Upload
others
View
18
Download
0
Embed Size (px)
Citation preview
“Standardisation of meningococcal
epidemiology – diagnostics”
SJ Gray,
Meningococcal Reference Unit (MRU),
(part of RSID),
Health Protection Agency,
Manchester Medical Microbiology Partnership
Manchester Royal Infirmary,
Manchester, UK.
SoGAT, NIBSC June 2008
Meningococcal Reference Unit (MRU)
(part of HPA RSID), Manchester
Free reference services (England & Wales)
••Confirm identity of case isolates (since 1984)Confirm identity of case isolates (since 1984)
serological phenotypic characterisation & sensitivities
serogroup & epidemiological markers
••NonNon--culture (PCRculture (PCR--based) confirmation of based) confirmation of meningococcal disease from clinical material (since meningococcal disease from clinical material (since 1996)1996)
serogroup determination: B, C, Y, W135 or A
Lab confirmed cases of Meningococcal
Disease (E & W) – epi-year
2006-07: PCR Total tested = 1313013130, positives = 9%
PCR only = 51% of all casesaverage 50 meningo PCR samples / day
can reach 100+ samples / day 20% of mol dept workload
Cultures 2006-07 = 1284 (563 cases) total
Neisseria meningitidis - characterisation
Serogroup(A,B,C,Y,W135,X,Z,29E)Polysaccharide capsule porA class 1 OMP
porBclass 2 or3 OMP
DNADNA
PCR detectionPCR detection::
ctrA, crgActrA, crgA
SerogroupSerogroup::
siaDsiaD (B, C, Y , (B, C, Y ,
W135)W135)
mynBmynB (A)(A)
Molecular Molecular
Epidemiology:Epidemiology:
MLSTMLST,,
porA,porA, fetAfetA
Sero-subtype
Serotype
VR1, VR2, VR3
eg.phenotype
B:NT:NT/P1.4/NT
MRU PCR-based assays for cultures and
non-culture material (direct clinical samples)
Detection assays: ABI TaqmanDetection assays: ABI Taqman™™
•ctrA detection of meningococcal DNA (capsulated organisms)
•siaD serogroup determination (sialylated capsules): B, C, Y or W135
•mynB serogroup A
Molecular Epidemiology Molecular Epidemiology –– DNA sequencing assaysDNA sequencing assays
•porA determination of sero-subtype (3 variable regions; VR1, VR2 & VR3)
•MLST (Multi-locus Sequence Typing) genetic relatedness between strains - clones
porA sequencing
Organism DNA
extract (heated)
porA PCR 1
Non-culture DNA extract
PCR positive
porA PCR 1
Nested PCR
porA PCR 2PCR sequencing
reactions
VR1 & VR2-(VR3)
DNA Sequence
VR1 & VR2-(VR3)
Compare translated AA sequences
to porA library via ww.neisseria.org
(http://www.mlst.net) to designate
VR1, VR2 & VR3
MLST (Multi-Locus Sequence Typing)
•sequence 7 loci ( within constituitve genes) to determine sequence type (ST)
By comparison with MLST database via www.neisseria.org (at http://www.mlst.net)
•If 4/7 loci agree between organisms may assign Clonal Complex
•Most European meningococcal disease described by 4 Clonal Complexes
•CC ST-11 has CFR 14% others around 5%
•Not under immune selective pressure like porA
MLST - considerations
The 7 loci – genes may require specific PCR
conditions for Non-culture material
Use of nested PCR assays for non-culture material
Clonal Complex designation provides
epidemiologically useful information even though
incomplete MLST results
A single base change in any of the 7 loci will
designate a new ST
EUIBIS EQA distributions 2005-2007
SJ Gray1, AJ Fox1, MA Regan1, LS Newbold1, N Patel2
and V James2.
1Meningococcal Reference Unit (MRU), Health Protection Agency (HPA), Manchester Royal Infirmary, Manchester, UK.
2External Quality Assurance Department (eQAD), UKNEQAS, Centre for Infections, Colindale, London, UK.
Design: Include all EU member and accession states
(eg. 3rd distribution, 2007: Austria, Belgium, Czech Republic, Denmark,
Estonia, England, Finland, France, Germany, Greece, Hungary, Iceland,
Ireland, Italy, Netherlands, Norway, Poland, Portugal, Scotland, Slovak
Republic, Slovenia, Spain and Sweden).
23 countries - Results returned from 21
Aim: Optimise and standardise European meningococcal
reference laboratory meningococcal strain
characterisation and detection to ensure accurate
surveillance Funded by
(European Invasive Bacterial Infections Surveillance Network)
EQA Aim and Design
•To assess phenotypic and genotypic characterisation (porA
sequence type and MLST) of culturescultures
•Use of simulated clinical non-culture samples to assess
DNA extraction, detection (PCR-based) and genotypic
characterisation (species DNA, serogroup, porA sequence
type and MLST)
•Utilising expert support of eQAD, CfI, UK
X3 EQA panels distributed in 2005, 2006 and 2007
Participants to receive their individual anonymous
reports compared to the consensus results
EQA Design continued
Culture and non-culture material
•Representative of the major disease causing lineages in
Europe
•Consideration of phenotypic and molecular
characteristics (porA sequence type and MLST)
A few unusual examples
Non-culture material was also selected to challenge
detection limits (sensitivity) of assays
All material was freeze-dried and distributed
internationally by eQAD
Preparation of simulated septicaemic
samples
MRU: Saline suspension of
N.meningitidis & estimated
viable count inin MSC*MSC*
Heat killed (100oC, 5
mins)
= Stock Suspension
Dilutions of Stock Suspension
in defibrinated horse blood
ABI Taqman to assess
dilutions for typical clinical
samples
Frozen Stock Suspension
transported to eQAD,CfI
eQAD: Specified dilutions
in horse blood, freeze
dried, safe international
distribution, documentation
Reconstituted on receipt,
tested to local abilities -
Results returned anonymouslyanonymously
to eQAD
Results reviewed by eQAD & MRUto produce individual lab result
compared to consensus
Individual labs assess own resultsIndividual labs assess own results
X3 EQA distributions - composition
EQA culture non-culture
panel (simulated septicaemia)
1st B (5), C (1), W135 (1), B (2), C (2), Neg (1)
Y (1), NG (1)
2nd A (1), B (1), Y (1) A (1), B (3)1, C (3)2, W135 (1),Neg (1), Str.pneumoniae (1)
3rd A (1), B (1), C (1), X (1) A (1)3, B (1)4, C (1)5, Neg (1)
Non-culture sensitivity design: 1, 2dilution series ( +++, ++ and + ), 3+++. 4+ and 5++
Example of culture consensus results
(2nd distribution)
No. phenotype1 porA MLST
VR1 VR2 VR3 ST CC
8318 A:21:P1.10 5-2 10 37-1 75 1
8319 C:2a:NT 5-12 10-8 36-2 11 11
8320 Y:14:P1.5 5-1 10-4 36-2 23 23
8321 C:2a:NT del3 del3 del3 11 11
8322 B:4:P1.3,6 18-1 3 38 41 41/44
1Phenotype dependent on reagent availability.
2stop codon in porA VR1. 3porA deletion
Culture EQA Results 1
Phenotypes: good agreement but lack of some reagents
locally. Clerical & notation issues.
Genotypes: PorA was successful where available: porA VR1
& VR2 assigned by 11/11, 6/6 and 15/15 over x3 distributions
(with fewer reporting VR3)
Two C isolates (2nd distribution) demonstrated the limitations
of phenotype characterisation but interesting porA. One had a
porA deletion problematic for some labs and one a point
mutation generating a stop codon (3-base TAG insertion) in
VR1.
•MLST: ST results were in good agreement for the cultures
with very few different to the consensus
•anomalies:
Labs able to compare their results with the consensus
The base changes could be due to technical, scientific or
clerical issues.
Culture EQA Results 2
Allelic profile
Consensus abcz adk aroE fumC gdh pdhC pgm
ST-275 CC ST-269 4 10 2 5 38 11 9
Non – consensus
ST-1881 CC ST-NA1 4 10 2 5 38 11 74
ST-352 CC ST-269 4 10 2 5 8 11 9
1NA = CC not assigned
An example of culture MLST anomalies –
comparison of consensus ST-275 to
ST-1881 and ST-352
ST-275 gdh 38 CGCGGCGAGTTTTATGACATTACCGGCG
ST-325 gdh 8 CGCGGCGAGTTTTACGACATTACCGGCG
gdh allele 38 and gdh allele 8 differ by 1 base change at nucleotide position 93
ST-275 pgm 9 GTAGTTACCAAAGAC
ST-1881 pgm 74 GTGGTTACCAAAGAC
pgm allele 9 and pgm allele 74 differ by 1 base change at nucleotide position 3
Consensus results of simulated
septicaemia samples (1st distribution)
No. concentration1 Genotype Lab
(orgs/mL) Group porA MLST Results2
VR1 VR2 VR3 ST
7863 4 x106 B 7 16 35 32 12/12
7864 0 Negative control - - - - 7/7
7865 2 x106 C 5-1 10-8 36-2 11 9/11
7866 9 x105 B 7-2 4 37 41 10/12
1estimated number of viable organisms / mL (MRU)
2Proportion of labs with serogroup consensus result
Consensus results for simulated
septicaemia samples (2nd distribution)
No. concentration1 Genotype Lab
(orgs/mL) Group porA MLST Results2
VR1 VR2 VR3 ST CC
83233 3 x105 C 5-1 10-4 36-2 50 11 16/18
83243 2 x104 C 5-1 10-4 36-2 50 11 14/18
83253 3 x103 C 5-1 10-4 36-2 50 11 12/17
8326 1 x106 W135 5 2 36-2 11 11 12/17
8327 1 x106 A 5-2 10 37-1 75 1 12/19
83284 1 x106 B 17 16-3 36 136 41/44 18/20
83294 1 x104 B 17 16-3 36 136 41/44 15/20
83304 3 x103 B 17 16-3 36 136 41/44 8/17
8331 3 x105 Negative N.meningitidis, POSITIVE Str. pneumoniae
8332 - Negative Control
1estimated number of viable organisms / mL (MRU).
2Proportion of labs with PCR-based serogroup consensus result.
38323, 8324 & 8325 were all dilutions of the same organism. 48328, 8329 & 8330 were all dilutions of the same organism.
Non-culture serogroup, MLST and
porA results
•The more dilute the sample the fewer the number of labs achieving the consensus
Suggest x103 organisms/mL may be the practical limit of PCR-based confirmation and characterisation
Inconsistency in reporting Negative results (assays attempted)
Assay availability (Y, W135 & A)
•Analysis and review of non-consensus sequencing results results
Lab30: Mis-priming in initial gdh loci
amplification resulted in “new” allele
designation – possible new ST?
Sample 8330, (x103 orgs/mL reported
as ?new gdh. Allele A>G at base 153.
Closest to allele 9 . No other alleles in
PubMLST database have A at this
position – evidence of mis-priming in
early PCR rounds
Sample 8329 gdh allele 9. Base G at
position 153
Samples 8329 & 8330 are the same
organism
Repeated sequencing of the products confirmed the same result. It was resolved post-EQA by repeating the initial amplification and re-sequencing the new products to obtain the consensus ST result.
Non-culture MLST 8768 (weak B) 3rd
distribution – only 2 lab reports
abcZ adk aroE fumC gdh pdhc pgm
ST 41 3 6 9 5 9 6 9
ST 2288 25 6 9 9 9 6 9
Nucleotide differences between abcZ-3 and abcZ-25
Identity: 99.08 % Differences: 4
nt 144: C → T nt 423: T → C
nt 429: T → C nt 432: C → T
Nucleotide differences between fumC-5 and fumC-9
Identity: 99.57 % Differences: 2
nt 9: G → A nt 441: A → G
6.78 x 103 distributed dilution
No consensus ST for 8768
But expected ST- 41
Non-culture porA 8768 - Weak
serogroup B (3rd distribution)
One lab reported different results to VR1 7-8 consensus
VR1 7-8 AQAANGGAGASGQVKVTKVTKVTKA
VR1 7-15 AQAANGGAGASGQVKVTKVTKV
6.78 x 103 distributed dilution
Conclusions 1
•x3 safe distributions of mixed culture and simulated
septicaemia (non-culture) material - with observed
improvement by the 3rd distribution
•Consensus reports allowed individual labs to review
Evidence of EQA for accreditation bodies
•Phenotypic characterisation: good - but limited access to
reagents, differences in notation and reporting were
observed
•PCR-based detection, confirmation and characterisation
was generally successful but some potential limitations
were observed
Improved surveillance - wider usage of serogroup A
assays
Reporting of clonal complexes is epidemiologically
useful (even if incomplete ST designation)
••Some evidence of detection and characterisation assay Some evidence of detection and characterisation assay
sensitivity limit (x10sensitivity limit (x1033 org/mL)org/mL)
••Evidence that gelEvidence that gel--based detection matched realbased detection matched real--time time
assays except for weak nonassays except for weak non--culture samplesculture samples
Conclusions 2
Feedback from participants: EU-IBIS meeting, Rome,
May 2007 (- used to design 3rd distribution October 2007)
•Too many samples?
•Expensive to carry out all assays – order of priority to
be given?
•Discussion of the validity of consensus results? What
if a lab is superior to the consensus?
•Possible scoring of EQA results for local quality
manager reports
More detailed analysis required of: PCR targets,
primers and DNA extraction methods
The Future
•Development of assay controls - DNA or organism
standards in collaboration with NIBSC?
For DNA extraction (protein matrix) & assay control
large freeze-dried batches (quantified?)
dilutions for sensitivity and EQA panels
applicable to surveillance targets
•Recent successful ECDC bid (co-ordinated by EMGM)
includes a further meningococcal EQA distribution and
training workshop