An elusive expansion at the FRDA locus

Claire Healey, Andrew Purvis, Mohammed Kiron Kibria, Kara Gaffing, Fiona Coyne & Roger Mountford

Cheshire and Merseyside Regional Molecular Genetics Laboratory, Liverpool Women’s Hospital

Presentation OverviewIntroduction:

• Friedreich ataxia: Clinical symptoms; Molecular pathology

Case 1:• Diagnostic referral;• CAG repeat expansion testing;• Unusual TP-PCR result

Case 2:• Diagnostic referral;• Premutation plus GAA repeat expansion within the disease-causing size range

Case 3:• Carrier testing;• GAA repeat expansion undetected using standard analysis

Friedreich Ataxia (FRDA)• Autosomal recessive neurodegenerative disorder;• Affects the spinal column and cerebellum;• Slowly progressive ataxia of the gait & limbs;• Onset: 10 – 15 years of age

• Associated with: Muscle weakness; Spasticity in the lower limbs; Absent lower limb reflexes; Dysarthria; Scoliosis; Pes cavus; Bladder dysfunction; Loss of position and vibration sense

FRDA• Additional clinical symptoms:

• ~ 30 %: Hypertrophic non-obstructive cardiomyopathy

• ~ 10-25%: Optic atrophy; Deafness; Glucose intolerance or Diabetes mellitus

• ~ 25%: Atypical presentation:

Later age of onset; Retained tendon reflexes; or Unusually slow disease progression

Genetics of FRDA• Incidence of 2-4 per 100,000 – Europe, N. Africa, Middle East & S. Asia • Carrier frequency of ~ 1:100

• FRDA gene (Frataxin or X25) indentified in 1996:

1. Expansion of GAA triplet repeat within intron 1 = 98% mutations

5a1 42 3

aaaaaaaaaaaaaaagaagaagaagaagaagaagaaaataaaga

Normal alleles: 5-33 GAA repeats; Alleles > 27 repeats rare; Premutation alleles: 34-65 GAA repeats; Expanded alleles: > 66 GAA repeats

Some alleles have interrupted sequences: GAAGGA or GAGGAA

Genetics of FRDA• Incidence of 2-4 per 100,000 – Europe, N. Africa, Middle East & S. Asia • Carrier frequency of 1:100

• FRDA gene (Frataxin or X25) indentified in 1996:

1. 98% mutations = expansion of GAA triplet repeat within intron 1

5a1 42 3

106

2. 1-2% FRDA patients – GAA expansion plus inactivating mutation, (nonsense, splicing, frameshift or missense)

Homozygous expansion & compound heterozygous patients: clinically indistinguishable; Patients with missense mutations near the carboxy-terminus have atypically mild FRDA; No patients have been described with two identified point mutations

1

165

182

Detection of GAA repeats:

• Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers

Molecular Genetic Testing

Molecular Genetic Testing

Detection of GAA repeats:

• Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers

n/n (8/29 repeats)

n/?

Molecular Genetic Testing

Detection of GAA repeats:

• Current testing strategy: a) F-PCR across repeat region with FAM-labelled primers;b) Triplet-prime PCR

n

E

Case 1

• Diagnostic referral;• Expansion & point mutation analysis requested:

Institute of Neurology: GAA repeat flanking PCR; TP-PCR

• Clinical details: 52 year old female; No further details avaliable

Case 1

F-PCR:

Patient

1. 31 rpt control

2.

Expansion control

3.Hom & Het normal controls

4. & 5.

8 repeats

Molecular Genetic Testing

Triplet-prime PCR:

cttcttcttcttcttcttcttcttcttgaagaagaagaagaagaagaa

Triplet-prime PCR:

Molecular Genetic Testing

cttcttcttcttcttcttcttcttcttgaagaagaagaagaagaagaa

Triplet-prime PCR:

Molecular Genetic Testing

cttcttcttcttcttcttcttcttcttgaagaagaagaagaagaagaa

cttcttcttcttcttcttcttcttcttgaagaagaagaagaagaagaa

gaagaagaagaagaagaagaa

gaagaagaagaagaagaagaa

gaagaagaagaagaagaagaa

Molecular Genetic Testing

Case 1

TP-PCR:

Case 1

Modified TP-PCR:

Primers:

FATP-P3-F-FAM

FATP-P1-R

FATP-P4-F GAA Int + FATP-P4-F GAG Int

Case 1

Southern Blot:

Patient Normal E/E n/E

1. 2. 3. 4.

EcoRVFA3PEx1

Case 1

? Clinical Significance:

• Long GAA repeats tracts form abnormal ‘sticky’ triplex DNA structures;

Case 1

? Clinical Significance:

• Long GAA repeats tracts form abnormal ‘sticky’ triplex DNA structures;• Inhibit transcription = reduced Frataxin protein

• Interrupted alleles: Triplexes less likely to form; Not predicted to inhibit transcription of Frataxin to the same extent as

pure GAA repeats; Shorter in length (equivalent to alleles of 100-300 triplets); May be associated with late on-set disease

(GAGGAA)n & (GAAAGAA)n interruptions may stabilise premutation alleles;

May prevent expansion into abnormal size range

• Clear guidelines regarding the implications of these interruptions and their clinical significance have not been established

Case 1

? Clinical Significance:

• Patient: 1 normal allele; 1 interrupted allele; No further mutations identified on sequence analysis

• Unlikely to be affected with FA;• ? chance finding unrelated to the patient’s symptoms

• Further work: Sequence interrupted allele

• Detection of interrupted: May be difficult using standard TP-PCR; Requires contiguous run of GAA repeats

• Diagnostic referral: 53 year old female: Progressive cerebellar degeneration

• F-PCR analysis identified an allele within the premutation range (~38 rpts);

• TP-PCR analysis detected the presence of an expansion

Case 2

Southern blot analysis:

• Confirmed presence of an allele in the premutation size range & an expanded allele in the affected size range

Case 2

Patient Normal E/E n/E

1. 2. 3. 4.

EcoRVFA3PEx1

Case 2

? Clinical Significance:

• Patient: 1 allele within premutation size range; 1 allele within affected size range; Identified in peripheral lymphocytes

• Premutation alleles: Not thought to affect transcription of the Frataxin gene; Not thought to be pathogenic; May show somatic instability

• ? if a significant proportion of such alleles expand into the affected size range in appropriate tissues, this may lead to atypical disease;

• Increases the likelihood of a diagnosis of FA

• Further work: Testing of other tissue types; Family studies

• Diagnostic referral: 10 year old child: Progressive ataxia, weakness, deteriorating motor skills, cerebellar

dysfunction; Two GAA repeat expansions

Mother identified as a carrier using standard testing strategy;

• Southern blot analysis:

EcoRV FA3PEx1

Case 3

9.4 Kb -

6.5 Kb -

4.3 Kb -

23 Kb - 1 7 8

• Diagnostic referral: 10 year old child: Progressive ataxia, weakness, deteriorating motor skills, cerebellar

dysfunction;

Mother identified as a carrier using standard testing strategy;

• Modified TP-PCR Assay: Different locus specific P1-primer;

Case 3

Standard TP-PCR

Modified TP-PCR

Mother Father

No expansion detected

• DNA sequencing: Primers flanking the standard P1 priming site

30bp deletion: Covering the whole of the standard TP-PCR P1 priming site in the patient’s

father and the affected child;

Deletion present on the same allele as the expansion; Explains why the expansion in the patient’s father could not be detected

using standard TP-PCR

• Summary: Samples harbouring such a deletion would give results consistent with

homozygosity for the same size normal allele using these assays; Deletion would not be detected - potentially an expansion could be

missed 115 FA referrals with 1 allele in the normal range and no TP-PCR expansion

were tested for the presence of this deletion No further deletions were identified in this cohort Likely that such a deletion is either very uncommon or private to this family

Case 3

Break point

Mother

Father

Affected child

AcknowledgementsAcknowledgements

All within the molecular genetics laboratoryAll within the molecular genetics laboratory

Andrew Purvis

Mohammed Kiron Kibria

Kara Gaffing

Fiona Coyne

Roger Mountford

Thank-you for listening