110 PLATFORM SESSION

zure susceptibility, and only those that exhibited generalized tonic-clonic seizures (GTCS) were used for the subsequent studies. At age 8 weeks, the PTU rats were injected intraperitoneally with either MK-80 I , a noncompetitive N-methyl-D-aspartate (NMDA)-receptor antagonist (0.01 mgikg, n = 14; 0.05 mg/kg, n = 15; and 0.5 mg/kg, n = 15) or NBQX, an AMPA-receptor antagonist (3 mg/kg, n = 5 ; and 10 mg/kg, n = 10). All drugs were given 30 min before the auditory stimulation, and then the in- cidence of audiogenic seizures was recorded. Be- havioral seizures were divided into running fits (RF) and GTCS, and the latency to RF/GTCS and the duration of RF/GTCS were measured and com- pared.

Almost all the PTU rats showed RF alone (8.5%) or RF followed by GTCS (90%) after stimulation at age 7 weeks. MK-801 dose-dependently blocked both RF (incidence: 0 at 0.01 mg/kg, 20% at 0.05 mg/kg, and 80% at 0.5 mglkg; p < 0.0001, Cochran- Armitage test) and GTCS (incidence: 20, 60, and

loo%, respectively; p < 0.0001). NBQX was found to be partially effective for only GTCS (incidence: 0 at 3 mg/kg and 30% at 10 mg/kg) but not for RF (0 and 0, respectively). At age 7 weeks, the PTU rats showed RF with a latency of 15 t 25 s and a duration of 8 f 4 s, and MK-801, which was injected into the same animals a week later (0.5 mg/kg), sig- nificantly inhibited RF, with a latency of 61 t 32 s (p < 0.001) and a duration 2 -t 4 s (p < 0.001). Neither 3 mg/kg nor 10 mg/kg of NBQX had an effect on the latency or duration of either RF or GTCS.

In our study, an NMDA antagonist markedly in- hibited both RF and GTCS in audiogenic seizures of PTU rats, but the anticonvulsant action of an AMPA-receptor antagonist was only partial, sup- pressing only GTCS. It is thus suggested that audio- genic seizures can be generated more primarily by NMDA receptors compared with AMPA receptors, and that some behavioral components (RF vs. GTCS) may be driven differently by different types of glutamate receptors.

Kindling

Anticonvulsant Effects of Tigabine, a New Antiepileptic Drug: The Profile of Action in the Rat Kindling Model of Epilepsy. Hitoshi Sato, Kiyoshi Morimoto, Yoshitaka Yamamoto, Takemi Watanabe, and Hiroshi Suwaki (Department of Neuropsychiatry , Kagawa Medi- cal School, Kagawa, Japan).

y-Aminobutyric acid (GABA) is the major inhibi- tory neurotransmitter in the central nervous system. Recently pharmacologic enhancement of GABAer- gic transmission has been applied to anticonvulsant treatment of epilepsy. Tigabine (TGB), a potent and selective GABA-uptake inhibitor, is a newly devel- oped antiepileptic drug. In this study, we analyzed the anticonvulsant profile of TGB in the rat kindling model, which is a chronic experimental model of human complex partial seizures secondarily general- ized, produced by repeated focal electrical stimula- tion of a limbic brain site. We examined the dose- and time-dependent anticonvulsant effects of TGB in amygdala (AM)- and hippocampal (H1PP)-kin- dled seizures.

Male Sprague-Dawley rats weighing 250-300 g were used. Chronic depth electrodes were implanted stereotaxically into the left AM or HIPP under gen- eral anesthesia with sodium pentobarbital. At least 7 days after surgery, the animals were subjected to kindling stimulation, which consisted of a 2-s train

of 100-Hz square-waves. All the rats received the kindling stimulus at the afterdischarge (AD) thresh- old intensity once daily. Kindling stimulation was continued until the animals had at least five consecu- tive generalized convulsions (stage 5 seizures), and then the generalized seizure-triggering threshold (GST) was determined in each rat for the pharmaco- logic experiments. The development of kindled sei- zures was assessed by using a modification of Ra- cine’s classification. TGB was dissolved in 5% glu- cose, and TGB or the vehicle was i.p. administered in a volume of 2 ml/kg.

In AM-kindled rats, i.p. TGB administration sig- nificantly reduced the seizure stage (20 mg/kg: 5.0 vs. 0.8, p < 0.05) and the afterdischarge duration (107.5 L 4.9 s vs. 10.0 t 3.4 s, p < 0.001) in dose- dependent manners, compared with vehicle treat- ment. The maximal anticonvulsant effects were ob- served at 15 or 30 min, and the effects had disap- peared at 4 h after TGB administration. Electrical stimulation at twice the GST threshold intensity

Epilepsia, Vol. 37, Suppl. 3, 1996

PLATFORM SESSION 111

slightly reversed the anticonvulsant effects. Simi- larly, pretreatment with picrotoxine (1 mg/kg) sig- nificantly but not completely antagonized the effects of TGB. In HIPP-kindled rats, TGB also signifi- cantly reduced the seizure stage (20 mg/kg: 5.0 vs. 0.3, p < 0.05) and the AD duration (99.6 k 9.4 s vs. 5.7 2 4.3 s, p < 0.01). High doses of TGB (20-40 mg/kg) caused sedation and motor impairment, whereas a toxic TGB dose (40 mg/kg) often caused EEG paroxysms with myoclonus.

TGB is a potent inhibitor of GABA uptake into either synaptosomal membranes or neurons and glial cells. TGB is 2.5 times more potent in inhibiting glial than neuronal GABA uptake. That the enhanced inhibition associated with the blockade of GABA

uptake has an anticonvulsant effect is supported by the results of this study on the kindling model involv- ing a selective GABA-uptake inhibitor, TGB. In our study, TGB exhibited dose-dependent anticonvul- sant effects on AM- and HIPP-kindled seizures, the efficacy for the two brain sites being almost the same. The effects of tigabine were partly due to elevation of the seizure-triggering threshold. Pre- treatment with picrotoxin significantly antagonized the effects of TGB, suggesting that the main anticon- vulsant effect of TGB is mediated by GABA sys- tems. Anticonvulsant doses of TGB caused only mild sedation and motor impairment. These results indicate the clinical usefulness of TGB in human temporal lobe epilepsy.

Regional Increase in p Subunit But Not a Subunit of Calmodulin Kinase I1 mRNA in Kindling. *tKeiko Sato, $Ken-ichi Kashihara, 8Kiyoshi Morimoto, TNorihito Yamada, *Toshiyuki Hayabara, and Whigetoshi Kuroda (*Clinical Research Institute, National Sanato- rium Minamiokayama Hospital, Departments of "Teuropsychiatry and $Neurology, Okayama University Medical School, Okayama; and §Department of Neuropsychiatry , Kagawa Medical School, Ka- gawa, Japan).

Calmodulin (CaM) kinase I1 is the major protein constituent of the postsynaptic density and has mul- tiple functional roles in neural signaling and plastic- ity, which include neurotransmitter release, induc- tion of gene transcription, regulation of cytoskeletal proteins, and phosphorylation of excitatory amino acid receptors. Kindling has been studied as an ani- mal model of epilepsy and neuronal plasticity. A number of reports have suggested the involvement of CaM kinase I1 in the mechanisms underlying kin- dling. Although some investigators have described long-lasting decreases in CaM kinase in the kindled brain, there have been few studies of short-lived changes in CaM kinase. In our study, we investi- gated the changes in the a and p subunit mRNAs of CaM kinase I1 after kindled seizures.

Forty male Sprague-Dawley rats weighing 300- 350 g were used. A tripolar electrode was implanted stereotaxically in the basolateral amygdala under pentobarbital anesthesia (50 mg/kg, i.p.). After a recovery period, the rats were subjected to daily kindling stimuli (a 2-s train of 250 ps, 100-Hz rectan- gular waves at a current intensity of 200 PA). Seizure stages were assessed according to Racine's classifi- cation. Immediately after (time zero) and at 30 min,

1, 2 ,4 , 8, and 24 h (n = 5 for each) after the kindled seizures, the brain was removed rapidly, frozen, and cut into sections 10-pm thick with a cryostat.

35S-Labeled antisense oligonucleotide probes for the a and p subunits of CaM kinase I1 were prepared. The sequences of the probes were a subunit, GGAC- CAGGCCAGGGTCCCTGCGCTCTCGTCGC; p subunit, GGCGGCAGGAGGGAGGGATCCTTT- GGGGCTGGTGATGGC. The procedures used were those described by Fujiwara et al. (Jpn J Psych- iatr Neurol 1991 ;45:897-902). The levels in sham- operated controls (n = 5) were taken as 100%.

Four to 24 h after generalized stage 5 kindled sei- zures, p subunit mRNA increased significantly by 18-28% in the granule cell layer of the bilateral den- tate gyrus and by 18-30% in the pyramidal cell layer of the ipsilateral CA2. In the pyramidal cell layer of the ipsilateral CA3, the levels increased significantly by 22% 4 h after the kindled seizures. In contrast, the level of a subunit mRNA did not change signifi- cantly in the regions examined up to 24 h after the kindled seizures. There was a tendency for a subunit mRNA to be decreased in the hippocampus and tem- poral cortex 1 h after the kindled seizures.

Our results indicate that the induction of p subunit