Upload
others
View
0
Download
0
Embed Size (px)
Citation preview
Anthocyanin regulation in bell pepper fruit
Wageningen University
Plant Breeding Group
Ying Liu (890427523050)
01-03-2016
I
Anthocyanin regulation in bell pepper fruit
Ying Liu
890427523050
Supervisor: Yury Tikunov
Examiner: Arnaud Bovy
Research Group: Plant Breeding
Wageningen University ● MSc Thesis ● 01-03-2016
Wageningen, Nederland
II
Abstract
The transient accumulation of anthocyanins is the main problem for breeding bell peppers with mature purple
fruits. The purple pigmentation only appears in unripe fruits and disappears during ripening. To investigate the
molecular mechanisms underlying the regulation of anthocyanin in pepper, a thesis project was conducted. A
purple-fruited genotype and a yellow-fruited genotype on which purple sectors can be formed in the fruit peel
when induced by stress were used. Anthocyanin structure, anthocyanin accumulation pattern, the
transcription level of the anthocyanin biosynthetic genes, regulatory genes and degradative genes were
investigated. Some key candidate genes involved in anthocyanin regulation were identified and the
anthocyanins in pepper were also detected as two delphinidin derivatives, delphinidin-3-caffeoylrutinoside-5-
glucoside and delphinidin-3-coumaroylrutinoside-5-glucoside. Results showed that neither the development
nor stress regulation can alter the structure of anthocyanins in pepper; the structure of anthocyanin should be
more dependent on its genetic background. The anthocyanin accumulation pattern fitted the visual
development pattern, which firstly increased and then decreased with the highest abundance in unripe purple
fruits. The expression level of biosynthetic genes and degradative genes were strongly correlated with
anthocyanin content. The disappearance of purple pigments in fruits of purple-fruited genotype during
ripening was due to the terminated expression of anthocyanin biosynthetic genes and the continuously
expression of anthocyanin degradative genes, so the ratio moved towards degradation. Stresses that triggered
anthocyanin biosynthesis did not show any effect on the expression of degradative genes.
Key words: anthocyanin biosynthesis, anthocyanin degradation, peroxidase.
III
Acknowledgement
This MSc thesis is part of my education in Plant Sciences at Wageningen University. It was a project from Plant
Breeding Group. First of all, I would like to thank Dr. AG (Arnaud) Bovy and YM (Yury) Tikunov PhD for their
critical and patient supervisions on the experimental works and report writing. Next, I want to thank Jos
Molthofffor for his supervision and help of the lab works. Not only their preciseness in helping me designing
the experiment and analysing the data, but also their professional attitudes influencing me a lot. I appreciate
their valuable guidance. Furthermore, I want to thank Enza Zaden B.V. for providing pepper materials. Finally,
I appreciate all the supports and companies from my parents, my husband, my friends and the colleagues from
PBR group.
IV
Content
Anthocyanin regulation in bell pepper fruit ................................................................................................................ 1
Anthocyanin regulation in bell pepper fruit ................................................................................................................. I
Abstract ........................................................................................................................................................................ II
Acknowledgement ...................................................................................................................................................... III
Content ....................................................................................................................................................................... IV
1. Introduction ......................................................................................................................................................... 1
1.1 Anthocyanins: the concept ................................................................................................................................ 1
1.2 Anthocyanin biosynthetic pathway.................................................................................................................... 2
1.2.1 Structural genes .......................................................................................................................................... 2
1.2.2 Regulatory genes ........................................................................................................................................ 3
1.3 Anthocyanin degradative pathway .................................................................................................................... 4
1.4 Environmental regulation of the anthocyanin pathway .................................................................................... 5
2. Research Aim ....................................................................................................................................................... 6
3. Research Questions and Hypotheses................................................................................................................... 7
4. Materials & Methods ......................................................................................................................................... 10
4.1 Plant Materials and Experimental Design ........................................................................................................ 10
4.1.1 Plant Materials .......................................................................................................................................... 10
4.2 Methods ........................................................................................................................................................... 11
4.2.1 Extraction and analysis of anthocyanins ................................................................................................... 11
4.2.2 RNA extraction and cDNA synthesis ......................................................................................................... 11
4.2.3 Candidate gene selection, primer design and gene expression analysis .................................................. 12
4.2.4 Phylogenetic analysis ................................................................................................................................ 13
4.2.5 Statistical analysis ..................................................................................................................................... 13
5. Result ................................................................................................................................................................. 15
5.1 A short description of experiments: ................................................................................................................ 15
5.1.1 Experiment 1: Identification and quantitation of anthocyanin ................................................................ 15
5.1.2 Experiment 2: Expression analysis of anthocyanin related genes ............................................................ 15
5.2 Research on anthocyanin structure ................................................................................................................. 15
5.3 Research on the anthocyanin accumulation pattern ....................................................................................... 17
5.4 Research on the expression of candidate genes .............................................................................................. 18
5.4.1 Validation of reference genes ................................................................................................................... 19
V
5.4.2 Expression pattern of candidate genes in cv. Tequilla .............................................................................. 19
5.4.3 Expression level of candidate genes in cv. Stayer ..................................................................................... 22
5.4.4 Identification of candidate R2R3-MYB, bHLH and WD40 regulators of anthocyanin biosynthesis .......... 24
5.4.5 The correlations between the expression level of candidate genes ......................................................... 25
5.4.6 The correlations between the expression level of candidate genes and anthocyanin content ................ 26
6. Discussion .......................................................................................................................................................... 30
6.1 The structure of anthocyanins formed during development or induced by stress is the same ...................... 30
6.2 The accumulation pattern of anthocyanins ..................................................................................................... 30
6.3 Candidate genes involved in the biosynthetic and degradative processes of anthocyanin ............................ 31
6.3.1 Expression of candidate genes under developmental regulation............................................................. 31
6.3.2 Expression of candidate genes under stress regulation ........................................................................... 32
6.3.3 Investigation on which candidate gene is development regulated and which is stress regulated. .......... 33
6.3.4 Identification of key candidate genes ....................................................................................................... 33
6.4 Hypothesized mechanisms for anthocyanin regulation................................................................................... 34
7. Conclusion ......................................................................................................................................................... 36
8. Further Perspectives .......................................................................................................................................... 37
8.1 Further research on degradative mechanism .................................................................................................. 37
8.2 Monitoring the pH value .................................................................................................................................. 37
8.3 Discover new candidate genes ........................................................................................................................ 37
8.4 Functional analysis of candidate genes ........................................................................................................... 37
8.5 Looking for genetic variations .......................................................................................................................... 37
8.6 Discover the effect of environmental regulation ............................................................................................. 38
9. References ......................................................................................................................................................... 39
10. Appendix I –Reverse transcription reaction ................................................................................................... 42
11. Appendix II – Candidate genes and primers .................................................................................................. 43
12. Appendix III - R2R3-MYB domain ................................................................................................................... 44
13. Appendix IV - Relative gene expression of all candidate genes ..................................................................... 45
14. Appendix V-The expression level of POD CA02g17240 in purple sector of stressed Stayer and peel of purple-
fruited genotype ........................................................................................................................................................ 50
1
1. Introduction
Given the health promoting effects of anthocyanins in the diet, there is an increasing interest in breeding
anthocyanin-rich crops. Anthocyanins are not only health related compounds but also essential elements to
promote fruit quality. Bell pepper (Capsicum annuum L.) is an agronomically important crop worldwide. It is a
good source of vitamins, carotenoids and flavonoids (Ghasemnezhad et al., 2011). Bell pepper fruits can
contain different pigments (e.g. chlorophyll and carotenoids) resulting in, for instance green, yellow, orange
and red fruits. Within cultivated pepper germplasm several purple fruited genotypes exist, which could be a
valuable source of anthocyanin. However, the purple pigmentation only appears in unripe fruits and disappears
during ripening. Unripe purple bell pepper fruits are not appreciated due to their bitter taste and lack of
sweetness. Until now, there are no purple bell peppers that are sweet and mature on the market. On the other
hand purple patchiness caused by accumulation in response to environmental factors have a negative impact
on fruit appearance.
Apparently there are two processes which are important for the anthocyanin content in pepper fruit - the
biosynthesis of anthocyanins and their degradation. Anthocyanin biosynthesis has been thoroughly studied in
many plant species. In bell pepper, however, only a few studies have been undertaken to investigate the
anthocyanin biosynthesis and there is lack of information with regard to anthocyanin degradation mechanisms.
By studying these two processes, we can provide knowledge to facilitate breeding for mature purple bell
peppers with a sweet taste. With an increasing awareness among consumers of both the sensorial and
nutritional quality, an innovative anthocyanin rich and sweet bell pepper could be of great economic
importance.
1.1 Anthocyanins: the concept
Anthocyanins are pigments that, depending on the number of hydroxyl groups on the B ring and the pH,
determine a range of colours from orange, red, purple to blue in flowers, seeds, fruits and vegetative tissues
(Tanaka et al., 2008). Anthocyanins are a class of secondary metabolites belonging to flavonoids and are
heterocyclic compounds, which are composed of a three-ring skeleton often conjugated with different sugar
and acyl moieties (Stommel et al., 2009). They are soluble compounds that mostly locate in the cell vacuoles.
In recent years, more attention has been paid to anthocyanins due to their health-promoting effects (Butelli
et al., 2008). They are antioxidants and there is accumulating evidence supporting their role in reducing
cardiovascular disease, certain cancers and other degenerative diseases (Lila, 2004; De Pascual-Teresa et al.,
2010). Thus, consuming anthocyanin-rich plants is considered beneficial to human health (Pojer et al., 2013).
Furthermore, anthocyanins protect against various biotic and abiotic stresses (Chalker-Scott, 1999; Ahmed et
al., 2014) in addition to their role in attracting pollinators and seed dispersers (Harborne & Williams, 2000).
Due to their benefits, anthocyanins are often targets for bioengineering and plant breeding programs.
2
1.2 Anthocyanin biosynthetic pathway
The anthocyanin biosynthetic pathway (Figure 1) has been characterized in detail, especially in model plants
like Arabidopsis, Petunia and maize. It is a branch way of the flavonoid metabolism (Petroni & Tonelli, 2011).
Delphinidin-3-coumaroyl-rutinoside-5-glucoside is the only anthocyanin that has been published in pepper
(Lightbourn et al. 2008). Two categories of genes are engaged in anthocyanin biosynthesis: structural genes
that encode the enzymes catalyzing each reaction step and regulatory genes that encode transcription factors
to manipulate the expression of the structural genes (Gonzali, Mazzucato & Perata, 2009).
1.2.1 Structural genes
The first dedicated step starts from catalyzing 4-coumaroyl-CoA and malonyl-CoA into naringenin chalcone by
chalcone synthase (CHS; Figure 1, ①). Then, naringenin chalcone is isomerized by chalcone isomerase (CHI;
②) to naringenin. Flavanone 3-hydroxylase (F3H; ③) converts naringen into dihydrokaempferol that can be
further hydroxylated by flavonoid 3’-hydroxylase (F3’H; ④) or flavonoid 3’,5’-hydroxylase (F3’5’H; ⑤) into
dihydroquercitin or dihydromyricetin, respectively. Next, the dihydroflavonols are synthesized into colourless
leucoanthocyanidins by dihydroflavonol 4-reductase (DFR; ⑥) and subsequently to colourful anthocyanidins
by anthocyanidin synthase (ANS; ⑦). Finally, various anthocyanins are produced by conjugation of
anthocyanidins, different sugar molecules are attached to anthocyanidins by various members of
glycosyltransferase enzyme family, e.g. flavonoid 3-O-glucosyltransferase (UFGT; ⑧), followed by acylation of
these sugar moieties often with aromatic acyl groups by acyltransferases. In dicot plants, the network of
structural genes encoding the anthocyanin biosynthetic enzymes are CHS, CHI, F3H, F3'H and F3'5'H, which are
categorized as early biosynthetic genes (EBGs) and DFR, ANS and UFGT, which are categorized as late
biosynthetic genes (LBGs) (Dubos et al. 2010). This network is very conserved and highly similar in many plant
species (Holton & Cornish, 1995; Boss et al., 1996; Tanaka, & Ohmiya, 2008). The CHS, F3H involved in
anthocyanin biosynthesis have been isolated from purple pepper fruits (Deng et al., 2014).
3
Phenylalanine
+ 3 * Malonyl CoA
Naringenin chalcone
CHS
Naringen
CHI
Dihydrokaempferol
F3H
Dihydroquercitin F3'H DihydromyricetinF3'5'H
Leucopelargonidin
DFR
Leucidelphindin
DFR
Leucocyanidin
DFR
Cyanidin (Anthocyanidins)
ANS
Pelargonidin (Anthocyanidins)
ANS
Delphinidin (Anthocyanidins)
ANS
FLS
KaempferolQuercetin
FLS
Kaempferol glycoside
UGTs
Quercetin glycoside
UGTs
Isorhamnetin OMT
Isorhamnetin glycoside
UGTs
Catechin
Epicatechin ANR
LAR
Proanthocyanidin
Cinnamic acid
PAL
4-Coumaric acid
C4H
Caffeic acid
4CL
5-O-Caffeoylquinic
acidHCT,C3H
Myricetin
FLS
Myricetin glycoside
UGTs
Pentahydroxyflavanone
F3'5'HEriodictyol F3'H
F3HF3H
Pelargonidin 3-glucoside
UFGT
Delphinidin 3-glucoside
UFGT
Cyanidin 3-glucoside
UFGT
4-Coumaroyl-CoA
Dihydroflavonols
Leucoanthocyanidins
Anthocyanidins
Anthocyanins
Figure 1. Schematic representation of the anthocyanin biosynthetic pathway (Petroni & Tonelli, 2011). CHS, chalcone synthase; CHI,
chalcone isomerase; F3H, flavanone 3-hydroxylase; F3’H, flavonoid 3’-hydroxylase; F3’5’H, flavonoid 3’,5’-hydroxylase; DFR,
dihydroflavonol 4-reductase; ANS, anthocyanidin synthase; UFGT, flavonoid 3-O-glucosyltransferase.
1.2.2 Regulatory genes
The anthocyanin biosynthetic pathway is highly controlled at the transcriptional level by coordinated activity
of transcription factors (TFs) from the R2R3-MYB , basic helix-loop-helix (bHLH) and reserved WD40 repeats
families (Ramsay & Glover, 2005; Tanaka, & Ohmiya, 2008). These TFs can form a MYB-bHLH-WD40 (MBW)
complex to bind to the promoters of the structural genes, leading to their transcriptional activation and hence
expression (Figure 2) (Stommel et al., 2009). The MBW complex regulates many biological processes including
4
anthocyanin biosynthesis (Petroni & Tonelli, 2011). The expression of WD40s, who provide a surface for
protein-protein interactions, are generally constitutive, while the expression of the R2R3-MYB and bHLH, who
interact in most cases, is more specific for pigmented tissue (Koes et al., 2005; Ramsay, & Glover, 2005). In
Arabidopsis, EBGs are regulated by independent R2R3-MYBs while LBGs are regulated by an MBW complex
(Petroni & Tonelli, 2011). In pepper, a dominant CaA gene (accession AJ608992) has been reported to encode
a R2R3 MYB transcription factor positively controlling anthocyanin biosynthesis, activating the LBGs during
early fruit development (Borovsky et al., 2004). In petunia, tobacco, tomato and potato, two bHLH genes, AN1
and JAF13 , and a WD40 gene have been proposed to be related with the regulation of anthocyanin
biosynthesis (Montefiori et al., 2015; Kiferle et al., 2015).
Apart from the positive regulators of anthocyanin biosynthesis, there are also negative regulators such as R3
MYB proteins which compete with R2R3-MYB during formation of complexes with bHLH proteins (Albert et al.,
2012). In addition in Arabidopsis and strawberry, negative MYB TFs, such as AtMYBL2, AtCPC and FaMYB1, have
been identified. They function as suppressors of anthocyanin biosynthesis by negatively regulating the
expression of the anthocyanin biosynthetic genes (Aharoni, et al., 2001; Petroni, & Tonelli, 2011). Moreover,
one of the miR156 target, SPL9 gene, can negatively regulate anthocyanin biosynthesis by destabilizing a MBW
complex to block the expression of biosynthetic genes (Guo et al., 2011).
R3-MYBWD40
bHLH
R2R3-MYB
Structural genes Anthocyanin biosynthesis
Figure 2. Model depicting the role of transcription factors, MYB, bHLH and WD40, regulating structural genes in anthocyanin
biosynthetic process (Koes et al., 2005; Jaakola, 2013).
1.3 Anthocyanin degradative pathway
In contrast to anthocyanin biosynthesis, the degradative processes are much less understood. Anthocyanin
degradation is regulated by specific genes and proteins during plant growth or in response to environmental
changes. The active in planta degradation of anthocyanins was first reported in Brunfelsia calycina flowers
(Vaknin et al., 2005) by a vacuolar class III peroxidase (POD), BcPrx01 (Zipor et al., 2015). During postharvest
storage of litchi, polyphenol oxidases (PPO) or POD are suggested to be responsible for anthocyanin
degradation (Zhang et al., 2001; Zhang et al., 2005). In extracts of blood orange juice, β-glucosidase and PPO
have been suggested to be involved in anthocyanin degradation during the final ripening stage (Barbagallo et
al., 2007). Oren-Shamir (2009) proposed three candidate enzyme families: PPO, POD and β-glucosidases, to be
involved in the anthocyanin degradative processes. PPOs are located in the plastids while PODs and β-
glucosidases are frequently located in the vacuoles, which make the latter two more promising candidates for
5
anthocyanin degradation. There are two presumed anthocyanin degradative pathways (Figure 3). One is the
direct oxidation by POD. The other one is comprised by a two-step degradation, namely de-glycosylation by β-
glucosidase and oxidation by PPO or POD (Barbagallo et al., 2007; Oren-Shamir, 2009).
AnthocyaninAnthocyanin o-
quinonePOD
Anthocyanidin
β-glucosidase
Degradation products of anthocyanin
POD/PPO
Figure 3. Presumed scheme about anthocyanin degradative process (Oren-Shamir, 2009).
1.4 Environmental regulation of the anthocyanin pathway
The activity of the molecular factors driving anthocyanin accumulation can be influenced by different
environmental conditions. Light is one of the most important environmental variables stimulating anthocyanin
biosynthesis such as high irradiation (Lightbourn et al., 2007; Azuma et al., 2012) and UV or blue spectrum
(Arakawa et al., 1985; Kondo et al., 2014; Xu et al., 2014). Anthocyanins are photo-protective agents (Chalker-
Scott, 1999) since they absorb excess visible and UV light, for example, they accumulate in young tissues to
protect them from light damage (Oren-Shamir, 2009). Low temperature has also been reported to induce
anthocyanin biosynthesis (Ahmed et al., 2014). High temperature plus low light enhanced the expression of
negative regulators and inhibit the expression of positive regulators, thus reducing the anthocyanin biosynthesis
(Petroni & Tonelli, 2011). Recently, high temperature is reported to reduce anthocyanin content in grapevine via
the enhanced peroxidase activity, including VviPrx31 peroxidase (Movahed et al., 2016). However, the
underlying molecular mechanisms of environmental regulation are mostly unknown.
6
2. Research Aim
The aim of this study is to investigate the biochemical and genetic regulation of anthocyanin biosynthesis and
degradation in bell pepper fruits in order to provide an insight into the mechanisms of anthocyanin metabolism
during ripening stage and under stress conditions.
7
3. Research Questions and Hypotheses
Main research question: What is the reason of transient accumulation of anthocyanin in bell pepper of a
purple-fruited genotype (see Materials and Methods) during ripening?
Sub-question group 1:
i) What are quantitative and structural changes of anthocyanins that take place during ripening of
the pepper fruit?
ii) What is the anthocyanin accumulation pattern of purple-fruited genotype during ripening?
iii) Is the structure of anthocyanins in purple pepper fruits and purple sectors of stressed yellow-
fruited genotype the same?
Anthocyanin accumulation or disappearance is controlled by plant development or induced by environmental
factors. Lightbourn et al. (2008) identified a single anthocyanin pigment in Capsicum: delphinidin-3-coumaroyl-
rutinoside-5-glucoside. However, there might be different effects of developmental and environmental
regulation on the structure of anthocyanin. For example, anthocyanin compounds of cultivated grapevine
comprise different derivatives of delphinidin, cyanidin, petunidin, peonidin and malvidin. The total amount
and the exact proportion of each compound are determined by genotype and environmental conditions
(Movahed et al., 2016). Thus, the structure of anthocyanin that generated during development or induced by
stress in pepper fruits may be different.
Hypothesis 1: The predominant anthocyanidin in our pepper materials is delphinidin. The structure of
anthocyanin in purple-fruited genotypes and in stress induced purple sector of yellow-fruited genotypes
might not be the same.
The fruit colour of purple-fruited genotype changes during ripening, namely from green to purple and then to
red. As the pigment content determines the fruit colour, it is very important to make the anthocyanin
accumulation pattern clear. In C.chinense, the anthocyanin was absent in green young fruits as well as orange
mature fruits and its content was the highest in purple immature fruits. The anthocyanin accumulation pattern
measured by HPLC fitted the visible developmental pattern, suggesting that anthocyanin is not masked by
carotenoids in ripe fruits but is rather degraded at that stage (Borovsky et al., 2004). In Brunfelsia calycina,
with the flower colour changed from dark purple to white during opening, the anthocyanin degradative activity
increased and anthocyanin content decreased (Zipor et al., 2015). Therefore, the anthocyanin content would
probably in general fits visual assessment. The purple-fruited genotype used in our study would likely follow a
similar accumulation pattern to C.chinense during ripening.
Hypothesis 2: The anthocyanin concentration may first increase and then decrease during ripening in purple-
8
fruited genotype.
Sub-question group 2:
i) What are the expression patterns of anthocyanin structural genes, regulatory genes and
degradative genes in purple-fruited genotype during ripening?
ii) What are the differences in gene expression between the purple sectors and the green parts of
the stressed fruits and how does it compare with the green part of the normal non-stressed
fruits of a yellow-fruited genotype?
iii) What is the variation in gene expression between the purple fruits and the purple sectors
formed under stress?
The expression of anthocyanin related genes have been studied in some solanaceous species. Although the
expression level of EBGs in the anthocyanin biosynthetic pathway displays a genotypic variation as they showed
either a higher or a similar expression in pigmented pepper fruits compared with non-pigmented ones
(Borovsky et al., 2004; Stommel et al., 2009; Deng et al., 2014), the LBGs and regulatory genes (R2R3-MYB and
bHLH) have been reported to highly express in pigmented pepper or transgenic tomato fruits (Borovsky et al.,
2004; Stommel et al., 2009; Deng et al., 2014; Kiferle et al., 2015). Additionally, the expression of LBGs also
showed a positive correlation with anthocyanin accumulation in pepper (Aza-González et al., 2013). Generally,
the anthocyanin biosynthetic genes would probably highly expressed in pigmented fruits. Thus, the expression
pattern of biosynthetic genes may be similar to anthocyanin accumulation pattern. On the other hand, the
induction of anthocyanin degradative genes and corresponding protein levels are associated with the intense
degradation of anthocyanin in Brunfelsia calycina petals (Zipor et al., 2015). So the expression of degradative
genes might rise before discoloration. Furthermore, when the proportion of degradation surpasses that of
production, discolouration occurs. Another probability might be degradation lasts constantly and when
biosynthesis decreases the ratio moves towards degradation.
Hypothesis 3: The structural and regulatory genes of the anthocyanin biosynthesis firstly increase and then
decrease during fruit ripening of purple-fruited genotype. The expression of candidate degradative gene and
candidate regulatory repressors responsible for anthocyanin degradation will elevate before colour-turning
stage. Or the expression of degradative genes can be constant and when biosynthesis stops the ratio moves
towards degradation.
It is known that the anthocyanin biosynthesis can be induced by environments such as high irradiation
(Lightbourn, Stommel, & Griesbach, 2007), different light spectrum (Kondo et al., 2014; Liu et al., 2015) and
low temperature (Ahmed et al., 2014). The expression of anthocyanin structural and regulatory genes has been
suggested to increase in response to the exposure to UV/blue light in accordance with the induction of
anthocyanin levels (Azuma et al., 2012; Shi et al., 2014). Certain R2R3-MYB TFs display unique expression
9
pattern for different light spectra (Wang et al., 2012). Some phytochrome interacting factors in Arabidopsis
were found out to belong to bHLH TFs (Liu et al., 2015). Additionally, Jaakola (2013) proposed the raise of
anthocyanin accumulation at low temperature might be regulated via the same mechanisms as light regulation.
Thus, it could be proposed that the expression of structural and regulatory genes in the purple sectors
stimulated by stress is supposed to be higher than those in green peels of stressed fruits or normal non-
stressed fruits. As anthocyanins constantly accumulate on the fruit skin, no difference is expected in the
expression of degradative genes.
Hypothesis 4: The expression level of biosynthetic genes and regulatory genes is significantly higher in purple
sectors of stressed fruits than that of green parts of stressed fruits or normal non-stressed fruits. The
degradative genes may not be expressed or their expression level might be similar between pigmented and
non-pigmented tissues.
In transgenic anthocyanin-rich tomato fruits, the same structural genes of flavonoid/anthocyanin pathway are
expressed under both regular cultivation and stressed conditions. However, the expression of regulatory genes
varied under these two conditions. Both SIANT1 and SIAN2, encoding two R2R3-MYB TFs, are able to induce
anthocyanin production; however, only SIAN2 can mediate anthocyanin biosynthesis induced by high light or
low temperature in vegetative tissues (Kiferle et al., 2015), which suggested that some regulatory genes were
specifically environmentally regulated. This provides evidence for hypothesizing that different regulatory genes
can play a role in controlling anthocyanin biosynthesis under normal fruit development conditions and under
stress conditions. Therefore, when comparing the immature purple fruits and the purple sectors from stressed
fruits, the expressed structural genes might be the same while the regulatory genes may be different. The
expression of degradation genes might be higher in turning purple fruit compared with purple sectors
considering the further degradative processes in purple fruit genotypes.
Hypothesis 5: The structural genes expressed in purple immature fruits and purple sectors of stressed fruits
may be the same while the regulatory genes which mediate them in these two different genotypes can be
different. The degradation genes should have a low or no expression in purple sectors of stressed fruits.
Main hypothesis: The fact that anthocyanins accumulate and subsequently disappear in fruits of purple-
fruited genotype during ripening might be due to the following proposed reason. When anthocyanins
accumulate in the fruits, the effect of anthocyanin biosynthetic genes is bigger than that of their degradative
genes; on the contrary, the disappearance of anthocyanins is the result of a shift of this gene expression
ratio towards the degradative genes.
10
4. Materials & Methods
4.1 Plant Materials and Experimental Design
4.1.1 Plant Materials
Two bell pepper genotypes, cv. Tequilla and cv. Stayer (Table 1), were obtained from Enza Zaden B.V. (Enkhuizen,
The Netherlands). Tequilla is a purple-fruited genotype whose fruit colour changes from purple to red during
ripening. Stayer is a yellow-fruited genotype and purple sectors can be formed permanently on the fruit peel
under stress conditions. In both genotypes, purple colour only appears in the fruit peel. Bell peppers were
grown in a greenhouse with standard cultivation procedures under natural light conditions. The day/night
temperature was 21°C/18°C, the relative humidity was 85% and the CO2 concentration was ambient. Bell
peppers were randomly harvested twice. The first time, fruits of cv. Tequila were harvested from four plants
from stage one to stage six (Figure 4A) while fruits of cv. Stayer were harvested from five plants comprising
both normal green fruit and green fruit with purple sectors (Figure 4B). Fruit stage was determined based on
size, colour and firmness. Fruits of stage six and stage seven of cv. Tequila were harvested two week later from
unknown number of plants. Four replicates of Tequila at each stage and three replicates (pooled from five
plants) of Stayer were harvested at the first time while two replicates of Tequila were harvested at the second
time. For Tequilla, peel and flesh of fruits from stage two and stage three were hard to separate so they were
sampled together after removing the seeds. Peel and flesh of Tequilla from stage four to seven were sampled
separately. For Stayer, samples were taken only from peel: purple sectors (S-P) and green parts (S-G) from
stressed fruits and green parts (C-G) from common non-stressed (control) green fruits. In total, there were 49
samples. All the samples were frozen by liquid nitrogen, ground (AKA A11 basic grinder) into fine powder and
stored at -80°C before analyses.
Table 1. Two pepper cultivars used in the experiment.
Cultivars Replicates Characteristics
Stayer N = 3 The colour of immature fruits is green and that of mature fruits is yellow. Purple sectors
can be permanently formed on the peel under stress.
Tequilla Stage 2 to 6: N = 4
Stage 7: N = 2
The fruit colour will change from green to purple and then to red during ripening.
11
Figure 4. Plant materials used in our experiment. (A) Fruit stages of cv. Tequilla from stage one to stage seven. (B) Type of peel used of
cv. Stayer. The left pepper indicated the stressed fruits and the right pepper indicated the common non-stressed fruits.
4.2 Methods
4.2.1 Extraction and analysis of anthocyanins
Freeze-ground samples (0.45-0.55 g) were weighed and put into Eppendorf tubes. Anthocyanins were
extracted with 0.75 mL of 99% methanol and 1% formic acid twice followed by vortex after each extraction.
The extracts were placed in an ultrasonic bath for 10 minutes. After centrifuge (Eppendorf™ Model 5417C) at
20800 g for 10 minutes, the extracts were filtered through 0.2 µm PTFE membrane filter. Quality control
samples were prepared from peel sample of Tequilla on stage four.
All the extracts were analyzed using a Liquid chromatography–mass spectrometry (LC-MS) according to the
protocol described by Wahyuni et al. (2013). Anthocyanins were identified by their absorption wavelength of
520 nm, exact molecular weight, MSn fragmentation pattern in Scripps Center for Metabolmics database
(https://metlin.scripps.edu/index.php) and in-house tomato metabolite database.
4.2.2 RNA extraction and cDNA synthesis
Total RNA was extracted from the same plant materials as those used for metabolic analysis. Samples were
collected from -80°C into liquid nitrogen container. RNA was isolated using QuickGene RNA cultured cell kit
(FujiFilm Life Science). Firstly, lysis buffer (LRC) and 2-Mercaptoethanol (2-ME) was fully mixed before use (10
µL 2-ME per 1mL of LRC). A small spoonful of powdered sample was added into a 2 ml Eppendorf tube with
520 µL LRC & 2-ME mix solution inside. After vortex, 96% ethanol (100 µL) was added into the tube and then
Stage 1 Stage 2 Stage 3
Stage 4 Stage 5 Stage 6 Stage 7
S-P
S-G C-G
A
B
12
vortex again; this step was repeated once by using 96% ethanol (180 µL). Tubes were centrifuged at 20800 g
for 30 seconds and then supernatant were transferred into cartridges. Lysate was pressed through cartridges
using QG-Mini80. WRC buffer (500 µL) was used to wash the cartridges. Secondly, 10*DNAse buffer (4 µL),
Amplification Grade DNAse I enzyme (1 µL; Invitrogen) and Milli-Q water (35 µL) were added into the cartridge
(15 minutes) in order to digest and eliminate DNA. Then the cartridges were washed twice by using WRC buffer
(500 µL). Total RNA was eluted by CRC (100 µL) after two minutes incubation at room temperature. The purity
and quantity (RNA concentration) of RNA was evaluated by NanodropTM spectrophotometer (Thermo Scientific
model 1000) by using 1.5 µL RNA sample. The 260/280 and 260/230 ratios that higher than 1.8 represented a
good purity. The overall quality of the RNA preparation was assessed by electrophoresis on a 1.5% agarose gel
using 200 ng of RNA. After running the gel, samples with two clear visible rRNA bands (1.1kB and 700bp band)
and mRNA smear were stored at -80°C for further steps. For samples with a low RNA concentration, their RNA
were repeatedly extracted and concentrated by RNeasy columns (Quiagen) until sufficient.
Prior to the qRT-PCR, RNA (2 μg) was employed to synthesis into cDNA using the Taqman® Reverse Transcription
Reagent kit (Life Technologies, Applied Biosystems #N8080234) according to manufacturer’s guideline
(Appendix I). This reaction obtained 20 ng cDNA/µL for gene expression analysis.
4.2.3 Candidate gene selection, primer design and gene expression analysis
Structural genes and regulatory genes from anthocyanin biosynthetic pathway and anthocyanin degradative
genes were targets for gene expression analysis. The selection of candidate genes was conducted via database
mining for known anthocyanin genes. A TBLASTN search was applied in the pepper genome database of the
Sol Genomics Network (SGN), based on the best homology with structure genes (CHS, CHI, F3H, F3’H, F3’5’H,
DFR, ANS and UFGT), regulatory genes (R2R3 MYB, bHLH and AN11) and degradative genes (PPO and POD)
underlying anthocyanin biosynthetic and degradative processes in Capsicum annuum (Aza-González et al.,
2013), Solanum lycopersicum, Solanum tuberosum, Solanum melongena, Nicotiana tabacum, Petunia x
hybrida, Brunfelsia pauciflora and Arabidopsis thaliana.
Published reference genes in peppers were compared and evaluated (Aza-González et al., 2013; Li, Li & Peng,
2013). The housing-keeping gene -Actin (CA12g08730) was used as a positive control. The -Actin primers
(ORF: 5’- TGAGCAGGAGCTTGAAACTG - 3’; UTR: 5’- CTTGTCCATCAGGCAATTCA - 3’) were available in our
laboratory. Primers for each candidate gene were designed using Primer3Plus
(http://www.bioinformatics.nl/cgi-bin/primer3plus/ primer3plus.cgi). Candidate genes and primer sequences
were listed in Appendix II.
Real-time PCR amplification of the cDNA was executed as described in Protocol for quantitative Real-Time PCR
(2015) in our laboratory using the C1000 TouchTM Thermal Cycler (Bio-Rad CFX96TM Real-Time System). The RT-
PCR mixture was prepared according to Table 2. For each biological replicate, there were two technical
replicates. The reaction efficiency of RT-PCR and R values were calculated by LinRegPCR program, resulting a
range of 1.8 to 2.1 (efficiency) and 0.99 to 1.00 (R value). The expression of all the candidate genes was
calibrated by the expression of -Actin in order to calculate the relative gene expression (RGE). RGE was used
to generate plots while its normalized log 2 value was employed for statistical analysis. Calculation formulas
13
were as follows:
ΔCt = Ct (reference gene) – Ct (gene of interest)
RGE = 2ΔCt * 100000
LOG 2 of RGE = LOG2RGE
Table 2. The composition of RT-PCR mixture.
Materials Volume (µL)
2*iQ SYBR GREEN super mix 22
Milli-Q water 11
Forward primer (3µM) 4.4
Reverse primer (3µM) 4.4
cDNA 2.2
The RT-PCR is performed in a volume of 20 µL per well. Milli-Q water is a substitute of the cDNA for the No Template Control.
4.2.4 Phylogenetic analysis
The amino acid sequences of 23 genes encoding R2R3-MYB proteins, 12 genes encoding bHLH proteins and
nine genes encoding WD40 proteins were aligned with geneious alignment by Geneious R9 software. The
phylogenetic tree was built based on Neighbor-Joining method through Geneious R9. The R2R3-MYB domain
was used to analysis R2R3-MYB proteins (Appendix III). Genes displayed in the phylogenetic tree were:
Arabidopsis thaliana, AtMYB4 (NP_195574), AtMYB75 (NP_176057), AtMYB90 (NP_176813), AtMYB113
(NP_176811), AtMYB114 (NP_176812); Capsicum annuum, CaA (CAE75745), R2R3-MYB CA02g19560, R2R3-
MYB CA08g19210, R2R3-MYB CA10g11690, R2R3-MYB CA10g11710, MYB12 CA00g59350; Fragaria x
ananassa, FaMYB1 (AAK84064); Nicotiana tabacum, NtAN2 (ACO52470); Petunia x hybrida, PhAN2
(AAF66727); Solanum lycopersicum, SlAN2 (ACT36604), SlANT1 (AAQ55181); Solanum tuberosum, StAN1
(AAX53089), StAN2 (AAX53091); Vitis vinifera, VvMYB4 (NP_001268133), VvMYBA1 (BAD18977), VvMYBA2
(BAD18978); Zea mays, ZmC1 (NP_001106010) and ZmPl (NP_001105885). The whole amino acid sequences
were used to analysis bHLH and WD40 proteins. Genes displayed in the bHLH phylogenetic tree were: AtTT8
(AEE82802), bHLH CA01g02540, NtAN1a (AEE99257), NtAN1b (AEE99258), NtJAF13 (AHY00341), PhAN1
(AAG25927), PhJAF13 (AAC39455), SlAN1 (Solyc09g065100), SlJAF13 (Solyc08g081140), StAN1 (AGC31677),
StJAF13 (ALA13580) and ZmLc (AAA33504). Genes displayed in the WD40 phylogenetic tree were: AN11
CA03g21190, AtTTG1 (CAB45372), FaTTG1 (AFL02466), NtTTG2 (ACN87316), PhAN11 (AAC18914), SlAN11
(Solyc03g097340), StAN11 (AEF01097), StTTG1-like (NP_001305551) and ZmPAC1 (AAM76742).
4.2.5 Statistical analysis
Data in the figures and tables were expressed as mean ± S.E.M. The differences between treatments or
genotypes were analysed by one-way ANOVA. The probability (P-value) lower than 0.05 (level of significance)
was considered to suggest significant difference, namely the null hypothesis was rejected at the 5% level.
Regression analysis and analysis of variance were performed using the simple linear regression model. Fisher’s
Protected LSD was used to determine significant difference (P < 0.05) among means when significant F values
were found. Statistical analyses were carried out using GenStat 17th Edition.
14
15
5. Result
5.1 A short description of experiments:
5.1.1 Experiment 1: Identification and quantitation of anthocyanin
In experiment 1, the structure and concentration of anthocyanins in cv. Stayer and cv. Tequilla were identified,
measured and compared. The structure of anthocyanins was not only compared within ripening process of
Tequilla but also between Tequila and Stayer. By comparing the moiety of anthocyanins, a better understanding
of the developmental and environmental influences on anthocyanin biosynthetic pathway can be achieved. By
measuring the concentration of anthocyanins, the anthocyanin accumulation pattern can be obtained.
Anthocyanin compositions, including the breakdown products, were determined by LC/MS and MS/MS.
5.1.2 Experiment 2: Expression analysis of anthocyanin related genes
Experiment 2 was designed to study the expression level of candidate genes. Candidate structural genes (CHS,
CHI, F3H, F3’H, F3’5’H, DFR, UFGT and ANS), regulatory genes (R2R3-MYB, bHLH and WD40) and degradative
genes (PPO and POD) were selected as described in Materials and Methods. Primers were designed for
candidate genes. RNA synthesized cDNA fragments were amplified by qPCR to get the expression level of all
candidate genes. Candidate genes of the flavonoid/anthocyanin pathway were selected
5.2 Research on anthocyanin structure
This section identified the type of anthocyanin existed in cv. Tequilla and cv. Stayer and explored whether there
were structural changes of anthocyanin during ripening stages in Tequilla and whether the structure of
anthocyanin in these two cultivars is the same.
There were roughly three peaks from each extract at the wavelength of 520 nm where light was generally
absorbed by anthocyanins (Figure 5). The retention time of these peaks was about 15.01, 17.32 and 17.65
minute, respectively. No anthocyanin was detected in either pericarps of all analyzed samples or green peels
(data not shown). By combining the retention time, mass spectra of anthocyanins was obtained based on the
highest relative abundance (Figure 6) and afterwards anthocyanins were deduced according to their mass
values. At retention time 15.01 minute, delphinidin-3-caffeoylrutinoside-5-glucoside (D-CfRut-G) (Figure 6 C&D)
was presumptively recognized with a mass equal to m/z [M+H]+ 935.2452. Meanwhile delphinidin-3-
coumaroylrutinoside-5-glucoside (D-CmRut-G) (Figure 6 A&B) was putatively identified with m/z [M+H]+
919.2512 from two peaks (Figure 5) whose retention time was 17.32 and 17.65 minute, respectively.
16
Figure 5. The LC-PDA chromatogram of peel extract of (A) purple sectors of stressed Stayer (S-P), (B) stage seven of Tequilla, (C) stage
six of Tequilla, (D) stage five of Tequilla and (E) stage four of Tequilla at absorption wavelength of 520nm. The y-axes indicate absorbance
unit (AU) and the x-axes indicate retention time (minute).
17
Figure 6. Mass spectrum of putatively identified anthocyanins D-CmRut-G (A & B) and D-CfRut-G (C & D). The y-axes represent relative
abundance of anthocyanins and the x-axes of A and C represent retention time (minute) while the x-axes of B and D represent m/z.
5.3 Research on the anthocyanin accumulation pattern
This section explored the quantitative changes of anthocyanin during ripening stages of cv. Tequila and
compared the quantitative differences between S-P, S-G and C-G of cv. Stayer.
The accumulation pattern of two anthocyanins in Tequila first increased and then decreased during ripening
(Figure 7). The accumulation patterns summarized from the PDA chromatograph (Figure 7 A) and the mass
spectrum (Figure 7 B) matched with each other. The amount of D-CfRut-G gradually elevated and reached its
highest values at stage six, and the amount of D-CmRut-G sharply increased from stage three to stage four,
maintained the highest content at stage five and then decreased afterwards. There was no significant
difference in the quantity of D-CfRut-G between stage six and seven as well as of D-CmRut-G between stage
four and five.
In both PDA chromatograph (Figure 8 A) and mass spectrum (Figure 8 B) of Stayer, the content of D-CfRut-G
was much lower than that of D-CmRut-G in S-P. There was no anthocyanin detected in S-G or C-G.
RT: 0.00 - 54.98
0 5 10 15 20 25 30 35 40 45 50
Time (min)
0
10
20
30
40
50
60
70
80
90
1000
10
20
30
40
50
60
70
80
90
100
Re
lative
Ab
un
da
nce
17.37
20.7830.4822.04 31.75 35.191.96 47.3239.594.29 49.2213.1411.00
15.01
44.6340.54
27.78 43.1529.9823.5917.45 47.4839.97
37.4519.571.67 2.15 54.2730.2326.97 49.815.79 10.88
NL:8.89E6
Base Peak m/z= 918.50-919.50 MS F017093
NL:2.63E5
Base Peak m/z= 934.50-935.50 MS F017093
Retention time (minute) m/z
Rel
ativ
e A
bu
nd
ance
A
D C
B
18
Figure 7. The absorbance unit per gram obtained from LC-PDA chromatogram (A) and relative abundance per gram obtained from mass
spectrum (B) of two anthocyanins: D-CfRut-G and ( ) and D-CmRut-G ( ) in Tequilla, the purple-fruited genotype, from stage two to
stage seven. Error bars represent standard error (N=4, stage two to stage six; N=2, stage seven). Different letters indicate significant
differences within each anthocyanin according to Fisher’s Protected LSD (P < 0.05, LSDA_D-CfRut-G = 74622, LSDA_D-CmRut-G = 1053544,
LSDB_D-CfRut-G = 676008, LSDB_D-CmRut-G = 4831376).
Figure 8. The absorbance unit per gram obtained from LC-PDA chromatogram (A) and relative abundance per gram obtained from mass
spectrum (B) of two anthocyanins: D-CfRut-G and ( ) and D-CmRut-G ( ) in Stayer, the yellow-fruited genotype. S-P indicated the
purple sectors in stressed fruits; S-G indicated the green peel in stressed fruits and C-G indicated the green peel of normal non-stressed
(control) fruits. Error bars represent standard error (N=3).
5.4 Research on the expression of candidate genes
This section exhibited the expression level of candidate genes in fruits of cv. Tequilla and cv. Stayer. The
A B
19
expression pattern of Tequilla during ripening was studied. Gene expression analysis of candidate genes
putatively involved in the anthocyanin biosynthetic/degradative pathway was carried out by correlating
candidate gene expression patterns with metabolite accumulation profile, aiming to find the promising
candidate genes involved in biosynthetic and degradative pathway of anthocyanins.
5.4.1 Validation of reference genes
The expression level of reference gene (-Actin) was determined by the Ct values. In general, most of samples
showed a stable expression that the majority of Ct values were within one cycle (Ct = 22.24 ± 0.54) while the
range of outliers can be three cycles (Figure 9). In Stayer, Ct values of all samples were within one cycle except
one green peel sample from stressed fruit. In Tequila, Ct values of samples from the same stage of same type
of tissue were within one cycle except one flesh sample from stage four (data not shown). Therefore, the -
Actin gene was good enough to be utilized as a reference gene in this study.
Figure 9. Boxplot (A) and Density plot (B) of Ct value of reference -Actin gene from all samples of Tequilla and Stayer. Ctmean = 22.24
and Ctstandard deviation = 0.54.
5.4.2 Expression pattern of candidate genes in cv. Tequilla
The expression level of candidate biosynthetic genes: CHS CA05g17060, CHI CA11g02280, F3H CA02g21550,
F3’5’H CA11g18550, DFR CA02g22270, ANS CA01g03670 and UFGT CA10g16530 in peel continuously
increased from stage two to stage five and then decreased until stage seven except for that of CHI CA11g02280
gene that no significant difference was found from stage two to stage five (Figure 10). Candidate genes
expressed in flesh were also measured; however, the levels were quite low compared with that in the peel.
The expression levels of CHS CA05g17060, F3H CA02g21550, F3’5’H CA11g18550, DFR CA02g22270, ANS
CA01g03670 and UFGT CA10g16530 in the peel were all significantly higher than that in the flesh during
ripening with the exception of F3H CA02g21550, F3’5’H CA11g18550, DFR CA02g22270, ANS CA01g03670 and
UFGT CA10g16530 that no significant difference was detected at stage seven. The expression level of CHI
CA11g02280 was distinct from the others that no significant variation was observed between peel and flesh.
The expressions of other candidate biosynthetic genes: CHS CA03g02050, CHS CA00g90800 and CHI
CA02g08970 were not depicted in Figure 10 due to their low transcripts (Appendix IV) and the expression of
A B Ct = 22.24 ± 0.54
20
UFGT CA07g00330 was even hardly detected (data not shown).
Figure 10. Expression levels of candidate structural genes and degradative gene of anthocyanin in the fruits of Tequilla, purple-fruited
genotype. Error bars represented SEM. Different letters indicated significant differences according to Fisher’s Protected LSD (P < 0.05,
LSDCHS CA05g17060 = 1.256, LSDCHI CA11g02280 = 1.958, LSDF3H CA02g21550 = 222466, LSDF3’5’H CA11g18550 = 2.268, LSDDFR CA02g22270 = 1.500, LSDANS
e
f
g
g
f
bd cd bc a0
50000
100000
150000
200000
250000
300000
350000
400000
450000
500000
2 3 4 5 6 7
CHS CA05g17060
e e e
dec a
de dbc b
0
5000
10000
15000
20000
25000
30000
35000
40000
45000
50000
2 3 4 5 6 7
CHI CA11g02280 Peel +Flesh
Peel
a
b
d
e
c
abab ab
bab
0
200000
400000
600000
800000
1000000
1200000
1400000
1600000
2 3 4 5 6 7
F3H CA02g21550
a b
cc
b
aa a a a0
50000
100000
150000
200000
250000
300000
350000
400000
450000
500000
2 3 4 5 6 7
F3'5'H CA11g18550
b c
e e
dab b b a
0
100000
200000
300000
400000
500000
2 3 4 5 6 7
DFR CA02g22270
ab
c
c
baa a a a
0
5000
10000
15000
20000
25000
30000
35000
40000
45000
50000
2 3 4 5 6 7
ANS CA01g03670
ab c
de
e
d
abb b b a0
50000
100000
150000
200000
250000
300000
350000
400000
450000
500000
2 3 4 5 6 7
UFGT CA10g16530
cdcd
ef
f
ede
b cb a
0
50000
100000
150000
200000
250000
300000
350000
400000
450000
500000
2 3 4 5 6 7
POD CA02g17240
Ripening stage
RG
E
21
CA01g03670 = 1.287; LSDUFGT CA10g16530 = 2.215 and LSDPOD CA02g17240 = 1.249). The Fisher’s Protected LSD was calculated based on the LOG2RGE
value of CHS CA05g17060, CHI CA11g02280, F3’5’H CA11g18550, DFR CA02g22270, ANS CA01g03670, UFGT CA10g16530 and POD
CA02g17240 and the RGE value of F3H CA02g21550.
The expression pattern of regulatory genes was more complex than that of structural genes. Most of the
regulatory genes showed a significantly higher expression level in peel than in flesh from stage four to stage
six (before turning) except for R2R3-MYB CA10g11710 at stage six and bHLH CA10g02540 (Figure 11). The
expression level of R2R3-MYB CA02g19560 was even higher in flesh than in peel (Appendix IV). Both the
expression patterns of R2R3-MYB CA10g11690 and R2R3-MYB CA10g11710 in peel were initially increased
from stage two to stage five and then decreased afterwards, which was similar to that of most structural genes.
The AN11 CA03g21190 gene also displayed a resembling pattern except for a stable high expression from stage
four to stage six. The bHLH CA10g02540 gene in peel maintained a constant expression level from stage two
to stage five before dropping at stage six. MYB90 (TC18020) had the highest gene expression among all
detected MYB genes. It constantly expressed from stage two to stage five and then decreased at stage six
where no significant difference was observed between peel and flesh (Appendix IV). The MYB12 CA00g59350
and R2R3-MYB CA08g19210 were two candidate regulatory repressors for anthocyanin biosynthesis (Appendix
IV). There was no significant difference in the expression level of MYB12 CA00g59350 from stage two to stage
six before sharply decreasing at stage seven. The expression of R2R3-MYB CA08g19210 continuously dropped
during ripening. The CaA gene (Borovsky et al., 2004) had a very low expression level in both peel and flesh
and its expression pattern was unclear (Appendix IV).
The expression level of candidate degradative gene POD CA02g17240 first rose from stage two to stage five
and then declined until stage seven (Figure 10), which displayed a similar expression pattern to most
biosynthetic genes. The expression level of POD CA02g17240 in the peel was significantly higher than that in
the flesh during fruit development. The expression of other candidate degradative genes: POD CA04g02730
and PPO CA02g15780 was not depicted in Figure 10 due to their low transcripts (Appendix IV).
22
Figure 11. Expression levels of candidate regulatory genes of anthocyanin in the fruits of Tequilla, purple-fruited genotype. Error bars
represented SEM. Different letters indicated significant differences according to Fisher’s Protected LSD (P < 0.05, LSDR2R3-MYB CA10g11690 =
1.357, LSDR2R3-MYB CA10G11710 = 18477, LSDbHLH CA10g02540 = 2644 and LSDAN11 CA03g21190 = 6426). The Fisher’s Protected LSD was calculated
based on the LOG2RGE value of R2R3-MYB CA10g11690 and the RGE value of R2R3-MYB CA10G11710, bHLH CA10g02540 and AN11
CA03g21190.
5.4.3 Expression level of candidate genes in cv. Stayer
Stress greatly induced the expression of candidate biosynthetic genes. The expression level of candidate structural
genes, CHS CA05g17060, CHI CA11g02280, F3H CA02g21550, F3’5’H CA11g18550, DFR CA02g22270, ANS
CA01g03670 and UFGT CA10g16530, as well as regulatory genes, R2R3-MYB CA10g11690 and R2R3-MYB
CA10G11710, in S-P was significantly higher than that in S-G or C-G (Figure 12 & 13). No significant difference
was observed in the expression level of candidate activators, bHLH CA10g02540, AN11 CA03g21190 and
MYB90, as well as candidate repressors, MYB12 CA00g59350 and R2R3-MYB CA08g19210, between S-P, S-G
and C-G (Figure 13 & Appendix IV). The expression level of CHS CA03g02050, CHS CA00g90800, CHI
CA02g08970, R2R3-MYB CA02g19560 and CaA was highest in S-G and their expression levels were quite low,
except for R2R3-MYB CA02g19560 (Appendix IV). The expression of UFGT CA07g00330 was even hardly
detected (data not shown).
There was no significant difference in the expression level of candidate degradative gene, POD CA02g17240
(Figure 12). POD CA04g02730 expressed highest in S-P while PPO CA02g15780 expressed constantly in S-P, S-
G and C-G and their expression level were quite low (Appendix IV).
d d cd d
ab abbc
ab ab a
0
5000
10000
15000
20000
25000
30000
35000
40000
45000
50000
2 3 4 5 6 7
bHLH CA01g02540
a a
b bb
aa a
aa
0
5000
10000
15000
20000
25000
30000
35000
40000
45000
50000
2 3 4 5 6 7
AN11 CA03g21190
cd e
f f
de abc b b a0
50000
100000
150000
200000
250000
300000
350000
400000
450000
500000
2 3 4 5 6 7
CA10g11690 R2R3-MYB
a a
bc
a aa a a a0
50000
100000
150000
200000
250000
300000
350000
400000
450000
500000
2 3 4 5 6 7
CA10g11710 R2R3-MYB
Peel +Flesh
Peel
RG
E
Ripening stage
23
Figure 12. Expression levels of candidate structural genes and degradative gene of anthocyanin in the peel of Stayer. Error bars
represented SEM. Different letters within each gene indicated significant differences according to Fisher’s Protected LSD (P < 0.05,
LSDCHS CA05g17060 = 2.142, LSDCHI CA11g02280 = 2.544, LSDF3H CA02g21550 = 221251, LSDF3’5’H CA11g18550 = 2.046, LSDDFR CA02g22270 = 1.641, LSDANS
a a
b
0
10000
20000
30000
40000
50000
60000
70000
80000
90000
100000
C-G S-G S-P
CHS CA05g17060
a a
b
0
500
1000
1500
2000
2500
3000
3500
4000
4500
5000
C-G S-G S-P
CHI CA11g02280
aa
b
0
100000
200000
300000
400000
500000
600000
700000
800000
900000
1000000
C-G S-G S-P
F3H CA02g21550
a b
c
0
5000
10000
15000
20000
25000
30000
35000
40000
45000
50000
C-G S-G S-P
F3'5'H CA11g18550
a b
c
0
5000
10000
15000
20000
25000
30000
35000
40000
45000
50000
C-G S-G S-P
DFR CA02g22270
aab
b
0
500
1000
1500
2000
2500
3000
3500
4000
4500
5000
C-G S-G S-P
ANS CA01g03670
a b
c
0
5000
10000
15000
20000
25000
30000
35000
40000
45000
50000
C-G S-G S-P
UFGT CA10g16530
0
50000
100000
150000
200000
250000
300000
350000
400000
450000
500000
C-G S-G S-P
POD CA02g17240
Tissues
RG
E
24
CA01g03670 = 2.075; LSDUFGT CA10g16530 = 1.600 and LSDPOD CA02g17240 = 65147). The Fisher’s Protected LSD was calculated based on the LOG2RGE
value of CHS CA05g17060, CHI CA11g02280, F3’5’H CA11g18550, DFR CA02g22270, ANS CA01g03670 and UFGT CA10g16530 and the
RGE value of F3H CA02g21550 and POD CA02g17240.
Figure 13. Expression levels of candidate regulatory genes of anthocyanin in the peel of Stayer. Error bars represented SEM. Different
letters within each gene indicated significant differences according to Fisher’s Protected LSD (P < 0.05, LSDR2R3-MYB CA10g11690 = 488,
LSDR2R3-MYB CA10G11710 = 671, LSDbHLH CA10g02540 = 3587 and LSDAN11 CA03g21190 = 2856). The Fisher’s Protected LSD was calculated based on
the RGE value of R2R3-MYB CA10g11690, R2R3-MYB CA10G11710, bHLH CA10g02540 and AN11 CA03g21190.
5.4.4 Identification of candidate R2R3-MYB, bHLH and WD40 regulators of anthocyanin biosynthesis
Phylogenetic analysis was performed on R2R3-MYB, bHLH and WD40 regulators of pepper (C. annuum),
tomato (S. lycopersicum), potato (S. tuberosum), petunia (Petunia x hybrida), tobacco (N. tabacum), maize (Z.
mays), grapevine (V. vinifera), strawberry (Fragaria x ananassa) and Arabidopsis (Figure 14). The R2R3-MYB
CA10g11710 was grouped in one clade with Anthocyanin 1 gene of potato and tomato. The MYB12
CA00g59350, R2R3-MYB CA02g19560 and R2R3-MYB CA08g 19210 were categorized in one clade with
repressors of anthocyanin synthesis in Arabidopsis, grapevine and strawberry (Figure 14 A). The R2R3 domain
of R2R3-MYB CA10g11690 gene was too short to be performed (Appendix III). The bHLH CA01g02540 gene
was grouped in one clade with JAF13 genes of tomato, potato, tobacco and petunia (Figure 14 B). The AN11
CA03g21190 was categorized in one clade with AN11 genes of tomato, potato and petunia (Figure 14 C).
aa
b
0
500
1000
1500
2000
2500
3000
3500
4000
4500
5000
C-G S-G S-P
R2R3-MYB CA10g11690
a a
b
0
500
1000
1500
2000
2500
3000
3500
4000
4500
5000
C-G S-G S-P
R2R3-MYB CA10g11710
0
5000
10000
15000
20000
25000
30000
35000
40000
45000
50000
C-G S-G S-P
bHLH CA01g02540
0
5000
10000
15000
20000
25000
30000
35000
40000
45000
50000
C-G S-G S-P
AN11 CA03g21190
25
Figure 14. Neighbor-joining phylogenetic tree of R2R3-MYB (A), bHLH (B) and WD40 (C) regulators of anthocyanin biosynthesis, based
on a GENEIOUS amino acid alignment.
5.4.5 The correlations between the expression level of candidate genes
The correlations between the expression level of candidate genes were made based on the results from 5.2.2.
Only the value of genes expressed in peel was used. The candidate genes were selected based on the quantity
of relative gene expression and the genes with a low expression were filtered out. Significant correlations have
been shown between the expression level of each structural gene from CHS CA05g17060 to UFGT CA10g16530
A
B C
26
in both Tequila and Stayer except for CHI CA11g02280 in Tequila that no gene was correlated with it (Figure
15). The expression of regulatory genes, R2R3-MYB CA10g11690 and R2R3-MYB CA10g11710, were strongly
associated with each other. Additionally, they were also highly correlated with that of structural genes in both
Tequila and Stayer, similarly except for CHI CA11g02280 in Tequila. In Tequila (Figure 15 A), likewise, the
expression of R2R3-MYB CA02g19560 was significantly correlated with that of most of the structural genes;
however, its expression level was much higher in flesh than in peel (Appendix IV). The expression of MYB90
significantly associated with that of EBGs (CHS, CHI and F3’5’H) while no association was found with that of
LBGs (DFR, ANS and UFGT). The expression of candidate regulatory repressor of anthocyanin production,
MYB12 CA00g59350 and R2R3-MYB CA08g19210, did not exhibit any correlation with that of structural genes
or other MYB genes. The expression of regulatory gene bHLH CA01g02540 was only associated with that of
CHI CA11g02280 and MYB90. With the exception of CHI CA11g02280 the expression of AN11 CA03g21190 was
associated with that of all candidate structural genes and R2R3-MYB CA10g11690 and R2R3-MYB CA10g11710.
Whereas in Stayer (Figure 15 B), except for R2R3-MYB CA10g11690 and R2R3-MYB CA10g11710 that had been
mentioned above, there was no correlation among regulatory genes or regulatory genes with structure genes.
For Tequilla, the degradative gene POD CA02g17240 was highly correlated with the seven structural genes
tested except for CHI CA11g02280 and with the four regulatory genes except for bHLH CA01g02540 (Figure 15
A). While for Stayer, no correlation was observed between the degradative gene with other genes.
Figure 15. The correlation of candidate genes in two genotypes: (A) Tequilla and (B) Stayer. The positive values in the colourful bar
means positive correlation and the negative values in the colourful bar means negative correlation.
5.4.6 The correlations between the expression level of candidate genes and anthocyanin content
In this section, the correlations between the expression level of each candidate gene and the content of two
anthocyanins were tested. Figure 16 illustrated the correlations between the relative abundance of D-CmRut-
1 CHS CA05g17060
2 CHI CA11g02280
3 F3H CA02g21550
4 F3’5’H CA11g18550
5 DFR CA02g22270
6 ANS CA01g03670
7 UFGT CA10g16530
8 R2R3-MYB CA10g11690
9 R2R3-MYB CA10g11710
10 MYB12 CA00g59350
11 MYB90
12 R2R3-MYB CA02g19560
13 R2R3-MYB CA08g19210
14 bHLH CA01g02540
15 AN11 CA03g21190
16 POD CA02g17240
27
G and the expression level of candidate genes. The expression of structural genes, except for CHI CA11g02280,
was strongly associated with the content of D-CmRut-G. Among the four regulatory genes, only the expression
of bHLH CA01g02540 was not significantly correlated with D-CmRut-G. The degradative gene POD CA02g17240
was also significantly associated with the content of D-CmRut-G. Figure 17 illustrated the correlations between
D-CfRut-G and the candidate genes. Among all the candidate genes, only CHI CA11g02280 and bHLH
CA01g02540 were significantly correlated with the relative abundance of D-CfRut-G. Both of them showed a
negative correlation.
Figure 16. The correlation of relative gene expression (x-axis) of candidate genes and relative abundance of D-CmRut-G (y-axis). The
correlations were performed on the pooled data of Tequilla and Stayer.
Relative gene expression
D-C
mR
ut-
G
28
Figure 16 Continue. The correlation of relative gene expression (x-axis) of candidate genes and relative abundance of D-CmRut-G (y-
axis). The correlations were performed on the pooled data of Tequilla and Stayer.
Relative gene expression
D-C
mR
ut-
G
29
Figure 17. The correlation of relative gene expression (x-axis) of candidate genes and relative abundance of D-CfRut-G (y-axis). The
correlations were performed on the pooled data of Tequilla and Stayer.
Relative gene expression
D-C
fRu
t-G
30
6. Discussion
The transient accumulation of anthocyanins is the main problem for breeding bell peppers with mature purple
fruits. The disappearance of purple pigmentation during ripening in purple bell peppers can be due to the
regulation of two processes – the biosynthesis of anthocyanins and their degradation. The structure and
quantity of anthocyanins in purple-fruited bell peppers and purple sectors formed on the stressed bell pepper
fruits have been studied. The candidate genes involved in anthocyanin accumulation have also been
investigated. In this section, the identification of functional genes is discussed and the mechanism behind the
transient accumulation of anthocyanins is explained.
6.1 The structure of anthocyanins formed during development or induced by stress is the same
It was hypothesized that the structure of anthocyanins in our pepper materials would be delphinidin glycosides
(Hypothesis 1). In experiment 1, we detected and identified two different delphinidin glycosides in the peel of
bell pepper fruits, D-CfRut-G and D-CmRut-G, which confirmed our hypothesis. In addition, the D-CmRut-G has
been reported in pepper before (Lightbourn et al. 2008). According to the PDA chromatograph (Figure 5) and
mass spectrum (Figure 6), the structure of anthocyanins during fruit development remained the same, which
indicates that these major anthocyanins are not subjected to any further structural modifications. In addition,
the structure of anthocyanins in the purple fruits and in the purple sector of stressed fruits was the same,
which is opposite to our Hypothesis 1 that the structure of anthocyanin in purple-fruited genotypes and in
stressed yellow-fruited genotypes might not be the same. This suggests that in both the stress-induced and
fruit development-induced accumulation of anthocyanins the same genetic/enzymatic machinery is involved
at least with respect to the structural part of the pathway. Therefore, the structure of anthocyanin in fruits
may be determined by its genetic background instead of stress influences (Jaakola, 2013).
6.2 The accumulation pattern of anthocyanins
Anthocyanins were only detected in purple peels instead of in either flesh or the green peel, which was
reasonable considering the colour of the tissues. Our result could be confirmed by Lightbourn et al. (2008)’s
observation that anthocyanin pigments accumulated in the outer mesocarp of the pepper fruits.
The purple pigmentation only appears in unripe fruits and disappears during ripening (Borovsky et al., 2004).
It was observed that the anthocyanin accumulation pattern in peel of purple-fruited genotypes firstly increased
from green young fruits to purple immature fruits (Figure 7, stage two to stage five) and then decreased from
purple mature-size fruits to purple-red turning fruits (Figure 7, stage six to stage seven) during ripening, which
was in agreement with our Hypothesis 2 that the anthocyanin concentration may first increase and then
decrease during ripening in purple-fruited genotypes. The anthocyanin accumulation pattern also fitted the
visible developmental pattern of peel during ripening, indicating that the anthocyanin was degraded rather
than masked by other pigments (Borovsky et al., 2004) or influenced by pH. Actually, the cell pH of pepper fruit
is not affected by maturity and it is relatively constant during ripening (Fox et al., 2005; Rahman et al., 2014).
In general, the change in anthocyanin accumulation pattern could be directly reflected by colour
31
transformation of peels.
There was no obvious difference in anthocyanin intensity between purple sectors and purple fruits by visual
assessment. However, the anthocyanin content in purple sectors of stressed fruits was generally lower than
that of purple fruits (Figure 7 & Figure 8). This might due to the dilute effect of green peel around purple
sectors, namely when sampling, it was hard to only sample purple sectors; there was always green peels
included.
6.3 Candidate genes involved in the biosynthetic and degradative processes of anthocyanin
In this section, only the candidate genes with a relative high gene expression are discussed due to their
promising opportunities to be the functional genes.
6.3.1 Expression of candidate genes under developmental regulation
The expression pattern of the majority of candidate genes including the degradative gene was similar in the
peel of purple-fruited genotype. The expression pattern of candidate structural genes (CHS CA05g17060, F3H
CA02g21550, F3’5’H CA11g18550, DFR CA02g22270, ANS CA01g03670 and UFGT CA10g16530) and regulatory
genes (R2R3-MYB CA10g11690 and R2R3-MYB CA10g11710) was in accordance with our Hypothesis 3 that
the structural and regulatory genes of the anthocyanin biosynthesis will first increase and then decrease
during fruit ripening of purple-fruited genotype. This results also matches with previous studies (Borovsky et
al., 2004; Stommel et al., 2009; Aza-González et al., 2013; Deng et al., 2014; Kiferle et al., 2015).
There were some exceptions. The AN11 CA03g21190 activated longer than other regulatory genes (Figure 11),
which may due to its non-intrinsic enzymatic function that it involved in multiple processes to facilitate protein-
protein interactions (Ramsay & Glover, 2005; Koes et al., 2005). So besides promoting anthocyanin biosynthesis,
there might be other processes, for instance suppressing anthocyanin biosynthesis, going on before colour-
turning which need the activation of AN11. For CHI CA11g02280 and bHLH CA10g02540, in addition to their
constant expression in peel from young green fruits to immature purple fruits, their expressions were also
comparable between peel and flesh. In our study, most of the candidate genes expressed in the flesh were
quite lower compared to that in the peel, which was reasonable because anthocyanins were only detected in
the peel. So the gene expression level in flesh could be considered as the background. However, it was not the
case for CHI CA11g02280 and bHLH CA10g02540. The reasons might be as follows. On one hand, CHI gene not
only belongs to EBGs of anthocyanin biosynthesis but also involves in the flavonoid pathway. Besides encoding
anthocyanin enzymes, it can also encode other flavonoid enzymes. Our results agree with previous study that
the expression level of EBGs can be comparable in either pigmented or non-pigmented tissues (Borovsky et al.
2004). On the other hand, it can also suggest that CHI CA11g02280 might not be the right anthocyanin CHI
gene. For bHLH CA10g02540, as it could be involved in multiple processes so there might be some other
processes taking place in the non-pigmented tissue that also need it (Koes et al., 2005; Quattrocchio et al.,
2006). For example, the biosynthesis of proanthocyanidins that are the major phenolic compounds at the
beginning of fruit development (Hichri et al., 2010; Jaakola, 2013). Moreover, according to Figure 14 B, the
bHLH CA10g02540 encoded a protein belonged to the JAF13 clade. In Solanaceae, AN1 is directly involved in
32
the regulation of biosynthetic genes, whereas JAF13 is involved in the regulation of AN1 transcription
(Montefiori et al., 2015). Therefore, the expression pattern of bHLH CA10g02540 does not match our
hypothesis.
The expression pattern of regulatory repressors and degradative gene was not consistent with Hypothesis 3
that the expression of candidate degradative gene and candidate regulatory repressors responsible for
anthocyanin degradation will elevate before colour-turning stage or constantly expressed during
development. Even though the two candidate regulatory repressors, MYB12 CA00g59350 and R2R3-MYB
CA08g19210, were grouped in one clade with MYB repressors in other species (Figure 14 A), their expression
did not perform any significant negative correlation with candidate biosynthetic genes (Figure 15 A). On the
contrary, one positive correlation was observed between R2R3-MYB CA08g19210 and CHI CA11g02280. Thus,
MYB12 CA00g59350 and R2R3-MYB CA08g19210 are not the promising regulatory repressors or at least they
do not repress anthocyanin biosynthesis at the gene expression level. Further research needs to be done to
investigate whether they suppressed the biosynthesis on the protein level. The expression of candidate
degradative gene, POD CA02g17240, increased until purple immature fruit stage. In the berries of grapevine,
the peroxidase activity was also found to increase during ripening (Movahed et al., 2016), which supported
our results to some extent.
Although the expression pattern of R2R3-MYB CA02g19560 in peel also first increased and then decreased, it
was discarded from candidate genes due to its higher expression in flesh (Appendix IV).
6.3.2 Expression of candidate genes under stress regulation
In yellow-fruited genotype, the expression of anthocyanin structural genes (CHS CA05g17060, CHI CA11g02280,
F3H CA02g21550, F3’5’H CA11g18550, DFR CA02g22270, ANS CA01g03670 and UFGT CA10g16530) and MYB
regulatory genes (R2R3-MYB CA10g11690 and R2R3-MYB CA10g11710) was strongly induced by
environmental factors (Figure 12), which was coincided with Hypothesis 4 that the expression level of
biosynthetic genes and regulatory genes will be significantly higher in purple sectors of stressed fruits than
that of green peels of stressed fruits or non-stressed fruits.
There was no significant difference in the expression of bHLH CA10g02540 and AN11 CA03g21190 between
pigmented and non-pigmented tissue. The explanation for bHLH CA10g02540 has been mentioned in 6.3.1.
The expression of AN11 CA03g21190 seemed not to be affected by stress and this was in agreement with
observation obtained from transgenic tomato lines with ectopic anthocyanin synthesis (Kiferle et al., 2015).
This suggests that there is no direct link between stress and the activation of WD40 genes and probably that
basal WD40 expression levels are sufficient to induce anthocyanin synthesis (Kiferle et al., 2015). The
ubiquitously expression of WD40 could also be putatively explained by the network regulation model namely
the combination of MYB and bHLH is adequate for fulfilling the specificity of the regulatory complex (Ma,
Pooler & Griesbach, 2009).
Our results showed that the expression of POD CA02g17240 was not affected by stresses triggering
anthocyanin production which agreed with Hypothesis 4 that the expression level of degradative genes might
33
be similar between pigmented and non-pigmented tissues.
6.3.3 Investigation on which candidate gene is development regulated and which is stress regulated.
The structural genes (CHS CA05g17060, F3H CA02g21550, F3’5’H CA11g18550, DFR CA02g22270, ANS
CA01g03670 and UFGT CA10g16530) were all expressed both under developmental regulation and stressful
regulation, which was in agreement with Hypothesis 5 that the structural genes expressed in purple immature
fruits and purple sectors of stressed fruits may be the same. However, the expression of CHI was highly
induced in purple sectors instead of purple fruits. This indicated that it may be a more stress regulated gene
rather development regulated.
The candidate regulatory genes, R2R3-MYB CA10g11690, R2R3-MYB CA10g11710, bHLH CA10g02540 and
AN11 CA03g21190, in pepper were expressed under both developmental and stressful regulations. This is
different with our Hypothesis 5 that the expression of regulatory genes induced by stress and fruit
development would be different. A R2R3-MYB TF encoded by SIAN2 can mediate anthocyanin production
under both regular and stressed conditions in transgenic tomato fruits. However, the SIANT1, encoding
another R2R3-MYB TF, can only induce anthocyanin production under regular conditions (Kiferle et al., 2015).
Furthermore, different environmental factors can trigger different regulatory complex controlling anthocyanin
biosynthesis (Jaakola, 2013). Therefore, there is variation in the activation of MYB TFs under different
conditions. R2R3-MYB CA10g11690 and R2R3-MYB CA10g11710 are not close to SIAN2 and R2R3-MYB
CA10g11710 is the homologous of SIANT1 (Figure 14 A). Thus, different from tomato, expression of SIANT1
homologous in pepper fruits could both be induced by stress and fruit development.
The candidate degradative gene, POD CA02g17240, was expressed under both developmental and stressful
regulations. However, in contrast to Hypothesis 5 that the degradative genes are hypothesized not or lowly
expressed in purple sectors of stressed fruits, the expression level of POD CA02g17240 in purple sector of
stressed fruits was similar to its highest expression level in purple fruits (Appendix V). In addition, stress did
not enhance or suppress the expression level of POD CA02g17240. Taking both into consideration, it suggested
that, in our study, the expression of POD CA02g17240 was developmentally regulated. Our results did not
provide any evidence whether POD CA02g17240 could be influenced by stress.
6.3.4 Identification of key candidate genes
Significant correlations were observed among the expression level of structural genes (CHS CA05g17060, F3H
CA02g21550, F3’5’H CA11g18550, DFR CA02g22270, ANS CA01g03670 and UFGT CA10g16530), regulatory
genes (R2R3-MYB CA10g11690, R2R3-MYB CA10g11710 and AN11 CA03g21190) and degradative gene (POD
CA02g17240) (Figure 15) as well as between these genes and the content of D-CmRut-G (Figure 16) either
under development regulation or stress regulation. The CHI CA11g02280 showed significant correlation with
other biosynthetic genes under stress induced anthocyanin biosynthesis. Therefore, the structural genes: CHS
CA05g17060, CHI CA11g02280, F3H CA02g21550, F3’5’H CA11g18550, DFR CA02g22270, ANS CA01g03670
and UFGT CA10g16530 and regulatory genes: R2R3-MYB CA10g11690, R2R3-MYB CA10g11710 and AN11
CA03g21190 and degradative gene (POD CA02g17240) were recognized as key candidate genes involved in
34
anthocyanin accumulation.
For bHLH CA10g02540, there was no strong evidence that it was the key regulator in the anthocyanin
biosynthesis; therefore, it cannot be recognized as key candidate gene in our study.
MYB90 had the highest gene expression among all regulatory genes and it significantly associated with EBGs
and bHLH; however, when multiply the expression of MYB90 and bHLH to recalculate the correlation with EBGs,
the correlation with F3’5’H CA11g18550 was not significant anymore (data not show). Thus, MYB90 might
more probably be involved in the regulation other flavonoids instead of anthocyanin. Therefore, it also cannot
be recognized as key candidate gene in our study.
Negative correlations were obtained between the relative abundance of D-CfRut-G and the expression level of
a biosynthetic gene (CHI CA11g02280) and a regulatory gene (bHLH CA10g02540), respectively (Figure 17).
However, the accumulation patterns of these two delphinidin derivatives were quite alike apart from a shift in
time (Figure 7). The D-CmRut-G had the similar accumulation pattern with the key candidate genes at the same
stage while the D-CfRut-G had one stage delay. Thus the negative correlations might result from a shift in the
maximum accumulation due to e.g. a hypothetical caffeoyl-transferase which is responsible for the final step
of acylation of D-CfRut-G production may start to express later then the coumaroyl-transerase that produces
D-CmRut-G.
6.4 Hypothesized mechanisms for anthocyanin regulation
For structural genes, F3H CA02g21550, F3’5’H CA11g18550, DFR CA02g22270, ANS CA01g03670 and UFGT
CA10g16530, and regulatory genes, R2R3-MYB CA10g11690, R2R3-MYB CA10g11710 and AN11 CA03g21190,
their expression levels were comparable between peel and flesh in turning fruits (stage 7), which implied that
the anthocyanin biosynthetic process had already stopped before colour-turning. Even though the
accumulation pattern of POD CA02g17240 was similar to that of biosynthetic genes, its activity in the peel was
always higher than that in the flesh especially at the turning stage so that it still encoded peroxidase to degrade
anthocyanin when key candidate biosynthetic genes have already stopped working (Figure 10). Therefore, it
suggests that the disappearance of purple colour in pepper fruits during ripening might be caused by the
termination of anthocyanin biosynthesis and the continuous anthocyanin degradative process. In the stress
induced anthocyanin biosynthesis, the contribution of biosynthetic genes should be larger than that of
degradative gene, leading to the anthocyanin accumulation in the fruit skin. According to our results, the
stresses that induce anthocyanin accumulation did not influence the key candidate degradative gene in our
study. On the contrary, when the berries of grapevine exposed to high temperature their anthocyanin content
decreased, the expression level of genes encoding peroxidase and the peroxidase activity significantly
increased meanwhile the expression level of biosynthetic genes decreased (Movahed et al., 2016). This implies
that the environmental factors that cause anthocyanin accumulation work by inducing anthocyanin
biosynthesis instead of reducing anthocyanin degradation while the environmental factors that reduce
anthocyanin accumulation work by inducing anthocyanin degradation and suppressing anthocyanin
production at the same time.
35
Our results suggest that anthocyanin accumulation is controlled by both biosynthetic and degradative
processes. The hypothesized mechanism is as follows. In young green fruits, the amount of anthocyanin
produced is less than that degraded so there is no purple pigment accumulated on the fruits skin. During
ripening process, the amount of anthocyanin produced gradually surpasses the amount degraded, thus the
fruits gradually become purple. Before turning stage, there is only anthocyanin degradation, so the fruits
become less purple.
36
7. Conclusion
The transient anthocyanin accumulation in bell pepper fruits is mediated by anthocyanin biosynthetic and
degradative processes. In young green fruits, the amount of anthocyanin produced is less than that degraded
so there is no purple pigment accumulated on the fruits skin. During ripening process, the amount of
anthocyanin produced gradually surpasses the amount degraded, thus the fruits gradually become purple.
Before turning stage, there is only anthocyanin degradation, so the fruits become less purple. Delphinidin-3-
coumaroylrutinoside-5-glucoside and delphinidin-3-caffeoylrutinoside-5-glucoside were the two anthocyanins
detected in pepper fruits in our study. Neither the development nor stress regulation can alter the structure
of anthocyanins in pepper fruits; the structure of anthocyanin should be more dependent on its genetic
background. We only observed anthocyanin accumulation in fruit peel. The purple pigmentation only appeared
in unripe fruits and disappeared during ripening. The anthocyanin accumulation pattern fitted the visual
development pattern, which firstly increased and then decreases with the highest abundance in unripe purple
fruits.
The candidate structural genes, CHS CA05g17060, CHI CA11g02280, F3H CA02g21550, F3’5’H CA11g18550,
DFR CA02g22270, ANS CA01g03670 and UFGT CA10g16530, candidate regulatory genes, R2R3-MYB
CA10g11690, R2R3-MYB CA10g11710 and AN11 CA03g21190, and candidate degradative gene, POD
CA02g17240, were recognized as key candidate genes involved in anthocyanin accumulation. The expression
pattern of biosynthetic genes and degradative genes were strongly correlated with the accumulation pattern
of anthocyanin. The expression of biosynthetic genes stopped before turning concomitant with the continuous
expression of degradative gene. Therefore, the disappearance of purple pigments in fruits of purple-fruited
genotype during ripening is due to the termination of anthocyanin biosynthesis and the continuously
anthocyanin degradation. Stresses that triggered anthocyanin biosynthesis do not show any effect on the
expression of degradative genes, while the environmental factors that triggered anthocyanin degradation
suppress the expression of biosynthetic genes.
On one hand, in our study, the expression of the candidate degradative gene is ubiquitous while the expression
of biosynthetic genes is shut down after turning; therefore, there are two approaches to extend anthocyanin
accumulation in further study, namely, prolonging anthocyanin biosynthesis and stopping anthocyanin
degradation. On the other hand, under both developmental regulation and environmental regulation, when
anthocyanin is degraded, the expression of biosynthetic genes has been suppressed. Whether there is a
negative signaling effect of anthocyanin degradation on the biosynthetic genes might also be an interesting
topic to investigate in the future.
The findings in this thesis provide important insights into anthocyanin regulation in peppers, which give further
research a more clear direction.
37
8. Further Perspectives
8.1 Further research on degradative mechanism
The peroxidase activity of samples should be measured to get a direct impression of its effect in degrading
anthocyanins. This can provide more clues than only analyzing gene expression. The activity of TFs should also
be measured. The expression level of genes encoding regulatory repressors did not match our hypothesis;
however, they did fall into a clade of MYB repressors. So except suppressing at gene level, they might suppress
at protein level. The anthocyanin degradative mechanism will be further unraveled using enzyme assays and
metabolomics.
8.2 Monitoring the pH value
The pH value of fruits during ripening should be measured. In this study, the measured anthocyanin content
of stage six and stage seven was not significantly distinguished. But the differences in fruit colour were quite
big. As the colour of anthocyanin could be influenced by cell pH, it is wise to measure it.
8.3 Discover new candidate genes
The candidate genes used in our study were based on database mining for known anthocyanin genes; however,
there are still many key genes, especially for regulatory and degradative genes, unknown. Therefore, it would
be better to use RNA-Seq to discover new candidate genes.
8.4 Functional analysis of candidate genes
a. The candidate genes can be transformed and expressed in N.benthamiana, E.coli or yeast to study the
gene function.
b. Transient gene expression or silencing can be applied in purple fruit genotypes to further investigate
the function of the candidate genes. The transient gene expression or silencing can be achieved by
Agrobacterium infiltration and virus induced gene silencing (VIGS).
c. Mutagenesis/TILLING can be used to study the candidate gene function and to develop plant materials
with high anthocyanin accumulation and/or low degradation activity. CRISPR CAS9 gene editing can
also be utilized to modify the potential candidate genes, in case an efficient pepper transformation
system can be developed.
8.5 Looking for genetic variations
Allele mining of the candidate genes in the natural pepper diversity and allelic variations can be linked to
anthocyanin biosynthetic or degradative activity. Segregating populations can be created to study the genetics
of these processes using QTL mapping.
38
8.6 Discover the effect of environmental regulation
The effect of light and temperature on anthocyanin biosynthesis and degradation can be analyzed by applying
different light quality, light quantity and temperature treatments.
39
9. References
Ahmed, N. U., Park, J. I., Jung, H. J., Hur, Y., & Nou, I. S. (2014). Anthocyanin biosynthesis for cold and freezing stress tolerance and
desirable color in Brassica rapa. Functional & integrative genomics, 1-12.
Albert, N. W., Davies, K. M., & Schwinn, K. E. (2012, March). Repression-The Dark Side of Anthocyanin Regulation? In II International
Symposium on Biotechnology of Fruit Species 1048 (pp. 129-136).
Arakawa, O., Hori, Y., & Ogata, R. (1985). Relative effectiveness and interaction of ultraviolet-B, red and blue light in anthocyanin
synthesis of apple fruit. Physiologia Plantarum, 64(3), 323-327.
Aza-González, C., Herrera-Isidrón, L., Núñez-Palenius, H. G., De La Vega, O. M., & Ochoa-Alejo, N. (2013). Anthocyanin accumulation
and expression analysis of biosynthesis-related genes during chili pepper fruit development. Biologia Plantarum, 57(1), 49-55.
Barbagallo, R. N., Palmeri, R., Fabiano, S., Rapisarda, P., & Spagna, G. (2007). Characteristic of β-glucosidase from Sicilian blood oranges
in relation to anthocyanin degradation. Enzyme and microbial technology, 41(5), 570-575.
Borovsky, Y., Oren-Shamir, M., Ovadia, R., De Jong, W., & Paran, I. (2004). The A locus that controls anthocyanin accumulation in pepper
encodes a MYB transcription factor homologous to Anthocyanin2 of Petunia. Theoretical and Applied Genetics, 109(1), 23-29.
Boss, P. K., Davies, C., & Robinson, S. P. (1996). Expression of anthocyanin biosynthesis pathway genes in red and white grapes. Plant
molecular biology, 32(3), 565-569.
Butelli, E., Titta, L., Giorgio, M., Mock, H. P., Matros, A., Peterek, S., ... & Martin, C. (2008). Enrichment of tomato fruit with health-
promoting anthocyanins by expression of select transcription factors. Nature biotechnology, 26(11), 1301-1308.
Chalker-Scott, L. (1999). Environmental significance of anthocyanins in plant stress responses. Photochemistry and photobiology, 70, 1-
9.
Cheng, Y. J., Deng, X. P., Kwak, S. S., Chen, W., & Eneji, A. E. (2013). Tolerant potato cultivar selection under multiple abiotic stresses.
Journal of Food, Agriculture & Environment, 11(2), 760-766.
De Pascual-Teresa, S., Moreno, D. A., & García-Viguera, C. (2010). Flavanols and anthocyanins in cardiovascular health: a review of
current evidence. International journal of molecular sciences, 11(4), 1679-1703.
Deng, M. H., Wen, J. F., Huo, J. L., Zhu, H. S., Dai, X. Z., Zhang, Z. Q., ... & Zou, X. X. (2014). Cloning and characterization of two novel
purple pepper genes (CHS and F3H). African Journal of Biotechnology, 11(9), 2389-2397.
Dubos, C., Stracke, R., Grotewold, E., Weisshaar, B., Martin, C., & Lepiniec, L. (2010). MYB transcription factors in Arabidopsis. Trends in
plant science, 15(10), 573-581.
Fox, A. J., Del Pozo-Insfran, D., Lee, J. H., Sargent, S. A., & Talcott, S. T. (2005). Ripening-induced chemical and antioxidant changes in
bell peppers as affected by harvest maturity and postharvest ethylene exposure. HortScience, 40(3), 732-736.
Ghasemnezhad, M., Sherafati, M., & Payvast, G. A. (2011). Variation in phenolic compounds, ascorbic acid and antioxidant activity of
five coloured bell pepper (Capsicum annum) fruits at two different harvest times. Journal of functional foods, 3(1), 44-49.
Gonzali, S., Mazzucato, A., & Perata, P. (2009). Purple as a tomato: towards high anthocyanin tomatoes. Trends in plant science, 14(5),
237-241.
Gou, J. Y., Felippes, F. F., Liu, C. J., Weigel, D., & Wang, J. W. (2011). Negative regulation of anthocyanin biosynthesis in Arabidopsis by a
miR156-targeted SPL transcription factor. The Plant Cell, 23(4), 1512-1522.
Hichri, I., Heppel, S. C., Pillet, J., Léon, C., Czemmel, S., Delrot, S., ... & Bogs, J. (2010). The basic helix-loop-helix transcription factor
MYC1 is involved in the regulation of the flavonoid biosynthesis pathway in grapevine. Molecular plant, 3(3), 509-523.
Holton, T. A., & Cornish, E. C. (1995). Genetics and biochemistry of anthocyanin biosynthesis. The Plant Cell, 7(7), 1071.
40
Jaakola, L. (2013). New insights into the regulation of anthocyanin biosynthesis in fruits. Trends in plant science, 18(9), 477-483.
Kiferle, C., Fantini, E., Bassolino, L., Povero, G., Spelt, C., Buti, S., ... & Gonzali, S. (2015). Tomato R2R3-MYB Proteins SlANT1 and SlAN2:
Same Protein Activity, Different Roles. PloS one, 10(8), e0136365.
Koes, R., Verweij, W., & Quattrocchio, F. (2005). Flavonoids: a colorful model for the regulation and evolution of biochemical pathways.
Trends in plant science, 10(5), 236-242.
Kondo, S., Tomiyama, H., Rodyoung, A., Okawa, K., Ohara, H., Sugaya, S., ... & Hirai, N. (2014). Abscisic acid metabolism and anthocyanin
synthesis in grape skin are affected by light emitting diode (LED) irradiation at night. Journal of plant physiology, 171(10), 823-829.
Lightbourn, G. J., Stommel, J. R., & Griesbach, R. J. (2007). Epistatic interactions influencing anthocyanin gene expression in Capsicum
annuum. Journal of the American Society for Horticultural Science, 132(6), 824-829.
Lightbourn, G. J., Griesbach, R. J., Novotny, J. A., Clevidence, B. A., Rao, D. D., & Stommel, J. R. (2008). Effects of anthocyanin and
carotenoid combinations on foliage and immature fruit color of Capsicum annuum L. Journal of heredity, 99(2), 105-111.
Li, J. G., Li, H. L., & Peng, S. Q. (2013). Three R2R3 MYB transcription factor genes from Capsicum annuum showing differential
expression during fruit ripening. African Journal of Biotechnology, 10(42), 8267-8274.
Ma, H., Pooler, M., & Griesbach, R. (2009). Anthocyanin regulatory/structural gene expression in Phalaenopsis. Journal of the American
Society for Horticultural Science, 134(1), 88-96.
Montefiori, M., Brendolise, C., Dare, A. P., Lin-Wang, K., Davies, K. M., Hellens, R. P., & Allan, A. C. (2015). In the Solanaceae, a hierarchy
of bHLHs confer distinct target specificity to the anthocyanin regulatory complex. Journal of experimental botany, 66(5), 1427-1436.
Movahed, N., Pastore, C., Cellini, A., Allegro, G., Valentini, G., Zenoni, S., ... & Filippetti, I. (2016). The grapevine VviPrx31 peroxidase as
a candidate gene involved in anthocyanin degradation in ripening berries under high temperature. Journal of plant research, 1-14.
Oren-Shamir, M. (2009). Does anthocyanin degradation play a significant role in determining pigment concentration in plants?. Plant
Science, 177(4), 310-316.
Petroni, K., & Tonelli, C. (2011). Recent advances on the regulation of anthocyanin synthesis in reproductive organs. Plant science,
181(3), 219-229.
Quattrocchio, F., Verweij, W., Kroon, A., Spelt, C., Mol, J., & Koes, R. (2006). PH4 of petunia is an R2R3 MYB protein that activates
vacuolar acidification through interactions with basic-helix-loop-helix transcription factors of the anthocyanin pathway. The Plant Cell,
18(5), 1274-1291.
Rahman, M. A., Halim, G. M. A., Chowdhury, M. G. F., Hossain, M. A., & Rahman, M. M. (2014). Changes in physicochemical attributes
of sweet pepper (Capsicum annum L.) during fruit growth and development. Bangladesh Journal of Agricultural Research, 39(2), 373-
383.
Ramsay, N. A., & Glover, B. J. (2005). MYB–bHLH–WD40 protein complex and the evolution of cellular diversity. Trends in plant science,
10(2), 63-70.
Tanaka, Y., & Ohmiya, A. (2008). Seeing is believing: engineering anthocyanin and carotenoid biosynthetic pathways. Current Opinion
in Biotechnology, 19(2), 190-197.
Tanaka, Y., Sasaki, N., & Ohmiya, A. (2008). Biosynthesis of plant pigments: anthocyanins, betalains and carotenoids. The Plant Journal,
54(4), 733-749.
Stommel, J. R., Lightbourn, G. J., Winkel, B. S., & Griesbach, R. J. (2009). Transcription factor families regulate the anthocyanin
biosynthetic pathway in Capsicum annuum. Journal of the American Society for Horticultural Science, 134(2), 244-251.
Vaknin, H., Bar-Akiva, A., Ovadia, R., Nissim-Levi, A., Forer, I., Weiss, D., & Oren-Shamir, M. (2005). Active anthocyanin degradation in
Brunfelsia calycina (yesterday–today–tomorrow) flowers. Planta, 222(1), 19-26.
41
Wahyuni, Y., Ballester, A. R., Tikunov, Y., de Vos, R. C., Pelgrom, K. T., Maharijaya, A., ... & Bovy, A. G. (2013). Metabolomics and molecular
marker analysis to explore pepper (Capsicum sp.) biodiversity. Metabolomics, 9(1), 130-144.
Xu, F., Cao, S., Shi, L., Chen, W., Su, X., & Yang, Z. (2014). Blue light irradiation affects anthocyanin content and enzyme activities involved
in postharvest strawberry fruit. Journal of agricultural and food chemistry, 62(20), 4778-4783.
Zhang, Y., De Stefano, R., Robine, M., Butelli, E., Bulling, K., Hill, L., ... & Schoonbeek, H. J. (2015). Different Reactive Oxygen Species
Scavenging Properties of Flavonoids Determine Their Abilities to Extend the Shelf Life of Tomato. Plant physiology, 169(3), 1568-1583.
Zipor, G., Duarte, P., Carqueijeiro, I., Shahar, L., Ovadia, R., Teper-Bamnolker, P., ... & Oren-Shamir, M. (2015). In planta anthocyanin
degradation by a vacuolar class III peroxidase in Brunfelsia calycina flowers. New Phytologist, 205(2), 653-665.
42
10. Appendix I –Reverse transcription reaction
Table S1. Protocol of reverse transcription reaction
Materials Quantity (µL)
10* Taqman RT buffer 10.00
MgCl2 22.00
dNTP mix 20.00
oligo dT 5.00
RNase inhibitor 2.00
MultiScribe rev. transcriptase 2.5
RNA (2µg) X
Milli-Q water 38.50- X
Total volume 50.00
Reverse transcription program:
25 °C, 10 min (annealing of primer)
48 °C, 30 min (extension)
95 °C, 5 min (deactivate the RTenzyme)
The concentration is 20 ng cDNA/µl.
43
11. Appendix II – Candidate genes and primers
Table S2. List of accession, source and primers of candidate genes
Gene Accession Source The forward primer (5’-3’) The reverse primer (5’-3’)
Chalcone synthase CA00g90800 SGN GAGGCCTTTGTTTGAGCTTG AATGCCAAGAGATCCGAATG
Chalcone synthase CA03g02050 SGN GGGCGCTAGAGTTCTTGTTG AATGTAAGCCCAACCTCACG
Chalcone synthase CA05g17060 SGN CATTGGGGATTTCTGATTGG GGCCTTTCTCATTTCATCCA
Chalcone isomerase CA02g08970 SGN TGCCATCAAGAAGCTCACTG AGGCCCTGCAGAGTAGTTCA
Chalcone isomerase CA11g02280 SGN AGCTCCAAGGAGTTGAACGA TTTCGATGGCCTCACTCTCT
Flavanone 3-hydroxylase CA02g21550 SGN ACGCTGATCATCAAGCAGTG CTTTTCGGCAACCTCTTCAG
Flavonoid 3',5'-hydroxylase CA11g18550 SGN CCTCGAGGGAATGATTTTGA CCATAGCTTCGAGAGGGACA
Dihydroflavonol 4-reductase CA02g22270 SGN CAAGGCAGAGGGAAGATTCA TCTGTCGGCAAGTCTCAATG
Anthocyanin synthase CA01g03670 SGN ATTTCATGGGCGATTTTCTG GGAGGCTTTTTGTTCAGCAG
Flavonoid 3-glucosyl
transferase
CA10g16530 SGN TGGAAATCTTGGCACATTCA GCCAAACATTCTCCACCATT
UDP-glucose:anthocyanidin
3-O-glucosyltransferase
CA07g00330 SGN TAGCTGACGCGTTTATGTGG ATTTCATCTTCGCGTCCATC
R2R3-MYB transcription
factor MYB12
CA00g59350 SGN CCTAAAGCTGCTGGTCTGCT GGACCACCTATTGCCAAGAA
R2r3-myb transcription
factor
CA02g19560 SGN TCATGTTCCCATCAAGACGA TGTGCTCCTTGTTGCATTTC
R2R3-MYB transcription
factor
CA08g19210 SGN GGCATTGATCCAACAACACA TTGTCGAGAAGGAGGGCTAA
CaA AJ608992 NCBI TGATGGAGTTCAATGGTGGA CCCAACCATCACTTTGTCCT
MYB113 (Yuni) CA10g11650 TGATGGAGTTCAATGGTGGA CCCAACCATCACTTTGTCCT
R2R3-MYB transcription
factor
CA10g11690 CCTCAACCTCGGAACTTCTC CATCCCAACCACCATCACTT
R2R3-MYB transcription
factor
CA10g11710 CGTGGTGCAACAACAAAAGT GGAGTTGCCTCCACCATTTA
MYB90 (Yuni) GGATCTCATCACATGGGACA CAGATGGGAAACCAGGGATA
Myc-like anthocyanin
regulatory protein
CA01g02540 SGN TCAGCAAAGAAAATCGCAGA TGCTGATCTAGCCTCCAGGT
AN11 CA03g21190 SGN TGAGGGATAAGGAGCATTCG GCATTGCCGGAGACCTAATA
Peroxidase CA02g17240 SGN CCAATGCAACTGCTCTGCTA AGCAGCAAAATCTCCCAAGA
Peroxidase CA04g02730 SGN ACCGCTGGATTTGATGACTC AAACATCGCGAATTTCCAAC
Polyphenol oxidase CA02g15780 SGN GTCCAACGCCTAGGGTATCA TCTTGTTTGGCCTTTTCACC
Actin (Yuni) TGAGCAGGAGCTTGAAACTG CTTGTCCATCAGGCAATTCA
44
12. Appendix III - R2R3-MYB domain
Figure S1. The R2R3-MYB domain used to make phylogenetic analysis.
45
13. Appendix IV - Relative gene expression of all candidate genes
Table S3. Relative gene expression of all candidate genes in Tequilla and Stayer.
Gene Genotype Peel / Peel + Flesh RGE Flesh RGE
CHS CA00g90800 Tequilla T II P+F 1581 ± 383
T III P+F 446 ± 76
T IV P 175 ± 70
T IV F 28 ± 8
T V P 32 ± 4
T V F 17 ± 2
T VI P 45 ± 11
T VI F 141 ± 38
T VII P 64 ± 22 T VII F 112 ± 47
Stayer C-G 52 ± 20
S-G 364 ± 80
S-P 76 ± 15
CHS CA03g02050 Tequilla T II P+F 55 ± 14
T III P+F 73 ± 4
T IV P 164 ± 22 T IV F 34 ± 10
T V P 70 ± 10 T V F 31 ± 6
T VI P 87 ± 30 T VI F 244 ± 72
T VII P 100 ± 23 T VII F 151 ± 88
Stayer C-G 56 ± 19
S-G 379 ± 93
S-P 126 ± 38
CHS CA05g17060 Tequilla T II P+F 30544 ± 10417
T III P+F 79711 ± 20080
T IV P 346847 ± 65823 T IV F 6196 ± 1281
T V P 320087 ± 27790 T V F 3364 ± 931
T VI P 82725 ± 24483 T VI F 1535 ± 320
T VII P 931 ± 233 T VII F 188 ± 70
Stayer C-G 580 ± 298
S-G 1203 ± 155
S-P 57449 ± 19820
CHI CA02g08970 Tequilla T II P+F 27 ± 10
T III P+F 19 ± 5
T IV P 31 ± 8 T IV F 17 ± 4
T V P 17 ± 5 T V F 16 ± 3
T VI P 39 ± 10 T VI F 119 ± 32
T VII P 78 ± 47 T VII F 86 ± 26
Stayer C-G 24 ± 11
S-G 232 ± 64
S-P 57 ± 28
CHI CA11g02280 Tequilla T II P+F 8504 ± 951
T III P+F 8012 ± 1288
T IV P 7070 ± 3034
T IV F 3019 ± 588
T V P 3078 ± 1034
T V F 1816 ± 694
T VI P 433± 155
T VI F 163 ± 47
T VII P 35± 33 T VII F 97 ± 63
Stayer C-G 43 ± 30
S-G 38 ± 17
S-P 1700 ± 125
46
Table S3 Conti. Relative gene expression of all candidate genes in Tequilla and Stayer.
Gene Genotype Peel / Peel + Flesh RGE Flesh RGE
F3H CA02g21550
Tequilla T II P+F 22975 3970
T III P+F 245813 ± 81556
T IV P 950897 ± 54006
T IV F 76854 ± 20197
T V P 1298161 ± 103323
T V F 120999 ± 36801
T VI P 605193 ± 125828
T VI F 235410 ± 68628
T VII P 76034 ± 7042
T VII F 220224 ± 36239
Stayer C-G 152436 ± 36120
S-G 185088 ± 22693
S-P 643015 ± 102197
F3’5’H CA11g18550 Tequilla T II P+F 1209 ± 757
T III P+F 15827 ± 6771
T IV P 328061 ± 102435
T IV F 1470 ± 721
T V P 355250 ± 114449
T V F 771 ± 198
T VI P 46303 ± 14870
T VI F 906 ± 200
200 T VII P 220 ± 78 T VII F 252 ± 30
Stayer C-G 136 ± 55
S-G 574 ± 116
S-P 16823 ± 8130
DFR CA02g22270 Tequilla T II P+F 1176 ± 411
T III P+F 9828 ± 4560
T IV P 77032 ± 15910
T IV F 1219 ± 441
T V P 72299 ± 14644
T V F 905 ± 168
T VI P 24541 ± 3900
T VI F 850 ± 181
T VII P 185 ± 22
T VII F 148 ± 26
Stayer C-G 158 ± 54
S-G 506 ± 138
S-P 9494 ± 3822
ANS CA01g03670 Tequilla T II P+F 511 ± 84
T III P+F 3628 ± 1409
T IV P 29264 ± 8612
T IV F 437 ± 161
T V P 34492 ± 7645
T V F 374 ± 85
T VI P 2937 ± 318
T VI F 411 ±1 08
T VII P 230 ± 51 T VII F 225 ± 55
Stayer C-G 114 ± 30
S-G 313 ± 68
S-P 1825 ± 1172
UFGT CA10g16530 Tequilla T II P+F 1124 ± 554
T III P+F 11849 ± 4987
T IV P 147095 ± 30942
T IV F 2076 ± 1134
T V P 223840 ± 59803
T V F 1180 ± 136
T VI P 46812 ± 16333
T VI F 1722 ± 511
T VII P 297 ± 20
T VII F 190 ± 23
Stayer C-G 151 ± 60
S-G 484 ± 84
S-P 26796 ± 11076
47
Table S3 Conti. Relative gene expression of all candidate genes in Tequilla and Stayer.
Gene Genotype Peel / Peel + Flesh RGE Flesh RGE
MYB12 CA00g59350 Tequilla T II P+F 5196 ± 970
T III P+F 4615 ± 1153
T IV P 6675 ± 1232 T IV F 1655 ± 346
T V P 5702 ± 719
T V F 1241 ± 307
T VI P 8569 ± 1155
T VI F 575 ± 146
T VII P 588 ± 68 T VII F 138 ± 39
Stayer C-G 1858 ± 107
S-G 2284 ± 634
S-P 1770 ± 228
R2R3-MYB CA02g19560 Tequilla T II P+F 309 ± 47
T III P+F 471 ± 163
T IV P 754 ± 272 T IV F 2655 ± 1255
T V P 1018 ± 357
T V F 2922 ± 285
T VI P 224 ± 37
T VI F 570 ± 137
T VII P 195 ± 43
T VII F 331 ± 59
Stayer C-G 186 ± 67
S-G 500 ± 108
S-P 190 ± 23
R2R3-MYB CA08g19210 Tequilla T II P+F 7939 ± 2455
T III P+F 3050 ± 581
T IV P 4338 ± 1629
T IV F 894 ± 231
T V P 1879 ± 727
T V F 721 ± 193
T VI P 606 ± 45
T VI F 272 ± 70
T VII P 165 ± 33
T VII F 145 ± 33
Stayer C-G 314 ± 26
S-G 764 ± 172
S-P 530 ± 46
CaA Tequilla T II P+F 67 ± 10
T III P+F 39 ± 9
T IV P 63 ± 24 T IV F 26 ± 9
T V P 28 ± 9 T V F 14 ± 3
T VI P 21 ± 5 T VI F 70 ± 18
T VII P 30 ± 2 T VII F 51 ± 16
Stayer C-G 31 ± 15
S-G 108 ± 25
S-P 50 ± 4
MYB113 CA10g11650 Tequilla T II P+F 108 ± 26
T III P+F 82 ± 21
T IV P 130 ± 38 T IV F 47 ± 17
T V P 52 ± 19 T V F 27 ± 7
T VI P 49 ± 9 T VI F 150 ± 38
T VII P 96 ± 29 T VII F 118 ± 19
Stayer C-G 98 ± 25
S-G 332 ± 74
S-P 128 ± 18
48
Table S3 Conti. Relative gene expression of all candidate genes in Tequilla and Stayer.
Gene Genotype Peel / Peel + Flesh RGE Flesh RGE
R2R3-MYB CA10g11690 Tequilla T II P+F 2172 ± 675
T III P+F 8175 ± 2238
T IV P 55855 ± 8667
T IV F 1003 ± 258
T V P 58415 ± 7601
T V F 725 ± 165
T VI P 3723 ± 984
T VI F 456 ± 94
T VII P 110 ± 65 T VII F 88 ± 6
Stayer C-G 198 ± 96
S-G 210 ± 15
S-P 1516 ± 224
R2R3-MYB CA10g11710 Tequilla T II P+F 2969 ± 1138
T III P+F 8522 ± 2602
T IV P 56343 ± 9106
T IV F 1179 ± 184
T V P 86680 ± 14250
T V F 845 ± 160
T VI P 4221 ± 1035
T VI F 633 ± 103
T VII P 228 ± 100
T VII F 261 ± 42
Stayer C-G 420 ± 200
S-G 604 ± 62
S-P 1745 ± 263
MYB90 (Yuni) Tequilla T II P+F 97282 ± 9986
T III P+F 78962 ± 19681
T IV P 123341 ± 23414
T IV F 60782 ± 12317
T V P 102202 ± 24637
T V F 57367 ± 14388
T VI P 20754 ± 3318
T VI F 20364 ± 4936
T VII P 31992 ± 5518
T VII F 29017 ± 3100
Stayer C-G 18725 ± 6555
S-G 13620 ± 643
S-P 11820 ± 4720
bHLH CA01g02540 Tequilla T II P+F 7774 ± 766
T III P+F 6087 ± 1793
T IV P 6065 ± 499 T IV F 4219 ± 1228
T V P 6831 ± 436 T V F 2653 ± 462
T VI P 1653 ± 204 T VI F 1600 ± 193
T VII P 1752 ± 88 T VII F 1489 ± 122
Stayer C-G 4774 ± 1650
S-G 4086 ± 87
S-P 3407 ± 701
AN11 CA03g21190 Tequilla T II P+F 7718 ± 716
T III P+F 7647 ± 1397
T IV P 16335 ± 2768
T IV F 8139 ± 1784
T V P 17085 ± 1440
T V F 7350 ± 1036
T VI P 17741 ± 4060
T VI F 5310 ± 1598
T VII P 6615 ± 899
T VII F 1938 ± 698
Stayer C-G 6458 ± 1081
S-G 7261 ± 420
S-P 5301 ± 836
49
Table S3 Conti. Relative gene expression of all candidate genes in Tequilla and Stayer.
Gene Genotype Peel / Peel + Flesh RGE Flesh RGE
POD CA02g17240 Tequilla T II P+F 15870 ± 672
T III P+F 20675 ± 7092
T IV P 71174 ± 4503
T IV F 3887 ± 928
T V P 148455 ± 33614
T V F 12404 ± 6574
T VI P 58797 ± 10461
T VI F 3477 ± 1162
T VII P 36885 ± 9902
T VII F 384 ± 50
Stayer C-G 94291 ± 19203
S-G 81397 ± 17144
S-P 110226 ± 20015
POD CA04g02730 Tequilla T II P+F 580 ± 44
T III P+F 175 ± 89
T IV P 97 ± 23 T IV F 19 ± 4
T V P 24 ± 5 T V F 10 ± 2
T VI P 303 ± 96 T VI F 86 ± 19
T VII P 68 ± 24 T VII F 75 ± 7
Stayer C-G 106 ± 25
S-G 725 ± 225
S-P 1782 ± 791
PPO CA02g15780 Tequilla T II P+F 377 ± 132
T III P+F 50 ± 10
T IV P 58 ± 29 T IV F 52 ± 16
T V P 30 ± 7 T V F 34 ± 10
T VI P 94 ± 27 T VI F 186 ± 72
T VII P 85 ± 7 T VII F 152 ± 32
Stayer C-G 63 ± 24
S-G 384 ± 67
S-P 112 ± 13
50
14. Appendix V-The expression level of POD CA02g17240 in purple sector
of stressed Stayer and peel of purple-fruited genotype
Figure S2. The expression level of POD CA02g17240 in purple sector of stressed Stayer and peel of purple-fruited genotype. Y-axis
indicates the relative gene expression and x-axis indicates the purple sector of stress Stayer and the ripening stage from stage four to
stage seven of Tequilla. Error bars represented SEM. Different letters indicated significant differences according to Fisher’s Protected
LSD (P < 0.05, LSD = 0.8163). The Fisher’s Protected LSD was calculated based on the LOG2RGE value of POD CA02g17240.
cd
bc
d
ab
a
0
20000
40000
60000
80000
100000
120000
140000
160000
180000
200000
S-P 4 5 6 7
RG
E
Stayer Tequilla