Upload
rachel-bennett
View
218
Download
0
Tags:
Embed Size (px)
Citation preview
An elusive expansion at the FRDA locus
Claire Healey, Andrew Purvis, Mohammed Kiron Kibria, Kara Gaffing, Fiona Coyne & Roger Mountford
Cheshire and Merseyside Regional Molecular Genetics Laboratory, Liverpool Women’s Hospital
Presentation OverviewIntroduction:
• Friedreich ataxia: Clinical symptoms; Molecular pathology
Case 1:• Diagnostic referral;• CAG repeat expansion testing;• Unusual TP-PCR result
Case 2:• Diagnostic referral;• Premutation plus GAA repeat expansion within the disease-causing size range
Case 3:• Carrier testing;• GAA repeat expansion undetected using standard analysis
Friedreich Ataxia (FRDA)• Autosomal recessive neurodegenerative disorder;• Affects the spinal column and cerebellum;• Slowly progressive ataxia of the gait & limbs;• Onset: 10 – 15 years of age
• Associated with: Muscle weakness; Spasticity in the lower limbs; Absent lower limb reflexes; Dysarthria; Scoliosis; Pes cavus; Bladder dysfunction; Loss of position and vibration sense
FRDA• Additional clinical symptoms:
• ~ 30 %: Hypertrophic non-obstructive cardiomyopathy
• ~ 10-25%: Optic atrophy; Deafness; Glucose intolerance or Diabetes mellitus
• ~ 25%: Atypical presentation:
Later age of onset; Retained tendon reflexes; or Unusually slow disease progression
Genetics of FRDA• Incidence of 2-4 per 100,000 – Europe, N. Africa, Middle East & S. Asia • Carrier frequency of ~ 1:100
• FRDA gene (Frataxin or X25) indentified in 1996:
1. Expansion of GAA triplet repeat within intron 1 = 98% mutations
5a1 42 3
aaaaaaaaaaaaaaagaagaagaagaagaagaagaaaataaaga
Normal alleles: 5-33 GAA repeats; Alleles > 27 repeats rare; Premutation alleles: 34-65 GAA repeats; Expanded alleles: > 66 GAA repeats
Some alleles have interrupted sequences: GAAGGA or GAGGAA
Genetics of FRDA• Incidence of 2-4 per 100,000 – Europe, N. Africa, Middle East & S. Asia • Carrier frequency of 1:100
• FRDA gene (Frataxin or X25) indentified in 1996:
1. 98% mutations = expansion of GAA triplet repeat within intron 1
5a1 42 3
106
2. 1-2% FRDA patients – GAA expansion plus inactivating mutation, (nonsense, splicing, frameshift or missense)
Homozygous expansion & compound heterozygous patients: clinically indistinguishable; Patients with missense mutations near the carboxy-terminus have atypically mild FRDA; No patients have been described with two identified point mutations
1
165
182
Detection of GAA repeats:
• Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers
Molecular Genetic Testing
Molecular Genetic Testing
Detection of GAA repeats:
• Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers
n/n (8/29 repeats)
n/?
Molecular Genetic Testing
Detection of GAA repeats:
• Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers;b) Triplet-prime PCR
n
E
Case 1
• Diagnostic referral;• Expansion & point mutation analysis requested:
Institute of Neurology: GAA repeat flanking PCR; TP-PCR
• Clinical details: 52 year old female; No further details avaliable
Case 1
F-PCR:
Patient
1. 31 rpt control
2.
Expansion control
3.Hom & Het normal controls
4. & 5.
8 repeats
Molecular Genetic Testing
Triplet-prime PCR:
cttcttcttcttcttcttcttcttcttgaagaagaagaagaagaagaa
Triplet-prime PCR:
Molecular Genetic Testing
cttcttcttcttcttcttcttcttcttgaagaagaagaagaagaagaa
Triplet-prime PCR:
Molecular Genetic Testing
cttcttcttcttcttcttcttcttcttgaagaagaagaagaagaagaa
cttcttcttcttcttcttcttcttcttgaagaagaagaagaagaagaa
gaagaagaagaagaagaagaa
gaagaagaagaagaagaagaa
gaagaagaagaagaagaagaa
Molecular Genetic Testing
Case 1
TP-PCR:
Case 1
Modified TP-PCR:
Primers:
FATP-P3-F-FAM
FATP-P1-R
FATP-P4-F GAA Int + FATP-P4-F GAG Int
Case 1
Southern Blot:
Patient Normal E/E n/E
1. 2. 3. 4.
EcoRVFA3PEx1
Case 1
? Clinical Significance:
• Long GAA repeats tracts form abnormal ‘sticky’ triplex DNA structures;
Case 1
? Clinical Significance:
• Long GAA repeats tracts form abnormal ‘sticky’ triplex DNA structures;• Inhibit transcription = reduced Frataxin protein
• Interrupted alleles: Triplexes less likely to form; Not predicted to inhibit transcription of Frataxin to the same extent as
pure GAA repeats; Shorter in length (equivalent to alleles of 100-300 triplets); May be associated with late on-set disease
(GAGGAA)n & (GAAAGAA)n interruptions may stabilise premutation alleles;
May prevent expansion into abnormal size range
• Clear guidelines regarding the implications of these interruptions and their clinical significance have not been established
Case 1
? Clinical Significance:
• Patient: 1 normal allele; 1 interrupted allele; No further mutations identified on sequence analysis
• Unlikely to be affected with FA;• ? chance finding unrelated to the patient’s symptoms
• Further work: Sequence interrupted allele
• Detection of interrupted: May be difficult using standard TP-PCR; Requires contiguous run of GAA repeats
• Diagnostic referral: 53 year old female: Progressive cerebellar degeneration
• F-PCR analysis identified an allele within the premutation range (~38 rpts);
• TP-PCR analysis detected the presence of an expansion
Case 2
Southern blot analysis:
• Confirmed presence of an allele in the premutation size range & an expanded allele in the affected size range
Case 2
Patient Normal E/E n/E
1. 2. 3. 4.
EcoRVFA3PEx1
Case 2
? Clinical Significance:
• Patient: 1 allele within premutation size range; 1 allele within affected size range; Identified in peripheral lymphocytes
• Premutation alleles: Not thought to affect transcription of the Frataxin gene; Not thought to be pathogenic; May show somatic instability
• ? if a significant proportion of such alleles expand into the affected size range in appropriate tissues, this may lead to atypical disease;
• Increases the likelihood of a diagnosis of FA
• Further work: Testing of other tissue types; Family studies
• Diagnostic referral: 10 year old child: Progressive ataxia, weakness, deteriorating motor skills, cerebellar
dysfunction; Two GAA repeat expansions
Mother identified as a carrier using standard testing strategy;
• Southern blot analysis:
EcoRV FA3PEx1
Case 3
9.4 Kb -
6.5 Kb -
4.3 Kb -
23 Kb - 1 7 8
• Diagnostic referral: 10 year old child: Progressive ataxia, weakness, deteriorating motor skills, cerebellar
dysfunction;
Mother identified as a carrier using standard testing strategy;
• Modified TP-PCR Assay: Different locus specific P1-primer;
Case 3
Standard TP-PCR
Modified TP-PCR
Mother Father
No expansion detected
• DNA sequencing: Primers flanking the standard P1 priming site
30bp deletion: Covering the whole of the standard TP-PCR P1 priming site in the patient’s
father and the affected child;
Deletion present on the same allele as the expansion; Explains why the expansion in the patient’s father could not be detected
using standard TP-PCR
• Summary: Samples harbouring such a deletion would give results consistent with
homozygosity for the same size normal allele using these assays; Deletion would not be detected - potentially an expansion could be
missed 115 FA referrals with 1 allele in the normal range and no TP-PCR expansion
were tested for the presence of this deletion No further deletions were identified in this cohort Likely that such a deletion is either very uncommon or private to this family
Case 3
Break point
Mother
Father
Affected child
AcknowledgementsAcknowledgements
All within the molecular genetics laboratoryAll within the molecular genetics laboratory
Andrew Purvis
Mohammed Kiron Kibria
Kara Gaffing
Fiona Coyne
Roger Mountford
Thank-you for listening