Proc. Nati. Acad. Sci. USAVol. 85, pp. 7089-7093, October 1988Biochemistry

An evolutionarily conserved protein binding sequence upstream ofa plant light-regulated gene

(gel retardation assay/DNA binding protein/tomato/Arabidopsis/small subunit of ribulose 1,5-bisphosphate carboxylase/oxygenase genes)

G. GIULIANOa'b, E. PICHERSKYcd, V. S. MALIKce, M. P. TIMKOc'f, P. A. SCOLNIK5, AND A. R. CASHMOREa'c'haPlant Science Institute, Department of Biology, University of Pennsylvania, Philadelphia, PA 19104; 'Laboratory of Cell Biology, Rockefeller University,New York, NY 10021; and 9DuPont, Plant Science Group, Experimental Station, Wilmington, DE 19898

Communicated by Winslow R. Briggs, June 6, 1988 (received for review March 8, 1988)

ABSTRACT A protein factor, identified in nuclear ex-tracts obtained from tomato (Lycopersicon escukntum, Sola-naceae) and Arabidopsis thaliana (Brassicaceae) seedlings,specifically binds upstream sequences from the plant light-regulated gene family encoding the small subunit of ribulose1,5-bisphosphate carboxylase/oxygenase (RBCS). RBCS up-stream sequences from tomato, pea (Pisum sativum, Legumi-nosae), and Arabidopsis are recognized by the factor. The factorrecognition occurs via a short conserved sequence (G box)whose consensus; sequence is 5'-TCTTACACGTGGCAYY-3'(where Y is pyr e). This sequence is distinct from the GTmotif descri Piously in RBCS promoters. Two otherconserved , showing a lesser degree of evolutionaryconservation o ind upstream of the G box but do not bindto the G box binding factor (GBF). Twelve nucleotides withinthe G box are sufficient for the formation of a stable DNA-GBFcomplex. GBF is found in both light-grown and dark-adaptedtomato leaf extracts, but it is present in greatly reducedamounts in root extracts.

The small subunit of ribulose 1,5-bisphosphate carboxylase/oxygenase (RBCS), a chloroplast enzyme active in photo-synthetic CO2 fixation, is encoded in higher plants by theRBCS nuclear gene family (1-3). Expression of these genesis controlled by both tissue-specific factors and by light (4-7). RBCS genes are highly transcribed in chloroplast-containing tissues, such as leaves, but not in roots. Plantsgrown in the light show much higher RBCS transcriptionlevels than dark-adapted plants. RBCS upstream sequencesas far as 1 kilobase from the transcription start point havebeen shown to be important for light-regulated and tissue-specific expression in transgenic plants. A complex array ofpositive and negative regulatory elements has been identifiedin these sequences, including enhancer-like elements able toconfer light-inducible and tissue-specific expression in eitherorientation to constitutive promoters (6, 8-10).

In general, promoter and enhancer function appears torequire an interaction with sequence-specific DNA bindingproteins (11). For example, discrete regions within theimmunoglobulin heavy-chain enhancer bind at least fourtypes of factors. Because of an apparent functional redun-'dancy, no one binding site is crucial in the full enhancer;however, simultaneous mutation at several sites impairsfunction (12).

Likewise, in the case of the pea RbcS-3A light-induciblepromoter, a factor present in nuclear extracts from peaseedlings, GT-1 (13) has been shown to bind to severalregions (boxes II, III, II*, III*) present in this promoter. Inhybrid constructs, boxes II and III are able to repress, in thedark, transcription driven by the cauliflower mosaic virus 35Sconstitutive enhancer (10). Nevertheless, in the full promoter

context, none of these boxes, if mutated separately, has aprofound effect on the expression of the gene. It has beensuggested (13) that this is due to the redundancy of the GT-1binding sequences in this promoter. It is possible thatadditional protein binding sequences are required for RBCSgene transcription. Here, we present evidence for the exist-ence in tomato and Arabidopsis of a protein factor, GBF(G-box binding factor), that recognizes a sequence distinctfrom boxes II and III of pea. This sequence, which we call Gbox, is strongly conserved during evolution of RBCS genesin dicotyledonous plants.

MATERIALS AND METHODSNuclei were prepared from leaves of 3-week-old tomato orArabidopsis plantlets by grinding in ice-cold buffer A (1 g/2ml) (0.8 M sucrose/10 mM MgCl2/25 mM Tris'HCl, pH7.8/0.5 mM phenylmethylsulfonyl fluoride/0.5 mMbenzamidine/6 mM 2-mercaptoethanol) with a Polytron ho-mogenizer. Nuclei were filtered through two layers ofcheese-cloth, pelleted (25,000 x g, 5 min), resuspended in buffer B[buffer A with sucrose reduced to 0.46 M and with 0.5%(vol/vol) Triton X-100], and pelleted again through a cushionof 75% (vol/vol) Percoll in buffer B (without Triton X-100)(5000 x g, 30 min). The nuclei were resuspended in buffer C[25% (vol/vol) glycerol/20mM Hepes KOH, pH 8.0/0.4 mMEDTA/0.5 mM phenylmethylsulfonyl fluoride/0.5 mMbenzamidine/l mM dithiothreitol) and lysed by adding am-monium sulfate to 0.5 M and rocking for 30 min at 40C. Aftercentrifugation at 300,000 x g for 1 hr, proteins in thesupernatant were precipitated with 0.35 g of ammoniumsulfate per ml, resuspended in bufferD (buffer C with 100mMKCI) at 2-10 mg/ml, dialyzed in the same buffer for 2 hr, andstored in aliquots at - 70'C. In certain cases, such as theextracts used in Fig. 5, biological activity of nuclei was alsoassayed by in vitro run-on transcription. The amount oftranscription found was always proportional to the number ofnuclei visible under the microscope as well as to the amountof extractable protein.

Binding assays (final vol, 10 ,ul) contained 10 mM HepesKOH (pH 8.0), 1 mM MgC12, 2% Ficoll 400, 2 pA of proteinextract, and 5 gg (unless indicated otherwise) of poly(dI-

Abbreviations: RBCS, small subunit ofthe ribulose 1,5-bisphosphatecarboxylase/oxygenase; GBF, G-box binding factor.bPresent address: Consiglio Nazionale delle Ricerce, Istituto diMutagenesi e Differenziamento, Via Svezia 10, 56100 Pisa, Italy.dPresent address: Department of Biology, University of Michigan,Ann Arbor, MI 48109.ePresent address: Philip Morris Research Center, Richmond, VA23261.'Present address: Department of Biology, University of Virginia,Charlottesville, VA 22903.hTo whom reprint requests should be addressed at: Plant ScienceInstitute, Department of Biology, University of Pennsylvania,Philadelphia, PA 19104.

7089

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

May

27,

202

1

7090 Biochemistry: Giuliano et al.

dC)poly(dI-dC) (14) (Pharmacia). Linearized competitorplasmid DNA was added at 400 ng per reaction mixture. Thiscorresponds to the following molar amounts (plasmid namesare in parentheses): 0.1 pmol (pSAc3), 0.13 pmol (plA27),0.15 pmol (p3.3), 0.17 pmol (p4.17), 0.19 pmol (plA270.6RV),0.21 pmol (pSlPS, pIGL2, pG3.6), 0.23 pmol (pMT02, pG1,pG4). After a 10-min preincubation, 1 1.l (1 ng, or 10 fmol)of 3' end-labeled probe was added. The reaction mixture wasincubated for 30 min at room temperature before analysis bynondenaturing gel electrophoresis (14). For DNase I "foot-printing," reaction mixtures were scaled up 8-fold andtreated with 2 units of DNase I (Boehringer Mannheim) for 1min at room temperature immediately before loading on arunning gel. The free and bound probes were eluted in 0.5 Mammonium acetate/1 mM EDTA, purified through Elutips(Schleicher & Schuell), and equal amounts of radioactivitywere loaded on an 8% acrylamide urea sequencing gel (15).Oligonucleotides used in competition experiments werecloned in single copy in the HindIII site of pUC9.

RESULTSIdentification of the Tomato andArabidopsis GBF. A tomato

nuclear extract and various probes spanning positions - 1000to - 31 from the first ATG of the tomato RbcS-3A gene (3)were analyzed by the gel electrophoresis DNA binding assay(16-18). One probe, spanning positions - 411 to - 242, gavea prominent retarded band in the presence of a high excess ofnonspecific competitor DNA (Fig. L4, lanes 4 and 5),suggesting that it was interacting with a factor present in theextract. This interaction was abolished by protease, but notby RNase, and was sensitive to heparin, an inhibitor ofDNA-protein interactions (23) lanes 6-8).GBF specificity for the RbcS-3A promoter was established

by competition assays. A plasmid containing the wholeRbcS-3A upstream region efficiently competes for GBF,

A B C1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 9 1 2 3 4

B

B-

F- fih-F

FIG. 1. Interaction of GBF with RBCS upstream sequences. Fand B, free and bound probe. (A) Tomato nuclear extract assayedwith a probe spanning the -411 to -242 region from the first ATGof the RbcS-3A gene (3). Lane 1, no extract; lanes 2-8, extract (8 jgof protein) added; lanes 2-5 contain 0, 0.5, 2.5, and 5 ,ug, respec-tively, of poly(dI-dC)poly(dI-dC); lanes 6-8 contain 5 ,ug of poly(dI-dC)poly(dI-dC) and 1 jig of proteinase K, RNase A, or heparin,respectively. (B) Competition of the binding. All lanes are as in A(lane 5) and contain 400 ng of the following linearized plasmids ascompetitors: lane 1, pUC9; lane 2, p3.3 (tomato RbcS-3A, - 1300 to-31); lane 3, p4.17 (tomato RbcS-3A, -1300 to -403); lane 4,pSiPS (tomato RbcS-1, - 697 to - 493); lane 5, pG3.6 [pea RbcS-3.6(19), -320 to -120]; lane 6, pIGL2 [Arabidopsis RbcS-JA (20),- 340 to -147]; lane 7, plA27 [2.0-kilobase EcoRI fragment con-taining the tomato Cab-lB (21) gene]; lane 8, plA270.6RV (tomatoCab-lB, - 744 to -110); lane 9, pSAc3 [3.0-kilobase HindIIlfragment containing a soybean actin gene (22)]. (C) Binding andcompetition of an Arabidopsis nuclear extract. The conditions are asin B except that the probe is a -340 to -147 fragment from theArabidopsis RbcS-IA gene. Lanes 1-4 contain pUC9, pIGL2, p3.3,and pG3.6, respectively. Each reaction mixture contained 4 jig ofprotein.

whereas the plasmid alone does not (Fig. 1B, lanes 1 and 2).A probe containing sequences - 1300 to - 403 did not impairGBF binding (lane 3), suggesting that the factor recognitionsite is not repeated in far upstream sequences. Promotersequences from other RBCS genes of tomato (3), pea (19),and Arabidopsis (20) are efficient competitors (lanes 4-6). Incontrast, tomato Cab-lB (21) (a gene encoding a chlorophylla/b binding protein) and soybean actin (22) upstream se-quences are poor competitors (lanes 7-9).To test whether Arabidopsis also contains GBF, we per-

formed gel shift assays with Arabidopsis nuclear extract.Indeed, the Arabidopsis RbcS-IA fragment, which bindstomato GBF, also specifically binds Arabidopsis factor (Fig.1C, lanes 1 and 2). Two retarded bands are seen in this case.The same tomato and pea RBCS promoter fragments thatinterfere with binding ofthe tomato factor also inhibit bindingof the Arabidopsis factor (lanes 3 and 4).TheG Box Is the GBF Binding Sequence. These data suggest

that a sequence present in various RBCS genes mediates theinteractions seen in both tomato and Arabidopsis extracts.Sequence comparison of the tomato RbcS-3A and RbcS-1upstream regions shows three regions of strong homology,named the L, I, and G boxes (Fig. 2), contained within thefragment showing affinity for GBF. These homologies arehighly significant, since these two genes diverged a long timeago (3) and do not share, in their upstream sequences,extensive regions of homology. All three boxes are found intobacco (24) (Nicotiana tabacum) and Nicotiana plumbagi-nifolia (25) RBCS upstream sequences (Fig. 2), while soy-bean upstream sequences lack a bona fide L box sequence(26). The most conserved of these three elements is the Gbox, which is present in 14 different RBCS genes from sevendifferent dicotyledonous plants (Fig. 2). The G box containsa prominent structure with dyad symmetry and, centered afew bases downstream, an inverted repeat (Fig. 2).Tom, RbcS-3A GAAATTAACCAACCATTTTCACTCATCCTTA*************CCTom.RbcS-1 A----- - A--GCA-TA---CA-A-T*************-AToh. Ntss-23 A-----I L---TCAA----A---T-A--TCCTCTTCCTAC*--plumbRbcS-8B A------ ----TCAA---TA---T-A--TCCTCTTCCTACC--Soyb. SRS-1 A-T-A-A--A--TTCCACCAC-ATCA-ACATTTTACGT******T-Soyb. SRS-4 A-T-A-A--A---TCCACCAC-ATCA-ACATTTTACGT******T-

.*-4-4CTTTTAGGATGAGATAAGACTATTC*TCATTCTGACACGTGGCACCCTTT -278TA-C-T ----- ---T-CAC-*AT-- ----- ---T-CA -534

-A-C-------I ---T--C-***AGGG---T----- ---TCCA -275-A-C------- --- T--C-GAGGTGCT-T ---- --- TCCA -287T-CCA----A- ---TA--GGAG****T-TC------T----TCCA -240T-CCA----A---------TA--GAAG*CC--CTC----------TTCCA -240

Petunia SSU-301Petunia SSU-611Pea RbcS-3.6Pea RbcS-8.0Pea RbcS-E9Pea RbcS-3APea RbcS-3CArabidopsis RbcS-1A

24mer (pG4) a12mer (pGl)lOmer (pMT02)

AAG-G--TC-----------TCCA -269AGC-A----------T----TCCA -185GGCA---T----------TTA-CC -217GGCA---T----------TTA-CC -227GGCA---T----------TTA--A -232GGTAATATC---A------TG-CC -217GTCA--ATC----------T--CA -172ATTA---TC---------TTA-C- -243

Ref:

(24)(25)(26)(26)

(1)(1)

(20)(20)(6)(2)(2)

(21)

aagctTCATTCTGACACGTGGCACCCTTTaagcttaagctTGACACGTGGCAagcttaagctTGACACGTGGaagctt

FIG. 2. Conserved regions in RBCS upstream sequences. The sixsequences on top (continued in the second row) show the L, I, andG boxes in three different solanaceous (tomato, tobacco, and N.plumbaginifolia) and one leguminous (soybean) species. Below, theG box sequences from three more dicotyledonous species, repre-senting the Solanaceae (Petunia), Leguminosae (pea), and Brassi-caceae (Arabidopsis) families, are shown. Dashes indicate nucleotideidentity with the tomato RbcS-3A sequence. Asterisks indicatespaces introduced to maximize homology. Thin and thick arrowshighlight, respectively, the extent ofthe dyad symmetry and invertedrepeat in the tomato RbcS-3A G box. The distance of the lastnucleotide from the start codon is given on the first column on theright. (Bottom) Sequences of the G box oligonucleotides used incompetition experiments (Fig. 4) are shown. Lowercase charactersindicate the flanking HindIII sequences used in the cloning.

Proc. Natl. Acad Sci. USA 85 (1988)

Dow

nloa

ded

by g

uest

on

May

27,

202

1

Proc. Natl. Acad. Sci. USA 85 (1988) 7091

The GBF binding sequence was mapped by DNase Ifootprinting. A 21-base and a 22-base footprint are seen,respectively, on the coding and noncoding strands of thebound tomato probe, both centered roughly on the G box(Fig. 3A, lanes B and B'). Two DNase-hypersensitive sitesare also seen on the noncoding strand of the bound probe(indicated by dots beside lane B'). One site is located at the3' border of the footprint and one is further upstream in theI box. With the Arabidopsis nuclear extract, a footprint was

A

also evident in the G box of Arabidopsis RbcS-IA (Fig. 3C).This footprint was given by the fastest-migrating complexshown in Fig. 1C. The footprint of the slowest complex wascomparable (data not shown). No other significant protectedregions were seen, in several experiments, for either thetomato or the Arabidopsis probes.Both the size of the footprint and the hypersensitive site in

the tomato I box leave open the possibility that sequencesflanking the G box also mediate the DNA-GBF interaction.

BF' B' r Tn X)

_~l E4'C.."... * Q

_ a

-ft u 19

II.5

E mjx+ ir-tiT'2~~1S

G' F' B' F

'llI

.0

FBF

6 0

* 3e2V-

. I

1;2t T

w

gag

D

en¢ FBFG

II

¢4:

HF'

Et£E-

U-,

U,

00

X FCC)

u-I i.,0CFF'

H C.

H

n u

H E"

90X U

X4 6

7

L

GFB F

'I!!If

* 9 0

4 & Zo.a -

0 !

at

o4*-

* a

_. _

is;;U)

FBFG F'

---F

E4:0

'Ci~~~~~~~t~~-

!!! > flv0h)

I'll<* X ! g |H~F

_ w" rb3~4*** w J <:XF

w * bV3~~F.. 0

F'

Wit Vg0SLEn

FIG. 3. DNase I footprinting ofGBF on G box sequences. (A) DNase I footprints obtained on the coding and noncoding strands of the tomatoRbcS-3A probe (lanes B and B', respectively) run alongside the free probe (lanes F and F') for comparison. The borders of the footprints andthe DNase-hypersensitive sites are aligned to the sequence (center) by lines. The G reaction of Maxam and Gilbert (30) is shown in lanes G andG'. On the sequence, vertical bars show the extent of the I and G boxes. Thick arrows on the two sides point the direction in which the gelswere run. (B) DNase I footprint of tomato GBF on an artificial probe containing the G box 12-mer flanked by pUC9 sequences (see also Fig.4B). (C) DNase I footprint of Arabidopsis GBF on the noncoding strand of the Arabidopsis RbcS-IA probe. (D) DNase I footprint of tomatoGBF on the coding strand of the pea RbcS-3.6 probe. The gel on the left was run to the bromophenol blue marker to show boxes I, II, and III(13) (highlighted by vertical bars). The gel on the right was run to the xylene cyanol marker to show the G box and box II*.

*Go

at

A

t

Biochemistry: Giuliano et al.

Dow

nloa

ded

by g

uest

on

May

27,

202

1

7092 Biochemistry: Giuliano et al.

To address this question, a series of chemically synthesizedoligonucleotides, containing G box sequences of differentlength (Fig. 2 Bottom), were cloned in single copy into pUCplasmid vectors and used in competition assays with thetomato GBF. A lO-mer shows weak competition (Fig. 4A,lane 2), while a 12-mer and a 24-mer are efficient competitors(lanes 3 and .4). It is interesting to note that because of theHindIll site used in the cloning process, the 10-mer can alsobe regarded as a 12-mer carrying a C to A transversion closeto its 3' end (Fig. 2 Bottom). Therefore, this single mutationis sufficient to severely impair GBF binding. Experimentsconducted with decreasing doses of competitor indicate thatthe 12-mer competes as efficiently as the whole'RbcS-3Aupstream region (data not shown).The sequence information contained in the 12-mer was also

shown to be sufficient for in vitro stable complex formation.Both the tomato and the Arabidopsis extracts were able tobind an artificial probe composed of pUC9 sequences con-taining the 12-mer (Fig. 4B). The footprint obtained on thisprobe (Fig. 3B, lane B) was very similar to that obtained onthe RbcS-3A probe (Fig. 3A, lane B). In both cases, thefootprints extended into sequences flanking the G box. Sincethe flanking sequences are unrelated in the two instances, itis unlikely that flanking sequences play a role in GBF binding.This idea is further supported by the fact that both tomato andArabidopsis extracts were iable to bind heterologous RBCSupstream sequences containing little sequence homologyoutside the G box (Fig. 4C). The Arabidopsis extract gave

A Tomato B Tomato Arabid.a b a b

- + - +- +4 +

1 2 34 1 23 45 67 8

'mm

Bo =

-__

c Tomato- - Arabidopsis-c d e f c d e f-+ + -+ + -+ +- -

1 23 4 5 6 78 9 10111213141516

0

ALeaves Stems Roots-+2 + 5+1 2 3 4 56

BL D LD

-+21 2 34

FIG. 5. Organ specificity and light regulation of GBF in nuclearextracts from mature tomato plants. All extracts were diluted to 2 mgof protein per ml before the assay. Assay conditions were as in Fig.1B. (A) GBF activity in extracts from different organs of mature (2months old) tomato plants. Lanes - contain pUC9; lanes + containpG1 as competitor. (B) GBF activity in leaf extracts from light-grownplants (L) (lanes 1 and 3) or plants transferred to the dark (D) for 3days (lanes 2 and 4). Lanes - contain pUC9; lanes + contain pG1as competitor.

two retarded complexes with all of the probes, and bothcomplexes were efficiently competed for by the G box12-mer.The strong heterologous interaction of the tomato extract

with the pea RbcS-3.6 upstream sequences allowed us toobtain a footprint (Fig. 3D). As can be seen, the onlysignificant protected region in this experiment is a 20-baseregion centered on the pea G box, and no protection was seenon the boxes I, II, and III described by Green et al. (13). Thisfurther confirms that GBF and GT-1 have distinct sequencespecificities.GBF Is Absent in Root Extracts but Present in Extracts from

Dark-Adapted Plants. As mentioned previously, RBCS genetranscription is shut off in roots and in dark-adapted plants.To assess whether GBF levels correlate with the levels oftranscription, extracts prepared from leaves, stems, androots of mature tomato plants were diluted to the sameprotein concentration and used in binding assays. The results(Fig. 5A) show that leaves and stems contain GBF activity(the specific activity in stem extracts is about half the activityfound in leaf extracts), while GBF activity is greatly reduced,or absent, in root extracts.GBF activity is consistently found in leaf extracts prepared

from light grown plants subjected to 3 days of darkness (Fig.5B), a condition that greatly reduces RBCS gene transcription(27). The dark GBF-DNA complex is mediated by G boxsequences since it is inhibited by the G box 12-mer. Thiscomplex appears to differ from that formed in the normalextracts prepared from plants that are not dark adapted as theformer complex consistently runs faster on retardation gels(Fig. SB) and is more unstable in the presence of low levelsof heparin (data not shown).

FIG. 4. Oligonucleotide competition and heterologous binding ofGBF. Reactions are as in Fig. 1B. Extent of the oligonucleotides isshown in Fig. 2 (Bottom). (A) Oligonucleotide competition of tomatoGBF binding to the RbcS-3A probe. Lanes 1-4 contain pUC9,pMT02 (10-mer), pG1 (12-mer), and pG4 (24-mer), respectively. (B)GBF binding to artificial G box probes. Lanes 1-4, tomato extract;lanes 5-8, Arabidopsis extract. Probes: a, 200-base-pair EcoRI/Pvu II probe from pUC9; b, same fragment fromn pG1 (containing the6 box 12-mer). Lanes - contain pUC9; lanes + contain pG1 12-meras competitor. (C) Heterologous binding ofGBF and'oligonucleotidecompetition. Lanes 1-8, tomato extract; lanes 9-16, Arabidopsisextract. Probes: c, tomato RbcS-3A; d, tomato RbcS-J, -697 to-493; e, Arabidopsis RbcS-IA; f, pea RbcS-3.6, -320 to -120(containing 50 base pairs of flanking pUC sequences). Lanes -contain pUC9; lanes + contain pG1 as competitor.

DISCUSSIONFrom the data presented, it can be concluded that the G boxis the sequence within RBCS upstream promoter sequencesthat binds a protein factor from plant nuclear extracts, whichwe call GBF (or G box binding factor). The occurrence of theG box sequence and GBF in distantly related plants indicatesthat this is an evolutionarily conserved form of DNA-proteininteraction. The observation that an Arabidopsis nuclearextract is able to recognize tomato RBCS upstream se-quences and vice versa is in keeping with the accurateexpression observed when RBCS promoters are introducedinto heterologous plant species (6-10).

Proc. Natl. Acad. Sci. USA 85 (1988)

Dow

nloa

ded

by g

uest

on

May

27,

202

1

Proc. Natl. Acad. Sci. USA 85 (1988) 7093

In our extracts, we were not able to detect an activitycorresponding to the pea GT-1 factor (13). This might be dueto technical differences in extract preparation and/or bindingconditions. Alternative explanations for the apparent ab-sence ofthe GT-1 factor in our extracts would include speciesdifference and contrasting developmental periods at whichthe extracts were prepared. The fact that the sequencenecessary and sufficient for GBF binding (Fig. 4) is distinctfrom the GT motif (28) reported to be the GT-1 bindingsequence suggests that GBF and GT-1 are functionally dis-tinct activities, a fact confirmed by the heterologous foot-printing experiment shown in Fig. 3D. In the pea RBCSpromoters, the G box is located just downstream from one ofthe GT motifs, box II*, suggesting that physical interactionbetween GBF and GT-1 may play a role in RBCS promoterfunction. In the tomato RbcS-3A promoter, a near-perfect boxIII homology (CA'1Tl71CACT) is found just downstream ofthe L box (Fig. 2).

Extracts from dark-adapted leaves, in which RBCS genetranscription is shut off, contained high levels of a factorbinding to the G box but giving a slightly faster migration ona retardation gel. We do not know at the present time whetherthe two factors are distinct protein species. These resultswere reproducible in three independent experiments. Al-though they protect the same nucleotides from DNase Idigestion, slight but significant differences can be observed infootprints from the two factors (unpublished data). It ispossible that the factor present in dark-adapted leaves is amodified form of GBF. High levels of GBF activity werefound only in extracts from organs (leaves, stems) whereRBCS genes are transcribed, whereas low (sometimes unde-tectable) activity was found in root extracts. This result iscompatible with a positive regulatory role of GBF andsuggests a possible molecular basis for the organ-specificexpression of RBCS genes. In soybean, a factor binding tothe lectin gene promoter has also been shown to be abundantonly in embryos, where the lectin gene is maximally ex-pressed (29). Of course, the possibility remains open thatsome of the differences we see are artifacts occurring duringextract preparation. A careful analysis of the in vivo bindingproperties of GBF is necessary to confirm our in vitro data.The question concerning the precise function of the G box

and of GBF in RBCS gene regulation remains open andawaits two types of experiments: the demonstration of acis-acting regulatory function for the G box sequence and thestudy of the in vivo binding behavior of GBF in response tolight- and tissue-specific factors.

We thank Neil Hoffman and Dudy Bar-Zvi for useful discussionsand Takashi Ueda and Robert Donald for plasmids. This work wassupported by National Institutes of Health Grant GM-38409 toA.R.C. E.P. and G.G. were supported by National Institutes ofHealth and DuPont postdoctoral fellowships, respectively.

1. Dean, C., van der Elzen, P., Tamaki, S., Dunsmuir, P. &Bedbrook, J. (1985) EMBO J. 4, 3055-3061.

2. Fluhr, R., Moses, P., Morelli, G., Coruzzi, G. & Chua, N.-H.(1986) EMBO J. 5, 2063-2071.

3. Pichersky, E., Bernatzky, R., Tanskley, S. D. & Cashmore,

A. R. (1986) Proc. Natl. Acad. Sci. USA 83, 3880-3884.4. Gallagher, T. F. & Ellis, R. J. (1982) EMBO J. 1, 1493-1498.5. Silverthorne, J. & Tobin, E. M. (1984) Proc. Natl. Acad. Sci.

USA 81, 1112-1116.6. Fluhr, R., Kuhlemeier, C., Nagy, F. & Chua, N.-H. (1986)

Science 232, 1106-1112.7. Simpson, J., Van Montagu, M. & Herrera-Estrella, L. (1986)

Science 233, 34-38.8. Morelli, G., Nagy, F., Fraley, R. T., Rogers, S. G. & Chua,

N.-H. (1985) Nature (London) 315, 200-204.9. Timko, M. P., Kausch, A. P., Castresana, C., Fassler, J.,

Herrera-Estrella, L., Van der Broeck, G., Van Montagu, M.,Schell, J. & Cashmore, A. R. (1985) Nature (London) 318, 579-582.

10. Kuhlemeier, C., Fluhr, R., Green, P. J. & Chua, N.-H. (1987)Genes Dev. 1, 247-255.

11. Dynan, W. S. & Tjian, R. (1985) Nature (London) 316, 774-778.

12. Lenardo, M., Pierce, J. & Baltimore, D. (1987) Science 236,1573-1577.

13. Green, P. J., Kay, S. A. & Chua, N.-H. (1987) EMBO J. 6,2543-2549.

14. Singh, H., Sen, R., Baltimore, D. & Sharp, P. (1986) Nature(London) 319, 154-158.

15. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) MolecularCloning:A Laboratory Manual (Cold Spring Harbor Lab., ColdSpring Harbor, NY).

16. Garner, N. M. & Revzin, A. (1981) Nucleic Acids Res. 9, 3047-3060.

17. Fried, M. & Crothers, D. M. (1981) Nucleic Acids Res. 9,6505-6525.

18. Strauss, F. & Varshavsky, A. (1984) Cell 37, 889-901.19. Timko, M. P., Kausch, A. P., Hand, J. M., Herrera-Estrella,

L., Van der Broeck, G., Van Montagu, M. & Cashmore, A. R.(1985) in Molecular Biology of the Photosynthetic Apparatus,eds. Steinback, K.E., Bonitz, S., Arntzen, C. J. & Bogorad, L.(Cold Spring Harbor Lab., Cold Spring Harbor, NY), pp. 381-396.

20. Timko, M. P., Herdies, L., de Almeida, E., Cashmore, A. R.,Leemans, J. & Krebbers, E. (1987) in Impact of Chemistry onBiotechnology, eds. Phillips, M., Shoemaker, S. P., Middle-kauf, R. D. & Ottenbrite, R. M. (Am. Chem. Soc., Washing-ton, DC), pp. 279-295.

21. Pichersky, E., Bernatzky, R., Tanksley, S. D., Breidenbach,W., Kausch, A. P. & Cashmore, A. R. (1985) Gene 40, 247-258.

22. Shah, D. M., Hightower, R. C. & Meagher, R. B. (1982) Proc.Natl. Acad. Sci. USA 79, 1022-1026.

23. Zillig, W., Zechel, K., Rabussay, D., Schachner, M., Sethi,V. S., Palm, P., Heil, A. & Seifert, W. (1970) Cold SpringHarbor Symp. Quant. Biol. 25, 47-58.

24. Mazur, B. J. & Chui, C.-F. (1985) Nucleic Acids Res. 13, 2373-2386.

25. Poulsen, C., Fluhr, R., Kauffman, J. M., Boutry, M. & Chua,N.-H. (1986) Mol. Gen. Genet. 205, 193-200.

26. Grandbastien, M. A., Berry-Lowe, S., Shirley, B. W. &Meagher, R. B. (1986) Plant Mol. Biol. 7, 451-465.

27. Giuliano, G. & Scolnik, P. A. (1988) Plant Physiol. 86, 7-9.28. Kuhlemeier, C., Green, P. J. & Chua, N.-H. (1987) Annu. Rev.

Plant Physiol. 38, 221-257.29. Jofuku, K. D., Okamuro, J. K. & Goldberg, R. B. (1987)

Nature (London) 328, 734-737.30. Maxam, A. M. & Gilbert, W. (1980) Methods Enzymol 65,

499-560.

Biochemistry: Giuliano et al.

Dow

nloa

ded

by g

uest

on

May

27,

202

1