doi:10.1016/j.jmb.2007.05.017 J. Mol. Biol. (2007) 371, 112–122

An Improved System for the Generation and Analysisof Mutant Proteins Containing Unnatural AminoAcids in Saccharomyces cerevisiae

Shawn Chen1, Peter G. Schultz1,2⁎ and Ansgar Brock2⁎

1Department of Chemistryand the Skaggs Institute forChemical Biology, The ScrippsResearch Institute, 10550 NorthTorrey Pines Road, La Jolla,CA 92037, USA2Genomics Institute of theNovartis Research Foundation,10675 John Jay Hopkins Drive,San Diego, CA 92121, USA

Present address: S. Chen, DepartmSciences, Ohio University, Athens, OAbbreviations used: wt, wild-type

superoxide dismutase with a six-hisaminoacyl-tRNA synthetase; pPpa,p-propargyloxyphenylalanine; pMpp-methoxyphenylalanine; pAzpa,p-azidophenylalanine; pApa, p-acetypBpa, p-benzoylphenylalanine; MRMmonitoring; ESI, electrospray ionizatime-of-flight; MALDI, matrix-assistionization; LC, liquid chromatograpspectrometry.E-mail addresses of the correspon

schultz@scripps.edu; abrock@gnf.or

0022-2836/$ - see front matter © 2007 E

We have previously described methodology that makes it possible togenetically encode a wide array of unnatural amino acids in both prokar-yotic and eukaryotic organisms. Here, we report the systematic optimiza-tion of a Saccharomyces cerevisiae expression system for the production ofmutant proteins containing unnatural amino acids. Modifications includesignificant increases in both the expression levels of the orthogonalEscherichia coli amber suppressor tRNACUA and cognate aminoacyl-tRNAsynthetase (aaRS) pair, and expression of the target protein gene using astrong transcriptional promoter, optimized codons and elevated plasmidcopy numbers. With this new system, a number of unnatural amino acids,including the photocrosslinkers p-benzoylphenylalanine and p-azidophe-nylalanine, and the chemically reactive amino acids, p-acetylphenylalanineand p-propargyloxyphenylalanine, were incorporated into human super-oxide dismutase (hSOD) in yeast in good yields (maximally ∼6–8 mg/l ofculture in most cases). Mass spectrometric analysis of the hSOD mutantswas performed with high dynamic range using multiple reaction monitor-ing that provided new insights into the factors that control the fidelity ofunnatural amino acid incorporation.

© 2007 Elsevier Ltd. All rights reserved.

Keywords: unnatural amino acids; protein expression; orthogonal tRNA/aminoacyl-tRNA synthetase; S. cerevisiae; multiple reaction monitoring

*Corresponding authors

Introduction

To date, more than 30 unnatural amino acids withnovel chemical and biological properties have been

ent of BiologicalH 45701, USA.; hSOD-His6, humantidine tag; aaRS,

a,

lphenylalanine;, multiple-reaction

tion; TOF,ed laser desorption/hy; MS, mass

ding authors:g

lsevier Ltd. All rights reserve

genetically encoded in Escherichia coli, Saccharomycescerevisae (yeast) and mammalian cells.1,2 Theseinclude metal-binding, photo-reactive, chemicallyreactive and fluorescent amino acids. This metho-dology makes use of a unique codon (either anonsense or frameshift codon), an engineeredsuppressor tRNA recognizing this codon, and itscognate aminoacyl-tRNA synthetase (aaRS). Neitherthe tRNA nor the aaRS cross-react with endogenoustRNAs or tRNA-synthetases in the host cell, i.e., theyare orthogonal. The specificity of the aaRS is thenevolved to uniquely aminoacylate the tRNA withthe unnatural amino acid of interest by means ofpositive and negative genetic selections using alibrary of aaRS active site mutants. OrthogonaltRNA/aaRS pairs derived from E. coli tyrosyl-tRNACUA/TyrRS and leucyl-tRNACUA/LeuRSpairs have been engineered to genetically encode awide variety of unnatural amino acids in yeast withhigh translational fidelities and good efficiencies.3,4

Here, we report the systematic optimization of theyields of mutant proteins that can be produced

d.

113Mutant Proteins Containing Unnatural Amino Acids

using engineered tyrosyl-tRNACUA/TyrRS pairs inthis system, resulting in N40-fold increase in expres-sion levels. In addition, we demonstrate the advan-tages of multiple reaction monitoring over othermass spectrometric techniques for the characteriza-tion of the translational fidelity of unnatural aminoacid incorporation.

Results and Discussion

Expression of the target gene in S. cerevisiae

First, we determined whether an increase in theyield of wild-type (wt) protein leads to a corre-sponding increase in the yield of the mutant proteincontaining an unnatural amino acid. The previouslyreported model gene was used,3,4 in which the firstten residues of human superoxide dismutase(hSOD) (GenBank accession number EF620776) arecodon-optimized for expression in yeast, and a His6tag is fused to the C terminus of the full-lengthprotein to facilitate purification and detection. In themodified system, gene expression is driven by astrong constitutive pTDH3 yeast promoter andterminated by the TDH3 terminator. The gene isencoded on a pC1 plasmid that has a 2μ origin and adefective LEU2 (leu2-d) marker.5 Deletion of theregulatory sequences at the 5′ end of this markergene causes a very low level of expression of theLEU2 gene (less than 5%),6 and as a result theplasmid must be maintained at high copy number inthe host strain SCY4.6 Host strain SCY4 (MATa, ade2-101, ura3-1, leu2-3, 112trp1, his3-11, CYB∷kan [cir0])is derived from strain MJY125, which is devoid ofthe naturally endogenous 2μ plasmid.5,7

To test this expression system, the amber nonsensecodon TAG was substituted for the Trp33 codon inthe hSOD gene in plasmid pC1hSOD (Figure 1(a)) toafford plasmid pC1hSODW33. Trp33 lies on theoutside of a β-barrel, exposed on the surface of thehSOD dimer.8 Mutation of this residue to otheraromatic amino acids is therefore not expected toperturb protein stability or folding significantly.Suppression of the TAG33 codon with an orthogonalE. coli tRNACUA/aaRS pair specific for the acetylenicamino acid p-propargyloxyphenylalanine (pPpa) (1,Figure 1(b)) afforded ∼1 mg/l of hSOD in thepresence of 1 mM racemic pPpa in –Leu/-Trpsynthetic medium. However, this expression levelis variable, ranging from b1–3 mg/l, depending onfermentation conditions. In comparison, wt hSOD isexpressed at ∼12–16 mg/l in the same system.

Optimized expression of the E. coli tyrosyltRNACUA gene in yeast

Although the previously described plasmidpTyrRS-tRNACUA encoding the orthogonal E. colityrosyl tRNACUA/aminoacyl-tRNA synthetase pair(EctRNACUA/aaRS) has a high copy replicativeorigin (2 μ),3 expression of the suppressor tRNA is

likely driven by a cryptic promoter on the plasmidor in the gene. This basal level of EctRNACUAexpression sustains cell growth and allows geneticselection of an active aaRS, but may be insufficientfor overproduction of mutant proteins.The gene encoding Bacillus stearothermophilus

tyrosyl-tRNA (BsttRNATyr) has internal sequencessimilar to the A and B boxes required for transcrip-tion of a tRNA gene by Pol III polymerase inyeast.9,10 BsttRNATyr is also a substrate for E. coliTyrRS, and the BsttRNATyr and E. coli tyrosyl tRNAsynthetase pair have been shown to be orthogonal inhigher organisms.9 Therefore, an amber suppressorBsttRNACUA gene was constructed to replace theEctRNACUA sequence in the previous plasmids.Expression of BsttRNACUA is driven by a Pol III-type promoter. Unfortunately, this construct did notincrease the yield of mutant hSOD significantly.Since the EctRNACUA gene has an intact B box, we

next attempted to modify the flanking sequences toincrease tRNA gene expression without compromis-ing TyrRS activity. The yeast suppressor tRNA geneSUP4 has a well-characterized Pol III promoter thatconsists of internal A and B boxes and flankingregions.11,12 A chimera gene SUP4-tRNACUA wastherefore generated, in which EctRNACUA (withoutthe CCA trinucleotide at its 3′ terminus) wasinserted between the ∼55 bp upstream (5′) and∼30 bp downstream (3′) flanking sequences of theoriginal SUP4 gene. This new tRNA expressionconstruct was then substituted for the EctRNACUAsequence in a previously described plasmid (pPR1-tRNACUA),

13 which has a pPpa-specific aaRS (PR1).To increase gene dosage, up to six copies of thetRNA gene were inserted into the plasmid in thesame direction (pPR1-6SUP4-tRNACUA representsthe construct that has six copies of the SUP4-tRNACUA). For comparison, another strong Pol IIpromoter, pPGK1, normally used for mRNA tran-scription, was cloned at the beginning of the tRNAregion in plasmids that have either the originalversion of the EctRNACUA gene or the newly createdSUP4-tRNACUA construct (e.g. plasmid pPR1-PGK1+3SUP4-tRNACUA, Figure 1(a)) (see Materialsand Methods for details.)The modified plasmids were introduced sepa-

rately into yeast strain SCY4 containing plasmidpC1hSODW33. Northern blot analysis was used todetermine EctRNACUA expression levels in cellsthat were cultured under the same conditions.Plasmid pPR1-3SUP4-tRNACUA afforded 30-foldmore EctRNACUA than the original plasmid pPR1-tRNACUA (Figure 2(a), lanes 8 and 7); six copies ofthe SUP4-tRNACUA gene (pPR1-6SUP4-tRNACUA)further increased tRNA expression levels (Figure2(a), lanes 4 and 8). The SUP4 gene flankingsequences are required for EctRNACUA over-expres-sion, since six copies of the EctRNACUA sequence inplasmid pPR1-6tRNACUA (without the SUP4 flank-ing sequences) did not lead to significant tRNAexpression levels (Figure 2(a), lanes 3 and 7). Use ofthe Pol II promoter pPGK1 in pPR1-PGK1+3SUP4-tRNACUA resulted in an additional two- to threefold

Figure 1. Plasmids for protein expression in yeast and the structures of unnatural amino acids. (a) Plasmid pPR1-PGK1+3SUP4-tRNACUA encodes the orthogonal E. coli tRNACUA and the p-propargyloxyphenylalanine-specific tRNAsynthetase PR1; plasmid pC1 encodes hSOD. (b) Structures of p-propargyloxyphenylalanine (pPpa) 1, p-methoxyphe-nylalanine (pMpa) 2, p-azidophenylalanine (pAzpa) 3, p-acetylphenylalanine (pApa) 4 and p-benzoylphenylalanine(pBpa) 5.

114 Mutant Proteins Containing Unnatural Amino Acids

increase in tRNAexpression relative to pPR1-3SUP4-tRNACUA (Figure 2(a), lanes 6 and 8): the plasmidpPR1-PGK1+3SUP4-tRNACUA gave an overall N50-fold increase in tRNA levels compared to the originalconstruct pPR1-tRNACUA (Figure 2(a), lanes 6 and7). Regardless of which promoter was used toexpress the tRNA, the final transcripts appeared tobe processed to the expected size. No intermediate,pre-tRNA or shorter tRNA (possibly without theCCA acceptor stem) transcripts were detected.Western blot analysis was used to determine the

expression levels of the hSOD-His6 Trp33 to pPpamutant (with over-expression of hSOD (SCY4/pC1-hSODW33) and the new pPR1 plasmids). Cellswere grown under the same conditions and lysatefrom the same volume of cells was analyzed (Figure2(b)). Plasmid pPR1-3SUP4-tRNACUA afforded anapproximate threefold increase in the yield ofmutant protein, and plasmid pPR1-PGK1+3SUP4-

tRNACUA increased the yield seven- to eightfoldover the original plasmid pPR1-tRNACUA (Figure2(b), lanes 2–4). Six copies of SUP4-tRNACUA geneson one plasmid pPR1-6SUP4-tRNACUA slowed cellgrowth and resulted in a lower yield of totalproteins and the mutant protein (Figure 2(b), lane1). Therefore, the construct PGK1+3SUP4-tRNACUAappears to be optimal for expression of mutantproteins.

Optimized expression of the E. coliaminoacyl-tRNA synthetase gene in yeast

We examined the effects of different promoters onaaRS gene expression levels. The aaRS gene wasexpressed originally behind the strong pADH1promoter. Seven promoters for mRNAs that arehighly expressed in yeast were examined: RPP15,ENO2, FBA1, RPP2B, TDH3, RPS2 and RPL5.14 The

Figure 2. Optimization of E. coli tRNACUA expression levels. (a) Modification of the tRNA gene region in plasmidpPR1. Plasmids pPR1-6SUP4-tRNACUA, pPR1-PGK1+3SUP4-tRNACUA and pPR1-3SUP4-tRNACUA (lanes 4, 6, and 8)contain six or three copies of the chimera gene SUP4-tRNACUA. pPR1-PGK1+3SUP4-tRNACUA (lane 6) has an additionalPol II promoter pPGK1. In a comparable series of plasmids (lanes 3, 5, and 7), the SUP4-tRNACUA genes were replacedwith the original version of the E. coli tRNACUA sequence.3 These six plasmids were transformed into yeast strain SCY4/pC1hSODW33. Total RNA was isolated from cells cultured under identical conditions. RNAs from yeast without anyplasmid (lane 1) and E. coli (lane 2) were the positive and negative controls for the Northern blots, respectively. Total RNA(8 μg) from each strain was separated on a TBE-Urea (8M)/10% polyacrylamide gel. The naturally abundant RNAs (100–200 nt 5.8 S, 5 S rRNAs) showed approximately the same intensities in the lanes, indicating similar amounts of total RNAin each lane. The RNAs were transferred onto a nylon membrane and then blotted with 32P -labeled antisenseoligonucleotides (see Materials and Methods). (b) Expression levels of the W33 to p-propargyloxyphenylalanine hSOD-His6 proteins were detected by Western blot. The protein lysates were produced from SCY4/pC1hSODW33 cellstransformed with the pPR1-derived plasmids, which have different tRNA gene constructs as indicated. The plasmidnames are explained in (a). Equal amounts of the cells were inoculated into –Trp/–Leu medium and incubated for ∼48 hat 30 °C with shaking. The cells were collected and lysed. The same volume of the lysates was loaded onto two separategels. After SDS-PAGE under identical conditions, one gel was used for the Western blot to detect hSODW33pPpa-His6(upper panel). The other gel was stained to show the total protein loaded. The smaller amount of total protein in lane 1resulted from the slow growth of the cells transformed with the 6SUP4-tRNACUA construct.

115Mutant Proteins Containing Unnatural Amino Acids

promoters and 5′ untranslated regions were PCR-amplified from yeast genomic DNA and insertedin front of the PR1 gene in plasmid pPR1-PGK1+3SUP4-tRNACUA to replace the pADH1 promoter(Figure 3). The resulting plasmids were transformedinto yeast strain SCY4/pC1hSODW33. mRNAlevels for aaRSs were analyzed by Northern blotand hSOD-His6 levels were analyzed by Westernblot (Figure 3). Promoter pTDH3 afforded thehighest level of aaRS mRNA, ∼1.3-fold higher thanpADH1, after normalization against rRNA expres-sion levels. However, the expression level of thehSOD-His6 mutant protein with pTDH3 was com-parable to that with the pADH1 promoter (Figure 3).Since the hSOD-His6 gene is expressed under apTDH3 promoter, pADH1was used to express aaRSsin all further experiments.There are significant differences in the GC content

of E. coli and yeast genes (∼50.73% versus ∼38.15%,respectively, at the genome scale), which may affect

expression of bacterial genes in yeast. The PR1 aaRSgene was therefore codon-optimized for expressionin yeast. Out of 424 amino acid residues in the PR1aaRS, 91 were codon-optimized and cloned in theplasmids pPR1opt (Genbank accession numberEF620776) (see codon preference table15). Theoptimized and native aaRSs were then His6-taggedat their C termini. Western blot analysis indicatedthat expression of the aaRS from plasmid pPR1optwas only slightly higher than that of the native aaRS.Importantly, the expression levels of the pPpamutant hSOD in strains carrying pPR1opt or pPR1were also similar. Approximately 50% of thetRNAs expressed from the pPR1opt-PGK1+3SUP4-tRNACUA in vivowere aminoacylated in the presenceof 1mMpPpa (1) inmedium, as determined by acidic(pH 6.0) urea-PAGE, which can separate the chargedand uncharged tRNA species.16 Thus, codon optimi-zation of the aaRS gene does not afford significantincreases in yields of the mutant protein.

Figure 3. Optimization of E. coli aaRS expressionlevels. Eight yeast promoters (pRPP15, pENO2, pFBA1,pRPP2B, pTDH3, pRPS2, pRPL5, and pADH1) were testedfor the expression of the p-propargyloxyphenylalanine-specific E. coli aaRS. Northern blots were used to detect theexpression levels of the aaRS with these promoters.Similar amounts of total RNA were loaded onto eachlane, as indicated by the intensity of rRNAs. Westernanalysis was used to determine the expression levels of theW33 to p-propargyloxyphenylalanine hSOD-His6 proteinin cells (SCY4/pC1hSODW33) transformed with pPR1-PGK1+3SUP4-tRNACUA-derived plasmids.

116 Mutant Proteins Containing Unnatural Amino Acids

Fidelity and generality of the improved system

The optimized tRNA/aaRS system was used toincorporate pPpa separately at three different posi-tions (Q16, N27, andW33) in hSOD-His6 using strainSCY4 and the pC1hSOD derived plasmids (themutant proteins are termed hSODQ16pPpa-His6,etc.) Cells were cultured in -Leu/-Trp syntheticmedium in shaker flasks to saturation (A600=∼2.5–2.7; ∼48 h). Protein was purified by Ni-NTA affinitychromatography and quantified following standardprotocols. The yields of the threemutant His6-taggedproteins ranged from 3–10 mg/l; the amount ofhSODQ16pPpa-His6 produced is about half of that ofhSODW33pPpa-His6 under the same conditions.This variation may be due to mRNA context effectson suppression efficiency, differential stabilities ofthe mutant proteins, the precise copy numbers of thepC1hSOD plasmids, or other unknown factors.Electrospray ionization (ESI) time-of-flight (TOF)mass spectrometric analysis confirmed that themolecular mass of the mutant protein in eachpreparation was within 1 Da of the expected mass(based on N-terminal methionine cleavage, N-term-inal acetylation, and a known disulfide bondbetween C57 and C14617): hSODQ16pPpa-His6 hasa major peak at 16,739.6 Da (expected 16,740.4 Da);hSODN27pPpa-His6 has a major peak at 16,753.6 Da(expected 16,754.4 Da); and hSODW33pPpa-His6 hasa major peak at 16,682.8 Da (expected 16,682.3 Da).

The generality of this expression system wasexamined for other unnatural amino acids andtheir corresponding tRNA/aaRS pairs. Four addi-tional E. coli tyrosyl-tRNA/aaRS derived pairsselective for p-methoxyphenylalanine (pMpa) (2),p-azidophenylalanine (pAzpa) (3), p-acetylphenyla-lanine (pApa) (4), and p-benzoylphenylalanine(pBpa) (5) (Figure 1(b)) were assayed.3,13 The aaRSgenes were cloned separately into the plasmidpPR1-PGK1+3SUP4-tRNACUA to replace the PR1.The resulting plasmids were transformed intoSCY4/pC1 SODW33 or SCY4/pC1 SODQ16, andthe transformed cells were grown in the presence ofthe corresponding unnatural amino acids at a finalconcentration of 1 mM (except soluble pBpa, seeMaterials and Methods.) The yields of thehSODW33-His6 mutant proteins were 5–10 mg/l ofculture (except hSODW33pApa-His6); the yields ofthe hSODQ16-His6 mutant proteins were 2–6 mg/lof culture (except hSODQ16pApa-His6). The yieldsof the pApa incorporated hSOD-His6 proteins were1mg/l of culture or less, which likely reflects a lowerspecific activity of the pApa aaRS.The purified, mutant proteins were analyzed by

ESI-TOFMS. The major products are hSOD-His6proteins whose masses match those of the expectedmutant proteins. However, in many cases, minorpeaks were observed that could be assigned tohSOD-His6 mutant proteins with Trp and Leu (orIle) incorporated at the designated positions, orpossibly other post-translationally modified formsof this protein (Supplementary Data Figure 1).Other minor components may stay undetectedbecause of the limited dynamic range and/orresolution of ESI-TOFMS method (and matrix-assisted laser desorption/ionization (MALDI-TOF)MS as in previous reports) at the intact proteinlevel. Dynamic range is limited mostly as a resultof non-specific background, which is often verypronounced in MALDI-TOFMS spectra and seen toa lesser extent in ESI-TOFMS spectra. Post acquisi-tion processing (charge deconvolution) performedon ESIMS spectra also introduces additional artifactsinto the baseline that often prevent the detection ofminor components. Supplementary Data Figure 1shows the best case scenario of a very high signal-to-noise spectrum of the hSODW33pPpa-His6 mutant.The major proteins present, hSODW33pPpa-His6at 16682.4 Da (expected 16682.3 Da), hSODW33Trp-His6 16666.2 Da (expected 16667.3 Da), andhSODW33Leu/Ile-His6 16594.6 Da (expected16594.3 Da), are assignable on the basis of theexpected masses (even though the mass error forhSODW33Trp-His6 is unusually large in comparisonto that of hSODW33pPpa-His6 and hSODW33Leu/Ile-His6), and the fact that they are observed withreasonable intensity in a region with low interfer-ence. The inset shows an expanded region witharrows indicating the expected location for themutants hSODW33Gln-His6 (expected 16594.3 Da)and hSODW33Tyr-His6 (expected 16644.3 Da) (laterdetected by multiple-reaction monitoring (MRM)).Neither mutant can be assigned with any confidence

117Mutant Proteins Containing Unnatural Amino Acids

due to the large mass error of the observed signal at16610.6 Da (potentially hSODW33Gln-His6) and theinterference around the expected mass for thehSODW33Tyr-His6 mutant. Based on a typicallyobserved background level of a few percent,confident detection/identification and quantifica-tion of mutants will be limited to the same level(under ideal conditions). In an effort to maximizedynamic range and obtain high confidence in theidentification of mutant proteins, we decided toanalyze the mutant proteins by examining thedigested peptides containing the unnatural aminoacids, which can afford higher sensitivity andspecificity when appropriate methods like MRMare applied.

Analysis of the mutant hSOD proteins by MRM

Analysis of peptide digests by standard liquidchromatography (LC) tandem mass spectrometry(MS/MS) methods allows characterization ofmutant proteins with better dynamic range, butonly in those cases where prior knowledge of anexpected mutation exists.18,19 We therefore decidedto perform a detailed study using MRM, whichallows the tracking of large numbers of analytes incomplex mixtures with high sensitivity anddynamic range. Instead of acquiring completemass spectra for the identification and quantificationof analytes, MRM focuses on predefined precursor/fragment ion mass pairs (selected by a first andsecond mass selector stage) to achieve its highdiscrimination power. Because full mass spectra arenot acquired, identification is based on knownstandards, in this case peptides containing all 20common amino acids at the site of mutation (seeMaterials and Methods for details). The data pre-sented in Figure 4 (mutations at W33) and Supple-mentary Data Figure 2 (mutations at Q16) areplotted only for mutant proteins that were detectedin at least three datasets. The repeated detection oflow-abundance species in several datasets providesadditional confidence in the assignments and lowerlimits (dynamic range) of detection for mutantproteins. Common amino acid containing mutantsof the peptide SNGPVKVxGSIKGLTE (x is W33 inwt hSOD) from hSOD were monitored along withthe species containing unnatural amino acids.Endoproteinase V8 was used to digest the W33mutant; the cleavage specificity of V8, c-terminal toE and D, prohibits the assessment of incorporationof E or D at site x of this peptide. Data for a secondset of experiments monitoring the peptide GDGPVx-GIINFEQK (which contains residue 16 of hSOD) isshown in Supplementary Data Figure 2. In this case,digestion with trypsin was used to generate thepeptides, which precludes assessment of K and Rincorporation at site x. The data shown for therelative amounts of the mutants present can beconsidered only semi-quantitative, because theestimates assume uniform ionization efficiency,charge-state distribution, and fragmentation effi-ciency for all the species monitored. However,

experiments performed on the standards, and thecorrelation of the abundances of the most abundantspecies with intact protein data indicates that theseassumptions are mostly valid. Exceptions are thepresence of basic amino acids (H, K, R) at site x;standard peptides containing H, K, or R at site xshow large charge-state shifts and significantlydifferent fragmentation patterns due to the charge-sequestering nature of these amino acids. Thisresults in the substantial underestimation of theabundance of peptides containing basic amino acids.The analysis is mostly unaffected by this becausenothing can be said about the K and R mutants inthe Q16 dataset due to trypsin digestion (see above).Furthermore, R mutants were never detected and aK mutant was detected only once at very low level(0.007%, data not shown) in theW33mutant protein.hSOD proteins containing p-azidophenylalanineshowed various levels of decomposition to p-aminophenylalanine. This produced a species con-taining a basic amino acid at site x, which wasmonitored to obtain more accurate fidelity informa-tion, but on the basis of the above comments it isclear that the total abundance of p-azidophenylala-nine is underestimated by the analysis.A comparison of the data in Figure 4 and

Supplementary Data Figure 2 reveals similar overalltrends for amino acid incorporation at the two sitesby the optimized tRNA/aaRS system. High incor-poration levels for pMpa, pAzpa, pApa, and pPpamutants at residues 16 and 33 contrast withsubstantially reduced levels for the pBpa mutants.This suggests that the orthogonal tRNA/aaRS pairsbehave similarly when decoding an amber codon atdifferent positions in the mRNA. Moreover, the datarevealed a number of interesting observationsconcerning the specificity of the improved systemand the evolved tRNA/aaRS pairs.

Specificity of the yeast protein expressionsystem

Analysis of a W33Tyr mutant hSOD (generated bysuppression of the W33TAG mutant in plasmidpC1SODW33 with the parent E. coli tyrosyl-tRNAsynthetase pair)3,20 revealed that 96.1% of theisolated protein is hSODW33Tyr-His6 and 3.9% ishSODW33Gln-His6 (Figure 4(b)). This is not surpris-ing, since it is known that yeast tRNACAG

Gln cansuppress an amber nonsense mutation in vivo bywobble G:U pairing with the anticodon CUG of theglutaminyl tRNA.21 However, a significant reduc-tion in the amount of Gln incorporation (from 3.9%to b1%) is observed for each sample (Figure 4, rowQ) in the improved expression system. This indi-cates effective competition of the amber suppressortRNA expressed from the SUP4 flanking sequencesand the pPGK1 promoter with the endogenousglutaminyl tRNA.Despite the fact that all five aaRSs examined are

derived from TyrRS, the hSODW33Tyr-His6mutant protein was never a major side-product(≤0.2% of total mutant proteins in most cases)

Figure 4. Results of the MRManalysis of the W33 hSOD-His6mutant proteins. (a) Histogram ofamino acid incorporation efficiencyat position 33 of hSOD-His6. ThehSOD-His6 mutant proteins are indi-cated according to the convention(W33Tyr represents hSODW33Tyr-His6, etc.) A natural amino acid atposition 33 is indicated by its single-letter code. UAA represents therespective unnatural amino acid ineach sample (see Figure 1 for theother abbreviations). TRP33(WT) is awild-type hSOD-His6 control.W33Tyr is expressed from a controlstrainusingplasmidspC1hSODW33and pTyrRS(wt)/tRNACUA contain-ing the WT TyrRS gene and thepreviously described tRNACUA con-struct(3) in SCY4. The suppressortRNA expression level in this strainshould be much lower than in theothers(seeFigure2andthetext).Dataare shown only formutants detectedin at least three samples. (b) Table ofthe data represented in (a).

118 Mutant Proteins Containing Unnatural Amino Acids

(Figure 4, rowY). This result indicates that theGAL4-based system3,20 used to select these unnaturalamino acid-specific aaRSs from the TyrRS mutantlibrary discriminates effectively against tyrosine inyeast. MRM analysis did confirm Trp and Leuincorporation (0.4–6% in most cases) into the mutantproteins, particularly the pPpa and pBpa hSOD-His6mutants (Figure 4 and Supplementary Data Figure 2,rowsWand L). Small amounts of uncharged and/orhydrophobic residues (F, Y, S, T, V, G) are occasion-ally detected in the mutant proteins; but no mutantcontaining a charged amino acid (no K, R, minimumH in Figure 4 and no D, E, H in Supplementary DataFigure 2) are observed. The presence of Trp and Leuin themutant proteins likely results from the fact thattwo amino acid auxotrophic markers, TRP1 andLEU2, are present in the plasmids used in both theselection system and the protein expression system.TRP1 encodes phosphoribosylanthranilate isomer-ase, and LEU2 encodes β-isopropylmalate dehydro-genase, which are in the tryptophan and leucinebiosynthetic pathways, respectively. Expression ofthese genes on high-copy number 2 μ plasmids likelyleads to increased intracellular concentrations of

tryptophan and leucine (a rise in the intracellularconcentration of leucine is correlated with the up-regulation of LEU2 in yeast22). The negativeselection3,20 apparently does not completely removeaaRS mutants that have some level of Trp-specificand Leu- specific activity in the presence of highconcentrations of Trp and Leu. While the mode bywhich an evolved aaRS interacts with its cognateunnatural amino acid and Trp or Leu has yet to bedefined, the intracellular availability of the unnaturalamino acid seems to be one of the factors governingthe specificity of the evolved aaRSs and theirselection. pMpa, pAzpa, pApa and pPpa (1–4, Figure1(b)) are highly soluble in the synthetic media andcan be added to a final concentration of 3–5 mMwithout adverse effects on the growth of yeast.pMpa, pAzpa and pApa hSOD-His6mutant proteinsare therefore consistently quite homogeneous (b6%Trp and Leu present). However, the homogeneity ofthe pPpa (1) hSOD-His6mutant varied from∼80% to90% in different isolates (Figure 4 and Supplemen-tary Data Figure 2). Whether pPpa is transportedinto the cell as efficiently as the other three (2, 3, 4) isunknown. In the case of pBpa (5, Figure 1(b)), it is

119Mutant Proteins Containing Unnatural Amino Acids

assumed that the low solubility reduces intracel-lular availability more than that of the otherunnatural amino acids (see Materials and Meth-ods). As a result, the percentage of the pBpa hSOD-His6 mutant protein in an isolate further decreasedto 60% or below (Figure 4 and Supplementary DataFigure 2).We attempted to reduce misincorporation of Trp

and Leu by replacing the TRP1marker with a URA3marker (an enzyme in pyrimidine biosynthesis) inthe tRNA/aaRS plasmids used in the expressionsystem. This change cannot be made in the selectionsystem because URA3 is the only negative selectionmarker in our current selection process.3,20 Noincrease in the purity of the hSOD mutant proteinswas observed (data not shown). Reduction in theexpression levels of the tRNA (with the 1SUP4-tRNACUA construct) increased the purity of mutantprotein only slightly (e.g. hSODW33pMpa-His6)(data not shown), but resulted in reduced yieldsof protein relative to that obtained from the PGK1+3SUP4-tRNACUA construct.In summary, an improved system for high-yield

expression of mutant proteins containing unnaturalamino acids in yeast has been developed. The use oftwo plasmids, one for the increased expression of anorthogonal E. coli tRNA/aminoacyl-tRNA synthe-tase pair, and one for the over-expression of thetarget protein, facilitates the efficient site-specificincorporation of unnatural amino acids into pro-teins in yeast at high levels. In addition, the value ofMRM for profiling the selectivity of tRNA/aaRSpairs was demonstrated, as exemplified by the largenumber of low-level impurities that could bedetected. The insights gained in this study maylead to improvements in the selection system forevolving more specific aaRSs for use in yeast. Forexample, instead of amino acid auxotrophic mar-kers, antibiotic, metal or toxin-resistance markerscan be used. It is likely that the mutant proteinsgenerated using the LeuRS derived aaRSs are morehomogeneous due to the presence of an editingdomain in LeuRS. Finally, it should be possible touse targeted or random mutagenesis approaches toenhance expression yields and homogeneity in theS. cerevisiae host (by improving amino acid uptakeor translational efficiency of the acylated tRNA,etc.), as well as explore other hosts such as Pichiapastoris.

†http://www.umanitoba.ca/faculties/medicine/bio-chem/gietz/%20Trafo.html

Materials and Methods

Materials

PfuUltra High-Fidelity DNA polymerase (Stratagene)was used for polymerase chain reaction (PCR). Yeastdropout medium (SD base and supplements) was fromClontech. Transformation reagents were from the Yeast-MAKER yeast transformation system (Clontech). Yeastplasmids were prepared with the DNA plasmid mini-prep kit (Qiagen) using beads to break cells. Yeastgenomic DNA was isolated with the DNeasy Tissue Kit

(Qiagen). Top10 E. coli (Invitrogen) was used for cloningand DNA manipulation. All plasmids were verified bysequencing. The sequence for the codon-optimized genePR1opt (BlueHeron Bio Inc., Bothell, WA) was depositedin GenBank (accession code EF620776). Racemic p-pro-pargyloxyphenylalanine was prepared as described.13

l-p-Methyoxylphenylalanine was purchased from Sigma.DL-p-Benzoylphenylalanine and DL-p-azidophenylala-nine were purchased from Bachem (King of Prussia,PA). DL-p-Acetylphenylalanine was synthesized bySynChem (Des Plaines, IL). The unnatural amino acids(except p-benzoylphenylalanine) were each dissolved in1 M NaOH to make 1 M (1000×) stock solutions; p-benzoylphenylalanine can be dissolved maximally at∼200 mM in 1 M NaOH.

hSOD plasmid construction and transformation

Plasmids pC1hSODW33 and pC1hSODQ16 were con-structed as described.5 Plasmid pC1SODN27-His6 forhSODN27-His6 gene expression was constructed byQuickchange II site-directed mutagenesis (Stratagene)using primers:

5′-ttcgagcagaaggaaagttagggaccagt-gaaggtg5′-caccttcactggtccctaactttccttctgctcgaa

SCY4 host cells were grown in complete syntheticmedium before transformation. About 10 μg of eachhSOD plasmid was used to transform cells by thelithium acetate method†. After transformation cells wereplated on –Leu agar plates and transformants formedvisible colonies after four to five days at 30 °C. ThehSOD plasmid was re-isolated and restriction digestionanalysis confirmed the presence of the plasmid in thetransformed cells. Plasmids containing tRNA/aaRS werethen transformed into the SCY4/pC1hSOD strain andselected on –LT (–Leu and –Trp) or –LU (–Leu and –Ura)agar plates.

Modification of the pTyrRS-tRNACUA plasmid

The following modifications were made to the pre-viously reported pTyrRS-tRNACUA plasmid3 that containsa p-propargyloxyphenylalanine specific E. coli TyrRS-derived gene: a monocistronic SUP4-tRNACUA wasassembled by PCR with the following primersDL:

primer1F, atcccgaccggtaagctgctagcctctttttcaattgtatatgtgttatgtagta(AgeI and NheI sites underlined):primer2R, gccgctcgggaaccccacctatttaatt-gttgaagaaagagtatactacataacacatat;primer3R, cggctctagacataaaaaacaaaaaaatggtgg-gggaaggattcgaa (XbaI site underlined).

The PCR product was digested with AgeI/XbaI andligated to a ∼8.5 kb fragment of the plasmid linearizedwith AgeI/NheI to afford pPR1-SUP4-tRNACUA. Asecond copy of the SUP4-tRNACUA PCR fragment(digested with AgeI/XbaI) was inserted into the uniqueAgeI and Nhe I site designed into the primer1F. The SUP4-

120 Mutant Proteins Containing Unnatural Amino Acids

tRNACUA gene was unidirectionally cloned as multiplecopies in the same plasmid in this fashion until pPR1-3SUP4-tRNACUA was obtained. Next, primers:

reampR_XbaI, cggctctagacttccttttcggttag-agcggatctta;reampF_AgeI, ccatcatttcttcgatcccgaccggta,

were used to amplify the tRNA region from pPR1-3SUP4-tRNACUA,whichwas subsequently inserted into theAgeI/NheI site of the same plasmid to generate pPR1-6SUP4-tRNACUA. Finally, a ∼650 bp fragment (amplified fromyeast SCY4 genomic DNAwith primers:

PGK1_F, atcccgaccggtcgatttgggcgcgaatccttta;PGK1_R, gtagatgctagcttccttgatgatctgtaaa,

which contains the promoter sequences for the PGK1 gene,was inserted into the AgeI/NheI site of pPR1-3SUP4-tRNACUA to afford pPR1-PGK1+3SUP4-tRNACUA. To testthe promoters for aaRS gene expression, the followingprimer pairs were used to amplify the promoters(indicated in the primer names) from the genomic DNA:

ENO2_F, atcccgaccggtaatcctactcttgccgttgccENO2_R, ccggaattcattgtatgttatagtattagttgcttggtg;FBA1_F, atcccgaccggttgaacaacaataccagccttccFBA1_R, ccggaattcgaatatgtattacttggttatggttatata;RPP2B_F, atcccgaccggtataatagtttttttcattcacttcaccRPP2B_R, ccggaattctgttgttgattaatagatattactttc;RPP15/21_F, atcccgaccggttaccgacggattccaaaatagccRPP15/21_R, ccggaattcggtcgtgattatcttgttgtgtac;TDH3_F, atcccgaccggtctattttcgaggaccttgtcaccTDH3_R, ccggaattcgtttatgtgtgtttattcgaaactaagt;RPL2B_F, atcccgaccggtgattggactctgagaagcacattgRPL2B_R, ccggaattcgtttagtgtccttgactgtctcag;RPS2_F, atcccgaccggttttcattgagattcatagttccgRPS2_R, ccggaattcttaattagttgagcttattggttg;RPL5_F, atcccgaccggtacacattcttcagagctcattaRPL5_R, gccggaattctgagatttgtgacggtgtctt

These PCR fragments were digested with AgeI andEcoRI, and substituted in place of the pADH1 promoter inpPR1-PGK1+3SUP4-tRNACUA to afford a series of plas-mids that have different promoters for the aaRS gene. Thecodon-optimized PR1opt gene was digested with EcoRIand NotI, and substituted in place of the original PR1 inpPR1-PGK1+3SUP4-tRNACUA to afford pPR1opt-PGK1+3SUP4-tRNACUA. Genes for p- methoxyphenylalanine(OMeTyrRS-1 variant), p-acetylphenylalanine, p-benzoyl-phenylalanine (BpaTyrRS-2 variant) and p-azidophenyla-lanine (AzidoTyrRS-3 variant) aaRSs were amplified fromthe published plasmids3,13 with the primers:

EYRS_EcoRI_F, tcaactgaattcatggcaagcagtaacttga;EYRS_NotI_R, atactagtgcggccgcttagtggtggtg-gtggtggtgtttccagcaaatcagacagtaa.

These DNA fragments were then digested with EcoRI andNotI, and substituted for the aaRS in pPR1-PGK1+3SUP4-tRNACUA. The resulting plasmids are termed pOme1-PGK1+3SUP4-tRNACUA, pBpa2-PGK1+3SUP4-tRNACUA,pAz3-PGK1+3SUP4-tRNACUA and pApa-PGK1+3SUP4-tRNACUA. To change TRP1 to a URA3 marker, the URA3gene was removed from pESC-Ura (Stratagene) as a∼2.6 kb XbaI-NotI fragment and used to replace thecorresponding TRP1 gene in the plasmids above. Theresulting plasmids are termed pOme1-Ura, pAz3-Ura,pPR1-Ura and pBpa2-Ura.

Northern blot analysis

Yeast host cells (SCY4/hSODW33) transformed withplasmids were grown in –Leu and –Trp liquid media at30 °C to A600 ∼1.0. Total RNA was isolated with aRibopure yeast kit (Ambion). About 8 μg of total RNAwas separated by 8 M urea-PAGE (10% polyacrylamidegel) for tRNA detection or a glyoxal agarose gelelectrophoresis for mRNA detection, and transferred toa nylon membrane (Ambion). The RNAs were UV-crosslinked to the membrane and hybridized with[5′-32P]DNA oligomers at 42 °C using a NorthernMAXkit (Ambion). After washing, radioactivity on the mem-brane was detected with a Phosphoimager. The oligonu-cleotide probes (5′ to 3′) to detect the E. coli tyrosyl-tRNACUA were a mixture of:

ggaaggattcgaaccttcgaagtcgatgacgg and tctgctccctttggccgctcgggaaccccacc

The probes to detect TyrRS derived PR1 mRNAwere amixture of:

gaagcggttaagcagcgtctca andcagtccgatcctgaatacttcttta

Protein expression and purification

Fresh transformed cells grown overnight in liquidmedium (A600 ∼2.0) were used to inoculate 100 ml offresh medium supplemented with 1 mM unnaturalamino acid (except p-benzoylphenylalanine) in a 500 mlflask to A600 ∼0.2. p-Benzoylphenylalanine was addedfrom a 1000-fold concentrated stock solution (∼200 mM)to growth cultures at 8–10 h intervals (five additions intotal) during fermentation; some white precipitate wasobserved after each addition. Cell cultures were incu-bated at 30 °C in an orbital shaker (250 rpm) for two daysuntil A600 was 2.5 or higher. Cells were pelleted, washedonce with saline, and lysed with Y-Per (Pierce) containingEDTA-free protease inhibitor (Roche). Cleared lysate waspassed through a 0.5 ml column of Ni-NTA agarose resinequilibrated with Y-Per. The column was washed withthree bed volumes of PBS (pH 8.0) containing 150 mMNaCl, and then three bed volumes of 30 mM imidazole inPBS. The His6-tagged hSOD protein was eluted in PBScontaining 250 mM imidazole, and dialyzed againstwater. Protein concentration was measured by theBradford assay (Bio-Rad). For Western blots, fermenta-tion conditions were the same as above: 100 μl of Y-perwas used to lyse the cells from a 1–2 ml culture. Then10 μl of lysate was mixed with loading buffer andseparated by SDS-PAGE on a 4%–20% polyacrylamidegel made with Tris-glycine . Western blots of His6-taggedproteins were detected with the SuperSignal West kit(Pierce).

Proteolysis

Proteolysis of affinity-purified proteins was carried outby incubation of proteins overnight at 37 °C withsequencing-grade modified trypsin (Promega) or endo-proteinase GluC (Roche Applied Science) using a sub-strate to enzyme ratio of 20:1 (w/w) based on theestimated protein concentration in 50 mM ammoniumbicarbonate buffer. In-gel digestions with trypsin and

121Mutant Proteins Containing Unnatural Amino Acids

GluC were performed according to the EMBL proce-dure‡. Briefly, gel slices were excised as approximately1 mm ×1 mm ×1 mm cubes, washed for 5 min withwater, 15 mins with acetonitrile, and dried in a vacuumcentrifuge before being rehydrated at 0 °C for 30 minwith 12.5 ng/μl of sequencing-grade modified trypsin orGluC in 50 mM ammonium bicarbonate buffer. Excessbuffer was removed and 20 μl of 50 mM ammoniumbicarbonate buffer was added to the gel slices beforeincubating at 37 °C overnight. Peptides were extractedfrom the gel slices as described in the EMBL procedure.

Nano-reverse phase (RP) LC MS/MS

Nano-reverse phase LC MS/MS was performed withan HPLC pump, an autosampler (Agilent Technologies,Palo Alto, CA), and an LTQ Orbitrap hybrid massspectrometer (ThermoElectron, San Jose, CA). Alterna-tively, for MRM experiments an identical HPLC systemwas used and a 4000 Q-Trap mass spectrometer (AppliedBiosystems/MDS Sciex, Foster City, CA). Digests wereloaded onto a vented column setup23 consisting of a100 μm i.d. precolumn packed with 4 cm of 5 μmMonitor C18 particles (Column Engineering, Ontario,CA) and an analytical column with integrated emitter tip(360 μm O.D.×75 μm i.d; 10 cm of 5 μm C18, ∼5 μm tip).The chromatographic profile was from 100% solvent A(0.1% aqueous acetic acid) to 40% solvent B (0.1% aceticacid in acetonitrile) in 60 min or alternatively from 100%solvent A (0.1% aqueous acetic acid) to 30% solvent B(0.1% acetic acid in acetonitrile) in 60 min at a flow rateof ∼100 nl/min.

MRM analysis

Two peptide mixtures containing the peptidesSNGPVKVxGSIKGLTE and GDGPVxGIINFEQK (x=nat-ural amino acid) (Biopeptide Corp., San Diego, CA)were used as retention time standards. The two standardpeptide mixtures contain all the expected peptidesresulting from incorporation of the 20 natural aminoacids at the W33 site (after GluC digestion) and the Q16site (after trypsin digestion) of hSOD, respectively.Analysis of the standards on the LTQ-Orbitrap systemallowed the establishment of an unambiguous retentiontime reference scale by combining accurate mass andMS/MS identification with the exception of leucine andisoleucine, which are structural isomers but neverthelesswere separated chromatographically at baseline. Fromknown retention time coefficients,24,25 and the knowl-edge that the analyzed peptides form a homologousseries, it is possible to assign the later eluting specieswith high confidence to the leucine-containing peptide(most frequently observed in the samples) and theearlier one to the isoleucine-containing species. Retentiontimes were not stable due to the use of a passivesplitting system used to achieve the low analytical flow-rates required for capillary chromatography. To over-come this variability, analytes were identified by plottingobserved retention times against the established stan-dard retention time-scale. These correlation plotsallowed the confident prediction of peptide retention

‡http://www.narrador.embl-heidelberg.de/Group-Pages/PageLink/activities/protocols/ingeldigest.html

times and unambiguous identification of the correctMRM signals even at low signal-to-noise levels duringdata analysis.The MS/MS spectra of the wild-type peptides

SNGPVKVWGSIKGLTE and GDGPVQGIINFEQK wereused to select strong MRM transitions. Equivalenttransitions for all the other potential peptides containingunnatural or natural amino acids were computed on thebasis of the selections made from the standards. For rela-tive quantification of SNGPVKVxGSIKGLTE, the MRMtransitions based on the respective triply charged pre-cursor ion masses and the ions y14++, y13++, b15++, b14++

(++ indicating a doubly charged ion) were used (Supple-mentary Data Figure 3). The GDGPVxGIINFEQK transi-tions were based on the doubly charged precursor andthe fragment ions y9+, y8+, y6+, b9+, b6+ (SupplementaryData Figure 4). MRM signals for each set of transitionswere manually summed and integrated using the AnalystSoftware package (Applied Biosystems/MDS Sciex,Foster City, CA). Significant decomposition of azidophe-nyl alanine species to the respective p-aminophenylala-nine species required monitoring of both signals andsummation.

Intact protein LC MS/MS

Intact protein mass spectra were acquired on anautomated LC/MS system (Waters, Milford, MA) consist-ing of a capillary LC with auto-sampler and a QTOF2mass spectrometer. Proteins (0.1 mg/ml) were loadedonto a reversed-phase protein Captrap (Michrom Bior-esources, Auburn, CA) for desalting with 0.1% (v/v) aceticacid in water and eluted with 80% (v/v) acetonitrile,0.1% (v/v) acetic acid at 5 μl/min into the ESI source of themass spectrometer. Summation, smoothing, and decon-volution of the spectra with the MaxEnt1 algorithm wereperformed using the MassLynx (Waters, Milford, MA)software package.

Acknowledgements

This work was supported by NIH GM62159 andthe Skaggs Institute for Chemical Biology (to P.G.S.).It is TSRI manuscript 18735.

Supplementary Data

Supplementary data associated with this articlecan be found, in the online version, at doi:10.1016/j.jmb.2007.05.017

References

1. Xie, J. & Schultz, P. G. (2006). A chemical toolkit forproteins—an expanded genetic code. Nature Rev. Mol.Cell Biol. 7, 775–782.

2. Wang, L. & Schultz, P. G. (2005). Expanding thegenetic code. Angew. Chem. Int. Edit. 44, 34–66.

3. Chin, J. W., Cropp, T. A., Anderson, J. C., Mukherji,M., Zhang, Z. W. & Schultz, P. G. (2003). An expandedeukaryotic genetic code. Science, 301, 964–967.

122 Mutant Proteins Containing Unnatural Amino Acids

4. Wu, N., Deiters, A., Cropp, T. A., King, D. S. & Schultz,P. G. (2004). A genetically encoded photocaged aminoacid. J. Am. Chem. Soc. 126, 14306–14307.

5. Summerer, D., Chen, S., Wu, N., Deiters, A., Chin,J. W. & Schultz, P. G. (2006). A genetically encodedfluorescent amino acid. Proc. Natl Acad. Sci. USA, 103,9785–9789.

6. Erhart, E. & Hollenberg, C. P. (1983). The presence of adefective LEU2 gene on 2u DNA recombinant plasmidof Saccharomyces cerevisiae is responsible for curing andhigh copy number. J. Bacteriol. 156, 625–635.

7. Mehta, S., Yang, X. M., Xian, M., Chan, C. S., Clarence,S., Dobson, M. J. et al. (2002). The 2 micron plasmidpurloins the yeast cohesin complex: a mechanism forcoupling plasmid partitioning and chromosome seg-regation? J. Cell Biol. 158, 625–637.

8. Parge, H. E., Hallewell, R. A. & Tainer, J. A. (1992).Atomic structures of sild-type and thermostablemutant recombinant human Cu,Zn superoxide dis-mutase. Proc. Natl Acad. Sci. USA, 89, 6109–6113.

9. Sakamoto, K., Hayashi, A., Sakamoto, A., Kiga, D.,Nakayama, H., Soma, A. et al. (2002). Site-specificincorporation of an unnatural amino acid into proteinsin mammalian cells. Nucl. Acids Res. 30, 4692–4699.

10. Bedouelle, H. (1990). Recognition of tRNATyr bytyrosyl-tRNA synthetase. Biochimie, 72, 589–598.

11. Kassavetis, G. A., Riggs, D. L., Negri, R. R., Nguyen,L. H. & Geiduschek, E. P. (1989). Transcription factorIIIB generates extended DNA interactions in RNApolymerase III transcription complexes on tRNA genes.M. Cellular Biol. 9, 2551–2566.

12. Goodman, H. M., Olson, M. V. & Hall, B. D. (1977).Nucleotide sequence of a mutant eukaryotic gene: theyeast tyrosine-inserting ochre suppressor SUP4-o.Proc. Natl Acad. Sci. USA, 74, 5453–5457.

13. Deiters, A., Cropp, T. A., Mukherji, M., Chin, J. W.,Anderson, J. C. & Schultz, P. G. (2003). Adding aminoacids with novel reactivity to the genetic code of Sac-charomyces cerevisiae. J. Am. Chem. Soc. 125, 11782–11783.

14. Jansen, R. & Gerstein, M. (2000). Analysis of the yeasttranscriptome with structural and functional cate-gories: characterizing highly expressed proteins. Nucl.Acids Res. 28, 1481–1488.

15. Sharp, P. M., Tuohy, T. M. F. & Mosurski, K. R. (1986).Codon usage in yeast: cluster analysis clearly differ-

entiates highly and lowly expressed genes.Nucl. AcidsRes. 14, 5125–5143.

16. Varshney, U., Lee, C. P. & RajBhandary, U. L. (1991).Direct analysis of aminoacylation levels of tRNAs invivo. Application to studying recognition of Escher-ichia coli initiator tRNA mutants by glutaminyl-tRNAsynthetase. J. Biol. Chem. 266, 24712–24718.

17. Lindberg, M. J., Normark, J., Holmgren, A. &Oliveberg, M. (2004). Folding of human superoxidedismutase: disulfide reduction prevents dimerizationand produces marginally stable monomers. Proc. NatlAcad. Sci. USA, 101, 15893–15898.

18. Kwon, I., Wang, P. & Tirrell, D. A. (2006). Design of abacterial host for site-specific incorporation of p-bro-mophenylalanine into recombinant proteins. J. Am.Chem.Soc.128,11778–11783.

19. Liu, W., Brock, A., Chen, S., Chen, S.-b. & Schultz, P.(2007). The genetic incorporation of unnatural aminoacids into proteins in mammalian cells. NatureMethods, 4, 239–244.

20. Chin, J. W., Cropp, T. A., Chu, S., Meggers, E. &Schultz, P. G. (2003). Progress toward an expandedeukaryotic genetic code. Chem. Biol. 10, 511–519.

21. Weiss, W. A. & Friedberg, E. C. (1986). Normalyeast tRNACAGGln can suppress amber codonsand is encoded by an essential gene. J. Mol. Biol.192, 725–735.

22. Oba, T., Yamamoto, Y., Nomiyama, S., Suenaga, H.,Muta, S., Tashiro, K. & Kuhara, S. (2006). Properties ofa trifluoroleucine-resistant mutant of Saccharomycescerevisiae. Biosci. Biotechnol. Biochem. 70, 1776–1779.

23. Licklider, L. J., Thoreen, C. C., Peng, J. & Gygi, S. P.(2002). Automation of nanoscale microcapillary liquidchromatography-tandem mass spectrometry a ventedcolumn. Anal. Chem. 74, 3076–3083.

24. Wang, Y., Zhang, J. & Gu, X. (2005). Proteinidentification assisted by the prediction of retentiontime in liquid chromatography/tandemmass spectro-metry. J. Chromatog. B, 826, 122–128.

25. Shinoda, K., Sugimoto, M., Yachie, N., Sugiyama, N.,Masuda, T., Robert, M. et al. (2006). Prediction ofliquid chromatographic retention times of peptidesgenerated by protease digestion of the Escherichia coliproteome using artificial neural networks. J. Proteome.Res. 5, 3312–3317.

Edited by J. Karn

(Received 14 March 2007; received in revised form 2 May 2007; accepted 3 May 2007)Available online 22 May 2007