). These results demonstrate that the appears to be inhibited by neighboring sequences (Fig. 5).full activity of the 169 construction requires the NF-xB binding Although the mechanism of this inhibition is unknown, it maysite C3Nl. Taken together, these observations indicate that the involve direct interactions between proteins bound to the upstreamC3Nl sequence acts as a PMA inducible element, and that region and proteins bound to the C3N1 element. Thesesequences located upstream of - 169 can block or suppress this interactions could influence either the transcriptional activity ofinducible activity. This upstream region contains a complex set NF-xB or the specific isoform of NF-xB that binds to the C3N1of protein binding sites and regulatory elements that are element. Interactions between NF-xB regulatory elements withconcentrated within the region -854 to -765 (20,31). To neighboring sequences have been observed in several systemsexamine the role that this region might play in the behavior of (32-34), and interactions between NF-xB proteins and otherthe full length promoter, with regard to PMA stimulation, a transcription factors have been reported (35,36). Of particularfragment containing these sequences (-854 to -690) was interest in this regard is an NF-xB element in the promoter ofinserted upstream of the inducible pM169 construct (pM169h, another gene expressed in the liver, angiotensinogen. ThisFig 5). When this construct was transfected into HepG2 cells, element has been shown to interact with the constitutiveinduction of transcription by PMA was suppressed. These results transcription factor C/EBP in addition to NF-xB (37). C/EBPdemonstrate that sequences located in the 164 nt between -854 was found to attenuate the inducible activity of the NF-xBand -690 act to block or suppress the PMA inducible activity element. It is possible that C/EBP, or a related protein, bindsof the NF-xB element C3N1. to the upstream region of the CHI promoter or to the C3N1

element and influences NF-xB activity. Another possibility isDISCUSSION that the upstream sequences act to favor the binding of less active

forms of NF-xB, such as the p50 homodimer (22). WhateverWe have demonstrated that the apo CIII gene promoter contains the mechanism, this kind of regulatory network may provide aan NF-xB binding site. This binding site, designated C3Nl, can means for differential regulation of apo CHI transcriptionaldirect PMA and IL-1 inducible transcription from a heterologous activity by specific combinations of physiological signals. It ispromoter in HepG2 cells, and appears to be a functional NF-xB possible, for example, that under certain physiological conditionsregulatory element. Surprisingly, in the full length cII promoter, the blocking activity of the apo cII enhancer is inactivated,the inducible activity of the NF-xB element was suppressed by allowing the C3N1 element to become functional. A differentsequences upstream of the C3N1 element. The region responsible set of signals might allow the blocking activity to function therebyfor this activity was narrowed down to 164 nt in the enhancer attenuating or repressing the stimulatory activity of the C3N1region of the CII promoter located approximately 500 nt element.upstream of the C3N1 element. These results suggest that the The observation that the C3N1 element is regulated byregulation of CHI gene expression by NF-xB is complex inflammatory cytokines is consistent with previous findings aboutinvolving the interaction of at least two transcriptional regulatory NF-xB. The cytokines IL1-3 and TNF-ca have been shown toelements. mediate NF-xB activation in many different cell types

In most cases that have been described, NF-xB elicits an (29,38-41). In hepatic cells inflammatory cytokines have beeninduction of transcriptional activity of the genes containing an shown to activate transcription from NF-xB sites in several genesNF-xB regulatory element. It is curious that while the C3N1 (37,42-44). What is the physiological significance of theelement is a transcriptional inducer in a heterologous system, in transcriptional regulation of the apo CHI gene by inflammatoryits natural context (the native apo CHI promoter) its activity cytokines? In the liver, which is the primary site of apo CIII

production, IL1-( and TNF-a are mediators of the hepatic acuteRelative phase response. The acute phase is a programmed response of

Transcriptional Activity the liver to inflammation, tissue injury and other severe acuteFold stresses. One of the potential physiological roles for NF-xB in

854 -700 -.00 -Qoo .1 NT PMA Stimulation the liver is to mediate transcriptional induction of a set of genes.AUJW- pM854 1.00 0.45 0.45 during the hepatic acute phase response. Some of the liver acute

Enharicer N phase genes have been shown to be regulated by NF-xB,{-pM169 0.80 5.83 7.29 including serum amyloid A (33,45) and angiotensinogen (37,44).

We are currently investigating apo CHI transcriptional activity

.4l..FL-J pM169b 0.73 2.43 333 during the acute phase response. Acute inflammation inducesdramatic changes in the production and utilization of many classes

ovnr,pM169c 1.02 6.81 6,68 of lipoproteins including triglyceride rich, apo CII containing,WIl69c 1.02 6.81 6.68 VLDL (46,47). Given the role of the apo CIII protein in

regulating triglyceride metabolism, it is reasonable to postulateI1@...H[}--.3JjJ........J pMl69h 1.21 2.77 2.29 that it participates in the remodeling of lipoprotein metabolism

that occurs during the cytokine mediated hepatic acute phasepM125 0.45 0.62 1.38 response. It is possible that the participation of apo CIII in this

response is mediated by NF-xB and the C3N1 element.

Figure 5. Transcriptional activity of the CImI promoter in HepG2 cells. Apo CIIIpromoter/CAT constructs were transfected into HepG2 cells and treated with mediaalone (NT) or with the PMA (PMA). Values represent corrected CAT activitiesrelative to the activity of the parent construct (pM854) without PMA treatment.Each value is the average of 3-6 experiments. Fold stimulation is the PMA valuedivided by the NT value.

ACKNOWLEDGEMENTSWe would like to that Dr Jan Breslow for helpful discussionsand Nancy Simonson Leff for technical assistance. This workwas carried out as partial fulfillment of the requirements for the

2422 Nucleic Acids Research, 1994, Vol. 22, No. 12

PhD degree from the department of Biochemistry and Biophysics,University of Pennsylvania (PG). TL was an EstablishedInvestigator of the American Heart Association. This work wassupported by grants to TL from the American Heart Associationand the NIH (HL45394).

REFERENCES

1. Havel, R. J. and Kane, J. P. (1989) Structure and metabolism of plasmalipoproteins, In Scriver, R. C., Beaudet, A. L., Sly, W. S., and Valle, D.(eds), The Metabolic Basis of Inherited Disease. McGraw Hill Inc., NewYork, NY. 6th edition, pp.1129-1138.

2. Ito, Y., Azrolan, N., O'Connell, A., Walsh, A., and Breslow, J. L.(1990)Science, 249, 790-793.

3. Aalto-SetdlA, K., Fisher, E. A., Chen, X., Chajek-Shaul, T., Hayek, T.,Zechner, R., Walsh, A., Ramakrishnan, R., Ginsberg, H. N., and Breslow,J. L. (1992)J. Clin. Invest., 90, 1889-1900.

4. Ordovas, J. M., Civeira, F., Genest, J., Jr., Craig, S., Robbins, A. H.,Meade, T., Pocovi, M., Frossard, P. M., Masharani, U., and Wilson, P.W. (1991)Atherosclerosis, 87, 75-86.

5. Rees, A., Stocks, J., Sharpe, C. R., Vella, M. A., Shoulders, C. C., Katz,J., Jowett, N. I., Baralle, F. E., and Galton, D. J. (1985)J. Clin. Invest.,76, 1090-1095.

6. Shoulders, C. C., Harry, P. J., Lagrost, L., White, S. E., Shah, N. F.,North, J. D., Gilligan, M., Gambert, P., and Ball, M. J.(1991)Atherosclerosis, 87, 239-247.

7. Tas, S. (1989)Clin. Chem., 35, 256-259.8. Dammenman, M.D., Sandkuijl, L.A., Halaas, J.L., Chung, W. and Breslow,

J.L. (1993)Proc. Natl. Acad. Sci. USA, 90, 4562-4566.9. Carlson, L. A. and Ballantyne, D. (1976)Atherosclerosis, 23, 563-568.

10. Schonfeld, G., George, P. K., Miller, J., Reilly, P., and Witztum, J. L.(1979)Metabolism, 28, 1001-1010.

11. Le, N.-A., Gibson, J. C., and Ginsberg, H. N. (1988)J. Lipid Res., 29,669-677.

12. Malmendier, C. L., Lontie, J. F., Dubois, D., Delcroix, C., Magot, T.,and De Roy, L. (1988)Adv. Fxp. Med. Biol., 243, 299-309.

13. Shelbume, F., Hanks, J., Meyers, W., and Quarfordt, S. (1980)J. Clin.Invest., 65, 652-658.

14. Windler, E. and Havel, R. J. (1985)J. Lipid Res., 26, 556-565.15. Krauss, R. M., Herbert, P. N., Levy, R. I., and Fredrickson, D. S.

(1973)Circ. Res., 33, 403-411.16. Smith, J. D., Melian, A., Leff, T., and Breslow, J. L. (1988)J. Biol. Chem.,

263, 8300-8308.17. Goodbourn, S., Zinn, K., and Maniatis, T. (1985)Cell, 41, 509-520.18. Lenardo, M. J., Fan, C. M., Maniatis, T., and Baltimore, D. (1989)Cell,

57, 287-294.19. Leff, T., Reue, K., Melian, A., Culver, H., and Breslow, J. L. (1989)J.

Biol. Chem., 264, 16132-16137.20. Reue, K., Leff, T., and Breslow, J. L. (1988)J. Biol. Chem., 263,

6857-6864.21. Gruber, P. (1992) Transcriptional Regulation of the human apo CHI gene.

University of Pennsylvania, Ph.. Thesis.22. Baeuerle, P. A. (1991)Biochim. Biophys. Acta, 1072, 63-80.23. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983)Nucleic Acids

Res., 11, 1475-1489.24. Ausubel, F. M. (1989) Current Protocols in Molecular Biology.

Wiley-Interscience, New York.25. Gorman, C. M., Moffat, L. F., and Howard, B. H. (1982)Mol. Cell. Biol.,

2, 1044-1051.26. Visvanathan, K. V. and Goodbourn, S. (1989)EMBO J., 8, 1129-1138.27. Januzzi, ?., Azrolan, N., O'Connell, A., Aaltosetala, ?., and Breslow, J.

L. (1992)Genomics., 14, 1081-1088.28. Birchbauer, A., Knipping, G., Juritsch, B., Aschauer, H., and Zechner,

R. (1993)Genomics., 15, 643-652.29. Griffin, G. E., Leung, K., Folks, T. M., Kunkel, S., and Nabel, G. J.

(1989)Nature, 339, 70-73.30. Sen, R. and Baltimore, D. (1986)Cell, 47, 921-928.31. Ogami, K., Hadzopoulou-Cladaras, M., Cladaras, C., and Zannis, V. I.

(1990)J. Biol. Chem., 265, 9808-9815.32. Collart, M. A., Baeuerle, P., and Vassalli, P. (1990)Mol. Cell Biol., 10,

1498-1506.33. Li, X. X. and Liao, W. S. (1991)J. Biol. Chem., 266, 15192-15201.

35. Hirai, H., Fujisawa, J., Suzuki, T., Ueda, K., Muramatsu, M., Tsuboi,A., Arai, N., and Yoshida, M. (1992)Oncogene, 7, 1737-1742.

36. LeClair, K. P., Blanar, M. A., and Sharp, P. A. (1992)Proc. Natl. Acad.Sci. USA, 89, 8145-8149.

37. Brasier, A. R., Ron, D., Tate, J. E., and Habener, J. F. (1990)EMBO J.,9, 3933-3944.

38. Anisowicz, A., Messineo, M., Lee, S. W., and Sager, R. (1991)J. Inmmunol.,147, 520-527.

39. Kessler, D. J., Duyao, M. P., Spicer, D. B., and Sonenshein, G. E. (1992)J.Exp. Med., 176, 787-792.

40. Libermann, T. A. and Baltimore, D. (1990)Mol. Cell Biol., 10, 2327-2334.41. Osbom, L., Kunkel, S., and Nabel, G. J. (1989)Proc. Natl. Acad. Sci. USA,

86, 2336-2340.42. Banerjee, R., Karpen, S., Siekevitz, M., Lengyel, G., Bauer, J., and Acs,

G. (1989)Hepatology, 10, 1008-1013.43. Nonaka, M. and Huang, Z. M. (1990)Mol. Cell Biol., 10, 6283-6289.44. Ron, D., Brasier, A. R., Wright, K. A., Tate, J. E., and Habener, J. F.

(1990)Mol. Cell Biol., 10, 1023 -1032.45. Edbrooke, M. R., Burt, D. W., Cheshire, J. K., and Woo, P. (1989)Mol.

Cell Biol., 9, 1908-1916.46. Cabana, V. G., Siegel, J. N., and Sabesin, S. M. (1989)J. Lipid. Res., 30,

39-49.47. Feingold, K. R., Soued, M., Serio, M. K., Moser, A. H., Dinarello, C.

A., and Grunfeld, C. (1989)Endocrinology, 125, 267-274.48. Sen, R. and Baltimore, D. (1986)Cell, 46, 705-716.

34. Mukaida, N., Mahe, Y., and Matsushima, K. (1990)J. Biol. Chem., 265,21128-21133.