AmpliTaq and AmpliTaq Gold DNA Polymerase

The Most Referenced Brand of DNA Polymerase in the World

Date: 2005-05

Notes: Authors are listed alphabetically

Molecular Immunology (48) Armour, K. L., P. R. Tempest, et al. (1994). "Sequences of heavy and light chain variable regions from four bovine immunoglobulins." Molecular Immunology 31(17): 1369. http://www.sciencedirect.com/science/article/B6T9R-476N7JP-

5B/2/c8f240fb549edf1d8042f60a1d29070f

Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and [lambda] constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V[lambda], from four bovine immunoglobulins of different specificities are presented.

Bates, E. E. M., M. C. Dieu, et al. (1998). "CD40L activation of dendritic cells down-regulates DORA, a novel member of the immunoglobulin superfamily." Molecular Immunology 35(9): 513.

http://www.sciencedirect.com/science/article/B6T9R-3VR19S9-2/2/1f521e6c275a7ba8fb94940fc5b2d5cf

Using a cDNA subtraction technique, a novel member of the immunoglobulin superfamily was isolated from human Dendritic cells (DC). This cDNA which we named DORA, for DOwn-Regulated by Activation encodes a protein belonging to the CD8 family of receptors containing a single V type loop domain with an associated J chain region, a transmembrane region containing an atypical tyrosine residue and a cytoplasmic domain containing three putative tyrosine phosphorylation sites. The hDORA gene has been localised to chromosome 16. From database searches a rat cDNA was identified that encoded a polypeptide with 63% identity to hDORA. The expression of the human cDNA was studied in detail. Northern blot analysis revealed 1.0 kb and 2.5 kb mRNAs in peripheral blood lymphocytes, spleen and lymph node, while low levels were observed in thymus, appendix, bone marrow and fetal liver. No signal was noted in non-immune system tissues. By RT-PCR analysis of hDORA revealed expression in cells committed to the myeloid lineage but not in CD34+ precursors or B cells and low expression in T cells. Expression was also observed in DC, purified ex vivo or generated in vitro from either monocytes or CD34+ progenitors. This was down-regulated following activation both by PMA and Ionomycin treatment and also by CD40L engagement. In situ hybridisation performed on tonsil sections showed the presence of hDORA in cells within Germinal Centers. This structure and expression suggests a function as a co-receptor, perhaps in an antigen uptake complex, or in homing or recirculation of DC.

Breiteneder, H., R. Friedl-Hajek, et al. (1996). "Sequence comparisons of the CDR3 hyper-variable loops of human T cell receptors specific for three major T cell epitopes of the birch pollen allergen Bet v 1." Molecular Immunology 33(13): 1039.

http://www.sciencedirect.com/science/article/B6T9R-3W3171M-4/2/4875f1e3cd492f3b007286c6cc07d071

We have analysed the T cell receptor (TCR) [alpha] and [beta] chain sequences of 16 human CD4+ T cell clones (TCCs) specific for three important epitopes of the major birch pollen allergen Bet v 1. The TCCs were raised from the peripheral blood of eight patients with birch pollen allergy, showing allergic rhino-conjunctivitis and allergic asthma. The TCCs from these individuals were specific for Bet v 1-derived peptides: amino acids (aa)77-92 (epitope 1), aa93-108 (epitope 2) and aa113-126 (epitope 3). The DNA sequence analysis of the TCRAV and BV regions revealed heterogeneous repertoires for recognition of the peptides. Multiple combinations of AV/AJ and BV/BJ were used. However, some inter-individual restriction was evident. A limited selection of AV8 and the normally infrequently used BV1S4 was obvious in TCCs specific for epitope 1. The TCRBV13 was more frequent in TCCs recognizing epitope 3. A very narrow distribution in length could be seen in the CDR3 sequences of the [beta] chain of TCRs with specificity for epitopes 1 and 2. Inter-individual positional micro-restriction was observed for the aa motif LR in the [beta]CDR3 (epitope 1), for the aa residue M in the [alpha]CDR3 and for the aa residue G in the [beta]CDR3 (epitope 3). Our results illustrate clearly that each antigenic peptide derived from a single allergen, is capable of selecting different characteristics in the responding repertoire of TCRs, thus increasing the complexity of allergen-recognition by T lymphocytes. Therefore, our findings limit the potential use of TCR targeted therapeutical strategies in Type I allergy.

Campbell, M. J., A. D. Zelenetz, et al. (1992). "Use of family specific leader region primers for PCR amplification of the human heavy chain variable region gene repertoire." Molecular Immunology 29(2): 193.

http://www.sciencedirect.com/science/article/B6T9R-476TRCP-2M/2/50891e6db13d28a7af83f515babb8bcd

We have designed a set of six, non-degenerate oligonucleotide primers, corresponding to the 5' leader regions of each of the six human VH gene families. A general strategy for family specific polymerase chain reaction amplification is described using these primers and a conserved 3' primer corresponding to frame work 3, JH, or constant region. This strategy was used to isolate and sequence novel human germline VH genes belonging to the VH2 and VH4 families. Under certain conditions, chimeric VH sequences were created by a "jumping polymerase chain reaction", combining DNA segments from different germline genes, but this could be avoided by limiting the number of amplification cycles. PCR amplification with these family specific primers will facilitate studies of the repertoire of germline VH genes as well as studies on VH gene usage in normal and aberrant (B cell malignancies, autoimmune diseases, etc.) B cell populations.

Chu, C. C. and W. E. Paul (1998). "Expressed genes in interleukin-4 treated Bcellsidentified by cDNA representational differenceanalysis." Molecular Immunology 35(8): 487.

http://www.sciencedirect.com/science/article/B6T9R-3VS7KGS-7/2/e9c0bc6d725535c05602f3ff8b0113cc

Interleukin-4 (IL-4) stimulates B cell growth and differentiation, such asinducingmature B cells to

switch to IgG1 and IgE production. To further characterize IL-4effects on Bcells, we used a sensitive PCR-based subtraction approach to isolate genes expressedin IL-4treated cells. Our approach combined an adaptation of the genomic representationaldifferenceanalysis (RDA) method to cDNA analysis with a physical separation method(magnetic beaddepletion). This cDNA RDA technique allowed us to perform subtraction on therelatively smallnumber of highly, characterized, purified B cells that can be convenientlyprepared. In the hopesof removing genes responsible for general cell growth, we subtractedcDNA made fromlipopolysaccharide (LPS)-stimulated B cells from cDNA from LPS+IL-4stimulated B cells.Two rounds of subtraction resulted in greater than 100-fold enhancement ofexpectedIL-4-induced C[gamma]1 cDNA. At that point, we cloned this subtraction library and analysed154randomly picked clones for sequence similarities. From these clones, 37 individual geneswereobtained. Most of these genes (30) could be functionally identified by sequence similarity.Theseincluded genes encoding C[gamma]1 (1), cytoskeletal components (4) and products involved inDNAreplication (3), metabolism (5), signal transduction (4), transcription (4), translation (6)andtransport (3). Only 7 genes had no similarity to known sequences in the GenBank, EMBLorSwiss Prot databases. One unknown gene (designated Fig1 for IL-Four InducedGene1) and one gene with homology to the human transcription factor E4BP4 were confirmedbyNorthern blot analysis to be induced 10-20-fold by IL-4 treatment. This list of expressedgenesin LPS+IL-4 treated B cells may shed further insight on the action and mechanism ofIL-4stimulation of cells.

De Jonge, J., J. Brissinck, et al. (1995). "Production and characterization of bispecific single-chain antibody fragments." Molecular Immunology 32(17-18): 1405.

http://www.sciencedirect.com/science/article/B6T9R-3YKM941-D/2/c65a23570a406a7aa010afbd03567de6

We report the construction, expression and purification of a bispecific single-chain Fv antibody fragment produced in Escherichia coli. The protein possesses a dual specificity: the single-chain FvB1 portion is directed to the Idiotype of BCL1 lymphoma cells, the single-chain Fv2C11 moiety binds to the CD3 marker on T cells. The two domains are joined by a flexible peptide linker. Using Immobilized Metal Affinity Chromatography, the recombinant protein was purified from bacterial insoluble membrane fractions. After refolding of the bispecific protein, it was affinity-purified. As demonstrated by flow cytometry, both binding sites are retained in the refolded protein. Retargeted cytotoxicity and T cell proliferation assays further prove the biological activity and specificity of the bispecific single-chain Fv. Thus, these bispecific molecules show a potential anti-tumor activity.

Delgado-Cervino, E., G. Fontan, et al. (2005). "C5 complement deficiency in a Spanish family: Molecular characterization of the double mutation responsible for the defect." Molecular Immunology 42(1): 105.

http://www.sciencedirect.com/science/article/B6T9R-4D39YGS-2/2/6a66908554ddc4cbd4489fb02eee4749

The complement C5 deficiency is a recessive autosomal defect associated with recurrent infectious episodes, generally caused by Gram-negative micro-organisms. To date, only two mutations responsible for C5 deficiency have been characterized, both in heterozygosis.In this paper, we evaluate by immunochemical methods the C5 deficiency in a six-member family, in which one member suffered from meningococcal sepsis and several pneumonia episodes; and a second one with two bacterial meningitis episodes and frequent tonsillitis, pneumonia and herpetic episodes. We also characterize the molecular basis of this deficiency.No C5 protein was found in the serum from three of the children. They were found to be homozygous for a double

mutation in the exon 40 of the C5 gene. The parents and the other children have half-normal levels of C5, and they were heterozygotes for the double mutation.This mutation modifies the reading frame, leading to a premature stop codon, and the resulting protein lacks 50 amino acids. As a result, homozygotes and heterozygotes have a total or a partial C5 deficiency respectively. This is the first report of a whole molecular characterization of C5 deficiency.

Duber, S., H. Engel, et al. (2003). "Germline transcripts of immunoglobulin light chain variable regions are structurally diverse and differentially expressed." Molecular Immunology 40(8): 509.

http://www.sciencedirect.com/science/article/B6T9R-49NXFW9-2/2/5f591eca774e5a72921731bc4f4478f5

The murine pre-B cell line R2-bfl, which can be induced to differentiate in vitro, was used to study germline transcription of variable regions of the light chain loci. RNA from these cells was subjected to a 3'-RACE and germline transcripts from 17 individual V[kappa] gene segments belonging to 12 V[kappa] families were characterized. Germline transcripts of all three V[lambda] regions were similarly analyzed. The synchronous differentiation of R2-bfl cells was then used to investigate the order of appearance of germline transcripts of the V and JC clusters of both light chain loci. This was taken as indicator for accessibility of a particular locus to rearrangement. Germline transcripts of the JC[kappa] cluster and the V[kappa] family most proximal to JC[kappa] was detectable already at day 0, while transcripts of the most distal V[kappa] family became apparent after initiation of differentiation at day 1. Transcripts of the JC[lambda] cluster could be found at day 2, whereas transcripts of the V[lambda] region were already present at day 1. Thus, the [lambda] locus becomes accessible to rearrangement later during development than [kappa], confirming and extending our previous findings. The V and JC clusters open at the same stage of development although slight asynchronicities were found for the V[lambda] and the distal V[kappa] gene segments.

Duenas, M., A.-C. Malmborg, et al. (1996). "Selection of phage displayed antibodies based on kinetic constants." Molecular Immunology 33(3): 279.

http://www.sciencedirect.com/science/article/B6T9R-3VXNH65-6/2/ad9122b1eaa05721972a0bb4b86dc239

The display of antibody fragments on the surface of filamentous bacteriophages and the selection of binders from antibody libraries have provided powerful tools to generate human antibodies. We reported recently a new concept (SAP system) for the selection of specific phages by linking antigenic recognition and phage replication, using a soluble fusion protein containing the antigen and a fragment of the M13 coat protein 3. In this investigation, a model library has been composed using six different antibody fragments which were characterized individually regarding their kass, kdiss and Ka. All Fab fragments were specific for a 15 amino acid region of the V3 loop of gp120 (HIV-1). We demonstrated that the SAP system could discriminate between the kinetic parameters of each clone, using different selection strategies. Phages expressing high affinity clones were selected preferentially using low doses of antigen but clones of lower affinity also could be selected by increasing the antigen concentration or using a preselection procedure. Phages expressing antibody fragment with high association or low dissociation rate constants were retrieved by utilizing short contact times between antigen and antibody or antigen-chase conditions.

Engel, H., H. Ruhl, et al. (2001). "Germ-line transcripts of the immunoglobulin [lambda] J-C clusters in the mouse: characterization of the initiation sites and regulatory elements." Molecular Immunology 38(4): 289.

http://www.sciencedirect.com/science/article/B6T9R-43YH4VJ-4/2/d4dad1a87493936fa0aff19b34d5f134

Transcription of unrearranged immunoglobulin gene segments strongly correlates with their accessibility to the V(D)J recombination machinery. The regulatory mechanisms governing this germ-line transcription are still poorly defined. In order to identify new regulatory elements, we first carried out a detailed characterization of the transcription initiation sites for the J-C germ-line transcripts, using rapid amplification of 5' cDNA ends, assisted by a template switching mechanism at the 5'-end of the RNA. Transcripts were observed that initiated heterogeneously, starting up to 293 ([lambda]1), 116 bp ([lambda]2) and 79 bp ([lambda]3) upstream from the respective J[lambda] gene segment. Additional RT-PCR analysis revealed the existence of germ-line transcripts of [lambda] and also of [kappa] that initiate even more upstream of these transcription initiation sites, although their frequencies were low. Promoter activity was detected in vitro 5' of J[lambda]2, with the minimal promoter activity mapping to the region between positions -35 and -120. In addition, computer analysis allowed the prediction of a nuclear scaffold/matrix attachment (S/MAR) region between the two J-C gene clusters at each hemi-locus. This region between the [lambda]1/[lambda]3 clusters binds to the nuclear matrix in vitro, and J-C [lambda]1 germ-line transcription initiates a short distance downstream from this S/MAR element.

Evans, M. J., S. A. Rollins, et al. (1995). "In vitro and in vivo inhibition of complement activity by a single-chain Fv fragment recognizing human C5." Molecular Immunology 32(16): 1183.

http://www.sciencedirect.com/science/article/B6T9R-3YKM94S-M/2/236cb667619cb911f4436d986d360267

Complement activation has been implicated in the pathogenesis of several human diseases. Recently, a monoclonal antibody (N19-8) that recognizes the human complement protein C5 has been shown to effectively block the cleavage of C5 into C5a and C5b, thereby blocking terminal complement activation. In this study, a recombinant N19-8 scFv antibody fragment was constructed from the N19-8 variable regions, and produced in both mammalian and bacterial cells. The N19-8 scFv bound human C5 and was as potent as the N19-8 monoclonal antibody at inhibiting human C5b-9-mediated hemolysis of chicken erythrocytes. In contrast, the N19-8 scFv only partially retained the ability of the N19-8 monoclonal antibody to inhibit C5a generation. To investigate the ability of the N19-8 scFv to inhibit complement-mediated tissue damage, complement-dependent myocardial injury was induced in isolated mouse hearts by perfusion with Krebs-Henseleit buffer containing 6% human plasma. The perfused hearts sustained extensive deposition of human C3 and C5b-9, resulting in increased coronary artery perfusion pressure, end-diastolic pressure, and a decrease in heart rate until the hearts ceased beating approximately 10 min after the addition of plasma. Hearts treated with human plasma supplemented with either the N19-8 monoclonal antibody or the N19-8 scFv did not show any detectable changes in cardiac performance for at least 1 hr following the addition of plasma. Hearts treated with human plasma alone showed extensive deposition of C3 and C5b-9, while hearts treated with human plasma containing the N19-8 scFv showed extensive deposition of C3, but no detectable deposition of C5b-9. Administration of a 100 mg bolus dose of N19-8 scFv to rhesus monkeys inhibited the serum hemolytic activity by at least 50% for up to 2 hr. Pharmacokinetic analysis of N19-8 scFv serum levels suggested a two-compartment model with a T1/2[alpha] of 27 min. Together, these data suggest the recombinant N19-8 scFv is a potent inhibitor of the terminal complement cascade and may have potential in vivo applications where short duration inhibition of terminal complement activity is desirable.

Fayen, J., J.-H. Huang, et al. (1995). "Class I MHC alpha 3 domain can function as an independent structural unit to bind CD8[alpha]." Molecular Immunology 32(4): 267.

http://www.sciencedirect.com/science/article/B6T9R-3YKM9C5-57/2/77ee6f49ed8b8d57f96ffcc3a048a733

Functional interactions between CD8-dependent cytotoxic T cells and their targets require physical contact between CD8 and a non-polymorphic determinant on the [alpha]3 domain of the class I MHC molecule. We developed a cell-free assay to directly monitor this molecular interaction, specifically excluding the participation of other cellular proteins and lipids. This assay employed a soluble CD8 derivative and a plate-bound HLA-A2.1 derivative, [alpha]3/MalE, in which the [alpha]3 domain has been expressed independently of its neighboring polypetide domains on the native class I MHC molecule and [beta]2-microglobulin ([beta]2-m). These proteins were produced using eukaryotic and prokaryotic expression systems, respectively. Our data demonstrated specific, saturable binding between soluble CD8[alpha] (sCD8[alpha]) and [alpha]3/MalE, and the Kd of this interaction was determined to be 4.5 x 10-7 M. Monoclonal antibodies (mAb) directed against either CD8 or the [alpha]3 domain of class I MHC inhibited binding; mAb directed against other sites on class I MHC and [beta]2-m did not. Our data suggest that the interaction between CD8[alpha] and the [alpha]3 domain of class I MHC does not require the participation of neighboring class I sequences or [beta]2-m.

Garlisi, C. G., K. J. Pennline, et al. (1993). "Cytokine gene expression in mice undergoing chronic graft-versus-host disease." Molecular Immunology 30(7): 669.

http://www.sciencedirect.com/science/article/B6T9R-476F814-CT/2/484a90c634d7d87d0aeb7f5d81695561

Chronic graft-versus-host disease (GVHD) can be induced in B6D2F1 mice by injection of parental DBA/2 lymphoid cells. Stimulation of donor T cells by host MHC antigens leads to the stimulation of host B cells. Little is known of the lymphokines produced during such a reaction. This study was designed to directly measure the levels of mRNA for interferon-gamma (IFN-[gamma]), interleukin 2 (IL-2), IL-4, IL-5, and IL-10, as well as several other genes, using semiquantitative polymerase chain reaction (PCR). Semiquantitative PCR was reproducible and signals generated were dependent on the amount of specific RNA or cDNA in each reaction. Early during the progression of GVHD (2 days after the first injection of parental cells) there was little increase in IL-10 mRNA, a slight increase in IL-4 mRNA, and a dramatic increase in IL-2 mRNA. In addition, IL-2 bioactivity was demonstrated in supernatants from GVH splenocytes cultured in vitro for 24 h. Later in the response (1 week after the second and final injection of parental cells) IL-4 mRNA levels were elevated as they were earlier while IL-10 mRNA levels were dramatically increased. IL-2 mRNA levels were no different in mice undergoing GVHD than in normal mice at this time. IFN-[gamma] mRNA was detectable both early and late, although at similar levels in normal mice and mice undergoing GVHD. At both times examined, IL-4 was below the limits of detection by bioassay and IFN-y, IL-4, IL-5 and IL-10 were below the limits of detection by ELISA. Further studies showed that a majority of the IL-4 and IL-10 mRNA found elevated in GVH mice were produced by Thy1.2+ T cells, with small amounts from B220+ B cells. In addition, the detectable IFN-[gamma] mRNA found in GVH mice at this later time also was produced by Thy1.2+ T cells, with small amounts from B220+ B cells.

Gerritsma, J. S. J., A. F. Gerritsen, et al. (1996). "Interleukin-1[alpha] enhances the biosynthesis of

complement C3 and factor B by human kidney proximal tubular epithelial cells in vitro." Molecular Immunology 33(10): 847.

http://www.sciencedirect.com/science/article/B6T9R-3W3NC30-2/2/bccf62f4675878f38b8728d982c6cabd

Local production in tubular cells of complement has been shown to occur in several kidney diseases by in situ hybridization, but the regulation at the local site during an inflammation is still unknown. In the present study, we demonstrate that human proximal tubular epithelial cells (PTEC) are able to produce complement components C3 and Factor B under non-stimulated conditions in vitro. The basal production of both was increased by 0.5 ng/ml interleukin-1[alpha] (IL-1[alpha]) for C3: from 95.5 +/- 4.0 ng/106 cells to 416.5 +/- 4.9 ng/106, and for Factor B: from 271 +/- 7.0 ng/106 cells to 457.5 +/- 7.0 ng/106 cells. In contrast cytokines such as TNF-[alpha], IFN-[gamma], IL-10 and IL-15 had no detectable effect. The upregulation by IL-1[alpha] was dose- and time-dependent. The response to IL-1[alpha] was shown to be mediated via the IL-1 receptor, as the addition of recombinant interleukin-1 receptor antagonist inhibited the IL-1[alpha] induced complement production by more than 80%. IL-1[alpha] enhanced mRNA expression of both C3 and Factor B as demonstrated by RT-PCR and dot-blot analysis. This indicated that IL-1[alpha] upregulated the expression of the C3 and Factor B at the transcriptional level. We hypothesize that in vivo the production of C3 and Factor B at the local site during an inflammatory response in the kidney may be regulated by IL-1[alpha] produced by inflammatory cells.

Glas, A. M., S.-C. Huang, et al. (1999). "Motif-specific probes identify individual genes and detect somatic mutations." Molecular Immunology 36(9): 599.

http://www.sciencedirect.com/science/article/B6T9R-3X3K84V-C/2/914ff9f0ecaf9d5375370c74ef007601

This report describes the correlation between motif-specific hybridization and necleotide sequence as an approach to the identification of individual human VH genes using motif-specific oligonucleotide probes, complementary to specific motifs within individual VH genes. The sensitivity of the hybridization and post washing processes permits discrimination of single nucleotide differences between probe and target. This feature is used both to identify individual genes, as well as to detect mutations in genes by sequential hybridization with multiple probes. In addition to the general strategy, specific details are provided for the identification of 12 VH3 genes and 14 VH4 genes.

Goetz, F. W., D. B. Iliev, et al. (2004). "Analysis of genes isolated from lipopolysaccharide-stimulated rainbow trout (Oncorhynchus mykiss) macrophages." Molecular Immunology 41(12): 1199.

http://www.sciencedirect.com/science/article/B6T9R-4CX00DG-6/2/d407318e2c79792bab9fc991fe9f67d0

A primary cell culture system was used to obtain differentiated rainbow trout (Oncorhynchus mykiss) macrophages that were stimulated with Escherichia coli lipopolysaccharide (LPS-10 [mu]g/ml) for 12 h in vitro. Messenger RNA from the LPS-stimulated cells was used to create two cDNA libraries from which a total of 1048 sequences were analyzed. A large number of cDNAs were obtained that could be related to immune function including structural proteins, proteases and antiproteases, regulators of transcription and translation, cell death regulators, receptors, lectins and immunoglobulins, cytokines and chemokines, cell surface antigens, signal transduction proteins, antimicrobial peptides, and enzymes involved in eicosanoid synthesis.

Selected genes that were analyzed by RT-PCR and real time PCR and found to be upregulated by LPS, included vascular cell adhesion molecule, the CCAAT/enhancer binding protein [beta], the inhibitor of NF-kB [alpha], CD209, a major histocompatibility class II-invariant chain protein, cyclin L1, acute phase serum amyloid A, and prostaglandin endoperoxide synthase 2.

Harmsen, M. M., R. C. Ruuls, et al. (2000). "Llama heavy-chain V regions consist of at least four distinct subfamilies revealing novel sequence features." Molecular Immunology 37(10): 579.

http://www.sciencedirect.com/science/article/B6T9R-423J9MV-D/2/3d258e477290b8170df37edebedc63b9

In addition to conventional antibodies (Abs), camelids possess Abs consisting of only heavy chains. The variable domain of such a heavy-chain Ab (VHH) is fully capable of antigen (Ag) binding. Earlier analysis of 47 VHHs showed sequence features unique to VHH domains. These include the presence of characteristic amino acid substitutions in positions which, in conventional VH domains are involved in interdomain interactions, and the presence of a long third complementarity-determining region (CDR3) which is frequently constrained by an interloop disulphide bond. Here, we describe a large (152) set of Lama glama VHH cDNAs. Based on amino acid sequence similarity, these and other published camelid VHHs were classified into four subfamilies. Three subfamilies are absent in dromedaries, which have been the primary source of VHHs thus far. Comparison of these subfamilies to conventional VH regions reveals new features characteristic of VHHs and shows that many features earlier regarded as characteristic of VHHs in general are actually subfamily specific. A long CDR3 with a concomitant putative additional disulphide bond is only observed in two VHH subfamilies. Furthermore, we identified new VHH-characteristic residues at positions forming interdomain sites in conventional VH domains. The VHH subfamilies also differ from each other and conventional VH domains in the canonical structure of CDR1 and CDR2, mean CDR3 length, and amino acid residue variability. Since different VHH-characteristic residues are observed in all four subfamilies, these subfamilies must have evolved independently from classical VH domains.

Haruta, H., H. Tachibana, et al. (1999). "Serum starvation induced secondary V[lambda]J[lambda] rearrangement in a human plasma B cell line." Molecular Immunology 36(3): 177.

http://www.sciencedirect.com/science/article/B6T9R-3WNMGP5-3/2/a4f7ce64eeef04a3448b655607a5d9c4

HB4C5 is a human antibody producing plasma B cell line that expresses the recombination activating gene-1 (RAG-1) and RAG-2 constitutively, but undergoes few secondary immunoglobulin gene rearrangements when cultured in fetal bovine serum-containing medium. Here, we found that depletion of serum from the culture media induces secondary V[lambda]J[lambda] rearrangement in this cell line. To investigate the induction mechanism of secondary V[lambda]J[lambda] rearrangement, we assessed the expression levels of RAG-1 and RAG-2 products, V[lambda] germline transcription level and the amount of V[lambda] signal broken ends (SBE) in HB4C5 cells cultured in serum-supplemented or serum-free medium. Western-blot analysis showed that the expression level for the RAG-1 and RAG-2 proteins was not affected by the serum depletion. V[lambda] germline transcript was found to be constitutively expressed in HB4C5 cell line and this transcription level was not affected by the lack of serum. On the other hand, the amount of V[lambda] SBE was shown to be increased in HB4C5 cells cultured in serum-free medium, suggesting that this increased formation of V[lambda] SBE at least partly contributed to the enhanced occurrence of secondary V[lambda]J[lambda] rearrangement in HB4C5 cells cultured in the serum-free condition. These results indicate that expression of RAG proteins and V[lambda] germline transcription is not enough to undergo

secondary V[lambda]J[lambda] rearrangement in this cell line.

Hexham, J. M., D. Dudas, et al. (2001). "Influence of relative binding affinity on efficacy in a panel of anti-CD3 scFv immunotoxins." Molecular Immunology 38(5): 397.

http://www.sciencedirect.com/science/article/B6T9R-448BFWG-8/2/0a3bb431e521d910f1cbee2984b51cb8

The in vitro cell killing potency of an immunotoxin reflects the aggregate of several independent biochemical properties. These include antigen binding affinity; internalization rate, intracellular processing and intrinsic toxin domain potency. This study examines the influence of antigen binding affinity on potency in various immunotoxin fusion proteins where target antigen binding is mediated by single chain antibody variable region fragments (scFv). Firstly, the relationship between affinity and potency was examined in a panel of four scFv immunotoxins generated from different anti-CD3 monoclonal antibodies fused to the 38 kDa fragment of Pseudomonas aeruginosa exotoxin A (PE38). Of these four scFv-PE38 immunotoxins, the one derived from the anti-CD3 monoclonal antibody UCHT1 has highest cell killing potency. Analysis of these four scFv-PE38 immunotoxins indicated a correlation between antigen binding affinity and immunotoxin potency in the cell killing assay with the exception of the scFvPE38 immunotoxin derived from the antibody BC3. However this scFv appeared to suffer a greater drop in affinity (~100 x), relative to the parent Mab than did the other three scFvs used in this study (2-10 x). Secondly, the scFv(UCHT1)-PE38 immunotoxin was then compared with a further panel of scFv(UCHT1)-derived immunotoxins including a divalent PE38 version and both monovalent and divalent Corynebacterium diphtheriae toxin (DT389) fusion proteins. When the scFv-UCHT1 domain was amino-terminally positioned relative to the toxin, as in the scFv(UCHT1)-PE38, an approximately 10-fold higher antigen-binding affinity was observed than with the C-terminal fusion, used in the DT389-scFv(UCHT1) molecule. Despite this lower antigen-binding activity, the DT389-scFv immunotoxin had a 60-fold higher potency in the T-cell-killing assay. Thirdly, a divalent form of the DT389-scFv construct, containing tandem scFv domains, had a 10-fold higher binding activity, which was exactly reflected in a 10-fold increase in potency. Therefore, when comparing immunotoxins in which scFvs from different antibodies are fused to the same toxin domain (DT or PE) a broad correlation appears to exist between binding affinity and immunotoxin potency. However, no correlation between affinity and potency appears to exist when different toxin domains are combined with the same scFv antibody domain.

Hildebrand, W. H., R. M. Horton, et al. (1992). "Nucleotide sequence analysis of H-2Df and the spontaneous in vivoH-2Dfm2 mutation." Molecular Immunology 29(1): 61.

http://www.sciencedirect.com/science/article/B6T9R-476F92G-SK/2/91261c1600604a210ec4faab2eb5efa6

The nucleotide sequence of the standard H-2Df allele and the spontaneous in vivoH-2Dfm2 mutation are reported here. Locus-specific sequences in the 5' and 3' untranslated regions of the mouse MHC class I H-2D-region genes were used to design primers for the specific amplification and cloning of H-2D-region cDNA from standard B10.M/Sn H-2f and mutant BIO.M-H-2fm2/Mob mice. A partial Df genomic clone and direct Df and Dfm2 mRNA sequence analysis confirmed the authenticity of the cDNA clones. Interestingly, H-2Df contains a proline in the [alpha]-helix of the [alpha] 1 domain at amino acid position 62; no other known class I molecule has a proline at this position. The H-2Dfm2 mutation, however, replaces this unique proline in Df with the H-2 and HLA consensus arginine at position 62. Although a point mutation cannot be ruled out, the single nucleotide change in the H-2Dfm2 mutation is flanked by a stretch of 47 nucleotide bases with an identical counterpart in H-2Kf, a finding consistent with a recombinatorial event between H-2Kf

and H-2Df.

Hohman, V. S., S. E. Stewart, et al. (1997). "Sequence and expression pattern of J chain in the amphibian, Xenopus laevis." Molecular Immunology 34(14): 995.

http://www.sciencedirect.com/science/article/B6T9R-3S84H6J-3/2/5a1aa3434e026704c80bd0d3381cf918

We have determined the cDNA sequence encoding J chain, a polypeptide accessory molecule associated with polymeric Ig, from the anuran amphibian, Xenopus laevis (South African clawed frog). The translated polypeptide consists of 164 amino acid residues, including the signal sequence, and is somewhat longer than the corresponding sequence in mouse and cow, the two mammalian species in which the signal sequence of J chain has been determined. J chain in several mammalian species (human, mouse, cow and rabbit) has eight Cys residues. In the human chain, two of these Cys residues, the second and third in the sequence, have been shown to form disulfide bridges to heavy chains in IgM or IgA; the remaining Cys residues form intrachain disulfide bonds. The Xenopus J chain contains only seven of these Cys residues. Ser is found at the position corresponding to the third Cys in mammalian J chains. Northern blot analysis, performed on RNA isolated from various organs of 3-month old frogs, indicated that the highest level of expression was in the intestine. Transcripts corresponding to J chain were also detected in the spleen and at very low levels in the thymus.

Honda, T., T. Nishizawa, et al. (2005). "Molecular cloning and expression analysis of a macrophage-colony stimulating factor receptor-like gene from rainbow trout, Oncorhynchus mykiss." Molecular Immunology 42(1): 1.

http://www.sciencedirect.com/science/article/B6T9R-4D5KRGS-1/2/9b125861dfd893a238d982563a2059ee

The M-CSF and its receptor (M-CSFR, CSF-1R or c-fms proto-oncogene) system were initially implicated as essential in mammals for normal monocyte development as well as for pregnancy. To allow a comparison with the M-CSF and M-CSFR system of an oviparous animal, we cloned a M-CSFR-like gene from rainbow trout (Oncorhynchus mykiss). The gene was cloned from a cDNA library of head kidney. It contained an open reading frame encoding 967 amino acids with a predicted size of 109 kDa. The putative amino acid sequence of rainbow trout M-CSFR showed 54% amino acid identity to fugu (Takifugu rubripes) M-CSFR, 52% to zebrafish (Danio rerio) M-CSFR and 40% to mouse (Mus musculus) and human (Homo sapiens) M-CSFR. The M-CSFR-like gene was constitutively expressed in head kidney, kidney, intestine, spleen and blood. The gene was detected especially in the ovary of immature female rainbow trout. These results suggest that a M-CSFR-like receptor may be involved in female reproductive tracts even in an oviparous animal like fish.

Irigoyen, M., C. Kowal, et al. (1996). "Molecular mapping of the 8.12 sle-associated idiotype specificity at the single amino acid level." Molecular Immunology 33(16): 1255.

http://www.sciencedirect.com/science/article/B6T9R-3W3FCV0-P/2/48a058283ecf18134665d24e70ef259d

The 8.12 idiotype is expressed in elevated titer in the serum of patients with systemic lupus

erythematosus and is a marker for a subpopulation of anti-DNA antibodies that possess a V[lambda]II encoded light chain. This study utilized a eukaryotic expression system to identify the structural basis for expression of this idiotype. Reversion of the 8.12+ DSC light chain to the hs1v215.23/DPL11 germline gene reveals that the 8.12 idiotype is encoded in the germline. The 8.12+ DSC and the 8.12- AS17 light chains, both belonging to the V[lambda]II family, were subjected to site directed mutagenesis, to localize amino acids important for expression of the 8.12 idiotype. Point mutations were performed in CDR1, CDR2, FR3 and CDR3, in positions where the 8.12+ DSC differs from the 8.12- AS17. Amino acids in CDR1 and the CDR2 proximal region of FR3, but not the J proximal region of CDR3, play a crucial role in 8.12 reactivity. The 3-D structure of Mcg, a human IgG1, with which DSC shares a sequence homology of 92.3% has been examined to visualize the effect of each of the mutations and to identify the surface on DSC that comprises the idiotype.

Ji, Y., S. Desravines, et al. (1999). "Junctional diversity in Xenopus immunoglobulin light chains." Molecular Immunology 36(17): 1159.

http://www.sciencedirect.com/science/article/B6T9R-3YCM594-4/2/553c04f359afb559d4b7595b8fed1375

Xenopus cDNA sequences encoding the homolog of mammalian kappa ([kappa]) light (L) chains were isolated from isogenic tadpole and adult individuals to investigate whether there existed stage-specific immunoglobulin L chain expression and somatic diversification. In the course of these studies rearrangements to a sixth JL gene segment and a pseudogene (JL[psi]) were found, and it is suggested that the order of these gene segments with respect to the L chain constant (C) region exon is: JL6-JL1-JL2-JL3-JL4-JL5-JL[psi]-CL. The cDNA junctional diversity was analyzed; few N and P regions were found and almost all the CDR3 were 9 codons in length. There were restricted patterns of recombination site resolution, and this is attributed to some constraint in JL coding end processing.

Kimura, T., T. Hosoi, et al. (2000). "Epitope mapping of monoclonal antibodies specific for a macrophage lectin: a calcium-dependent epitope is in the carbohydrate recognition domain." Molecular Immunology 37(3-4): 151.

http://www.sciencedirect.com/science/article/B6T9R-40J1DSX-7/2/6b53b75769203f5a1a3442c4dbab2300

Mouse macrophage galactose/N-acetylgalactosamine-specific calcium-type lectin (mMGL) has a calcium-dependent conformational epitope which is a ligand-induced binding site. A monoclonal antibody (mAb) specific for this epitope (LOM-11) stabilize lectin activity. We performed mapping for this conformational epitope using trypsin fragments that contain a carbohydrate recognition domain (CRD) and chimeric recombinant proteins between mMGL and a human counterpart of this molecule. Binding site for the mAb LOM-11 was mapped within the C-terminal 59 amino acids of CRD. Binding sites for all four mAbs that block carbohydrate ligand binding were also mapped in the C-terminal half of CRD. These results indicated that the calcium-dependent site potentially involved in protein-protein interaction, regulatory or for coordinated binding, is mapped within CRD in addition to the independent carbohydrate binding site, and that both of the distinct sites may have spatial proximity.

Larsen, J. N., P. Stroman, et al. (1992). "PCR based cloning and sequencing of isogenes encoding the

tree pollen major allergen Car b I from Carpinus betulus, hornbeam." Molecular Immunology 29(6): 703.

http://www.sciencedirect.com/science/article/B6T9R-476F8Y3-PR/2/4fd27350e93ca14843bf20903905eecd

Cloning of the gene encoding the major allergen, Car b I, from Carpinus betulus (hornbeam) pollen was performed using the Polymerase Chain Reaction (PCR) to specifically amplify the gene of interest using single stranded cDNA as template. Specific primers, deduced from the aminoterminal sequence of the purified protein, were tailored to facilitate direct expression of plasmic clones, and the large fraction of positive clones obtained, revealed the presence of isogenic variation.Three clones were characterized in detail by antibody based assays and nucleotide sequencing. The recombinant allergens were shown by crossed immunoelectrophoresis (CIE) to precipitate with monospecific polyclonal rabbit antibodies raised against purified Bet v I, by crossed radioimmuno-electrophoresis (CRIE) to bind tree pollen allergic patient serum IgE, and by immunoblotting to bind murine monoclonal antibodies, raised against purified Car b I from pollen.Car b I is encoded by a 159-triplets open reading frame. The molecular masses (Mr = 17272, 17355 and 17217 Da, respectively), the amino acid composition, and the aminoterminal sequence of the predicted polypeptides agree well with data obtained by analysis of the protein purified from pollen.The deduced amino acid sequences show pronounced homology (73, 75 and 74% identities respectively) to Bet v I, the major allergen from Betula verrucosa (white birch) pollen.Soluble recombinant Car b I, without a fusion partner, was produced in Escherichia coli with an immunochemical reactivity closely resembling that of the native pollen allergen. The tree pollen major allergens therefore constitute an ideal system for the study of allergenic epitopes.

Leung, S.-o., D. M. Goldenberg, et al. (1995). "Construction and characterization of a humanized, internalizing, B-cell (CD22)-specific, leukemia/lymphoma antibody, LL2." Molecular Immunology 32(17-18): 1413.

http://www.sciencedirect.com/science/article/B6T9R-3YKM941-F/2/a131d152e333c7db2be85fd30125b8c3

The murine monoclonal antibody, LL2, is a B-cell (CD22)-specific IgG2a which has been demonstrated to be clinically significant in the radioimmunodetection of non-Hodgkin's B-cell lymphoma. The antibody carries a variable region-appended glycosylation site in the light chain, and is rapidly internalized upon binding to Raji target cells. Humanization of LL2 was carried out in order to develop LL2 as a diagnostic and immunotherapeutic suitable for repeated administration. Based on the extent of sequence homology, and with the aid of computer modeling, we selected the EU framework regions (FR) 1, 2 and 3, and the NEWM FR4 as the scaffold for grafting the heavy chain complementarity determining regions (CDRs), and the REI FRs for that of light chains. The light chain glycosylation site, however, was not included. Construction of the CDR-grafted variable regions was accomplished by a rapid and simplified method that involved long DNA oligonuleotide synthesis and the polymerase chain reaction (PCR). The humanized LL2 (hLL2), lacking light chain variable region glycosylation, exhibited immunoreactivities that were comparable to that of chimeric LL2 (cLL2), which was shown previously to have antigen-binding properties similar to its murine counterpart, suggesting that the VK-appended oligosaccharides found in mLL2 are not necessary for antigen binding. Moreover, the hLL2 retained its ability to be internalized into Raji cells at a rate similar to its murine and chimeric counterparts.

Lim, P. L., D. T. M. Leung, et al. (1994). "Structural analysis of a phosphorylcholine-binding antibody

which exhibits a unique carrier specificity for Trichinella spiralis." Molecular Immunology 31(14): 1109.

http://www.sciencedirect.com/science/article/B6T9R-476N7KP-5R/2/aef1fc93d5bb2cb2030ae56434542282

A phosphorylcholine (PC)-binding IgG (Mab2) antibody produced by a hybridoma derived from a BALB/c mouse which had been immunized against Trichinella spiralis was found to bind to the immunizing antigen (TSC) but not to other PC-associated antigens such as pneumococcal antigen (PNC) and PC-conjugated ovalbumin (PC-OVA). Sequence analysis of the protein revealed the presence of a heavy chain (VH) which was very similar (differing in only four amino acids) to that of the M511 myeloma protein, and a light chain (VL) which was completely identical to that of the M167 myeloma protein. Several M511/M167+ proteins, including the prototypic M511 protein and PC-binding proteins of other families (TEPC 15 and W3207), were examined in their binding to the various PC-associated antigens. These were found to be largely indiscriminate although subtle differences were observed for some antigens with some of the antibodies. A comparison of the VH sequences of Mab2 and these proteins revealed that of the differences seen, the single most important substitution in Mab2 which could contribute to the unique specificity of the molecule is the glycine residue at 49H. None of the other proteins, including other PCV-binding proteins published to-date, which utilize the same VH segment (99 in total), has this substitution.

Liu, Y., Y. Endo, et al. "Ficolin A and ficolin B are expressed in distinct ontogenic patterns and cell types in the mouse." Molecular Immunology In Press, Corrected Proof http://www.sciencedirect.com/science/article/B6T9R-4F60N8C-2/2/e8a0b873e1423f76e072cd735fc32c1c

Ficolins are a group of proteins characterized by the presence of collagen-like and fibrinogen-like domains. Two of three human ficolins, L-ficolin and H-ficolin, are serum lectins that form complexes with mannose-binding lectin-associated serine proteases (MASPs) and play important roles in the lectin complement pathway. The other human ficolin, M-ficolin, is a non-serum-type ficolin that is expressed in monocytes. Little is known about the physiological roles of ficolins. In this study, we delineated the ontogeny and cell types that express ficolins in mice. RT-PCR analysis showed that the expression pattern of ficolin A expression was closely similar to that of Masps, suggesting that these molecules may function in coordination as components of the lectin complement pathway. The cell types that express ficolin A mRNA in both adult liver and spleen were identified as macrophages by in situ hybridization. Ficolin B exhibited a distinct ontogeny pattern that switched from embryonic liver to postnatal bone marrow and spleen. The cells that express ficolin B mRNA were identified as belonging to the myeloid cell lineage by magnetic sorting and by subsequent RT-PCR in bone marrow cells. Thus, the different spatial-temporal expression patterns of ficolins A and B suggest that these molecules play distinct roles in the prenatal and postnatal stages.

Louie, K. A., J. Ochoa-Garay, et al. (1996). "H-2Ld-alloreactive T cell hybridomas utilize diverse V[alpha] and V[beta] T cell receptor chains." Molecular Immunology 33(9): 747.

http://www.sciencedirect.com/science/article/B6T9R-3W2YC96-2/2/a42b6126b984fb5af00fcda8951b9381

We have sequenced the TCRs from Ld-specific alloreactive T cell hybridomas, whose reactivities we have found to be quite representative of those of a primary dm2 anti-BALB/cJ mixed

lymphocyte reaction. We find V[beta]6, V[beta]7, V[beta]8 and V[beta]10 gene segments. V[alpha] usage is diverse, although closely related to that from peptide-specific Ld-restricted CTLs. V[alpha]-V[beta] selection provides evidence of preferential pairing. Amino acid frequency analysis shows that the [alpha]CDR2 region is rich in charged amino acids, in contrast to the [beta]CDR2 region. Our data suggests the [beta] chain may be more immunoglobulin-like than the [alpha] chain, and that charge complementarity may be important in TCR-MHC interactions. We do not consider our results to be contradictory to those previously reported but rather they may represent an early, more diverse response.

Mazzucchelli, R., M. Amadio, et al. (2004). "Establishment of an ex vivo model of monocytes-derived macrophages differentiated from peripheral blood mononuclear cells (PBMCs) from HIV-1 transgenic rats." Molecular Immunology 41(10): 979.

http://www.sciencedirect.com/science/article/B6T9R-4CX00BV-2/2/54329d4d1705dbf3eff3c7f932e2f156

It has been developed an HIV type 1 transgenic rat model (HIV-1 Tg Rat) which contains a gag-pol-deleted HIV-1 provirus regulated by the viral LTR promoter. Altought it harbors a non infectious provirus, efficient viral expression occurs in different tissues and disease manifestations as well as immune-response alterations and pathologies similar to humans can be observed. Regulation of HIV-1 expression is influenced by various cellular factors and it is well known that macrophages are one of the major reservoir of HIV-1 infection and a vehicle for virus spread to other tissues. Purpose of our work was to establish an antigen presenting cells (monocyte-derived macrophages, MDM) ex vivo model from these HIV-1 transgenic rats. This model can be used to study function of HIV-infected MDM and their behavior like HIV-1 reservoir. Ultimately, these studies may be helpful in defining approaches to control HIV-1 spread.

McDermott, M. J., E. Weber, et al. (2000). "Identification, cloning, and characterization of a major cat flea salivary allergen (Cte f 1)." Molecular Immunology 37(7): 361.

http://www.sciencedirect.com/science/article/B6T9R-41MB06R-4/2/852d94531cd112cace98f8cb458b2200

An 18 kDa protein isolated from saliva of the cat flea, Ctenocephalides felis, elicits a positive intradermal skin test (IDST) in 100 and 80% of experimental and clinical flea allergic dogs, respectively. Using solid-phase enzyme-linked immuno assay (ELISA), this protein detected IgE in 100 and 80% of experimental and clinical flea allergic dogs, respectively. A cDNA (pFSI) encoding a full-length Cte f 1 protein was isolated from a C. felis salivary gland cDNA library, using a combination of PCR and hybridization screening. This cDNA is 658 bp in length, and contains an open reading frame of 528 bp. The open reading frame encodes a protein of 176 amino acids, consisting of an 18 amino acid signal sequence and a 158 amino acid mature protein. The calculated molecular weight and pI of the mature protein are 18106 Da and 9.3, respectively. The protein, named Cte f 1, is the first novel major allergen described for canine flea allergy. Recombinant Cte f 1 (rCte f 1) was expressed in Escherichia coli, Pichia pastoris and baculovirus infected Trichoplusia ni cells. Approximately, 90% of the rCte f 1 expressed in E. coli accumulated in insoluble inclusion bodies, which could be refolded to a soluble mixture of disulfide isomers with partial IgE binding activity. Small quantities of an apparently correctly refolded form of rCte f 1, which had IgE binding activity equal to the native antigen, was isolated from the soluble fraction of E. coli cells. However, P. pastoris and baculovirus infected insect cells expressed and secreted a fully processed, correctly refolded and fully active form of rCte f 1. Mass spectrometry analysis of the active forms of rCte f 1confirmed that eight intact disulfide bonds were present, matching the number observed in the native allergen. The relative ability of

rCte f 1 to bind IgE in the serum of flea allergic animals, produced in these three expression systems, matched that of the native allergen. Competition ELISA demonstrated that approximately 90% of the specific IgE binding to native Cte f 1 could be blocked by the different forms of rCte f 1.

McKenzie, S. E., M. A. Keller, et al. (1992). "Characterization of the 5'-flanking transcriptional regulatory region of the human Fc[gamma] receptor gene, Fc[gamma] RIIA." Molecular Immunology 29(10): 1165.

http://www.sciencedirect.com/science/article/B6T9R-476F8VT-P6/2/ea05ad0fd81ee1363994365d7316a3ff

The human Fc[gamma] receptor gene Fc[gamma] RIIA is expressed in platelets, neutrophils, monocytes and macrophages. Understanding the regulation of expression of Fc[gamma] RIIA will enhance our knowledge of regulated gene expression and immune function m these cells. We cloned a 3.65 kb region of the 5' end of the Fc[gamma] RIIA gene and characterized 3.4 kb of previously unreported sequence of the 5'-flanking region. Primer extension studies and RNase protection analyses of mRNA from HEL, K562 and U937 cells revealed multiple transcription start sites. One transcription start site mapped to a 5'-untranslated (5'UT) exon approximately 1 kb 5' to the ATG translation initiation codon, while a second start site mapped near the ATG codon. Reverse transcription combined with PCR (RT-PCR) employing an oligonucleotide m the putative 5'UT exon and an antisense oligonucleotide in the translated region yielded products which confirm that transcription starts in this 5'UT exon 881 bp upstream of the ATG codon. Sequence analysis of the RT-PCR products showed two related RNA splice products which use alternative 3'-consensus AG splice acceptor sites. Fc[gamma] RIIA mRNA thus has three distinct potential 5'UT regions, two alternatively spliced forms from the start site in the 5'UT exon and the third from the start site near the ATG codon. Comparisons of the human Fc[gamma] RIIA 5'-flanking region whith human Fc[gamma] RI and miouse Fc[gamma] RII[beta] genes as well as with other genes expressed in megakaryocytes, neutrophils and monocytes reveal structural similarities and shared promoter elements.

Nye, S. H., C. M. Pelfrey, et al. (1995). "Purification of immunologically active recombinant 21.5 kDa isoform of human myelin basic protein." Molecular Immunology 32(14-15): 1131.

http://www.sciencedirect.com/science/article/B6T9R-3YKM95C-1G/2/acebd3809819e1cd467d8f2edfd52a47

We have designed and expressed in bacteria a recombinant fetal form of human myelin basic protein (21.5 kDa isoform; rhMBP21.5), a candidate aitoantigen in multiple sclerosis. An exon 2 insertion, carboxy-terminal histidine tag and preferred bacterial codons differentiate the MBP21.5 gene from that encoding the adult, brain-derived form of human MBP (18.5 kDa isoform; hMBP18.5). MBPs were expressed at high levels in E. coli and extracted from whole cells by simultaneous acid solubilization and mechanical disruption. A nearly two-fold increase in recombinant protein was detected in strains harboring MBP genes with bacterial preferred codons compared to genes containing human codons. The recombinant molecules were purified in two steps, first by reversed-phase chromatographic separation and then by metal affinity chromatography. Dimeric forms of recombinant MBP21.5 were detected under physiological conditions, however, substitution of a serine for the single cysteine at amino acid residue 81 resulted in only monomer formation. All forms of recombinant MBPs induced proliferative responses of human T lymphocytes specific for epitopes in MBP18.5 kDa. In contrast, human T cell lines that recognize an exon 2-encoded epitope of MBP responded to the 21.5 kDa isoform of MBP, but not the 18.5 kDa isoform.

Ohlin, M. and C. A. K. Borrebaeck (1998). "Insertions and deletions in hypervariable loops of antibody heavy chains contribute to molecular diversity." Molecular Immunology 35(4): 233.

http://www.sciencedirect.com/science/article/B6T9R-3W1RG0F-5/2/19248871758071a9ac32a653c3ef3fb1

Antibody diversity, a molecular feature which allows these proteins to specifically interact with a diverse set of targets, is created at the genetic level by a variety of means. These include germline gene segment recombination, junctional diversity and single basepair (bp) substitution. We here demonstrate that a human high affinity antibody specific for an exogenous protein antigen carry three amino acid residues immediately adjacent to the first hypervariable loop of the heavy chain. These additional residues are shown not to be encoded by the germline repertoire. We also describe the characteristics of insertions and deletions, not found in any known germline sequence, within the first and second hypervariable loops of other previously described antibody-encoding genes. These findings demonstrate that insertions or deletions of entire codons provide yet another approach by which the human antibody repertoire is diversified in vivo. Since these major genetic modifications occur within or immediately adjacent to loops contributing to the antigen-binding site, they are likely to affect the binding properties of the mutated antibodies.

Press, J. L., C. A. Giorgetti, et al. (1991). "A new germline VH36-60 gene is used in the neonatal primary and adult memory response to (T,G)-A--L." Molecular Immunology 28(11): 1217.

http://www.sciencedirect.com/science/article/B6T9R-476F6XV-M/2/bdde81062bc8524a99ff3bbfbb822edc

Our previous studies of the neonatal primary response to (T,G)-A--L showed that the majority of anti-(T,G)-A--L antibodies bind the copolymer L-Glu:L-Tyr (GT), share idiotypy (Id), and use the H10 germline VH gene from the VHJ558 family and a V[kappa] 1 gene. We also identified two hybridomas from different neonatal donors that produced GT +, Id + antibodies using a V[kappa] 1 gene with a VH gene from the VH36-60 family. In the study reported here, we show that both neonatal hybridomas use the same germline VH gene from the VH36-60 gene family. However, the VH gene sequence is different from previously identified germline genes of the VH36-60 gene family. To determine whether the expressed heavy chain gene had undergone somatic mutation, we isolated the corresponding germline gene from kidney DNA. Sequence analysis of this gene shows that it is a new member of the VH36-60 family which is not mutated in the neonatal antibodies. Furthermore, the deduced amino acid sequences of the two neonatal antibodies are identical not only in the VH region but also in the VH-D-JH joins, suggesting that there is a strong selection for CDRIII among neonatal anti-(T,G)-A--L antibodies using this germline gene (designated here as VH3A1) with a V[kappa] 1 gene. Also, the VH gene from the VH36-60 family that we showed previously was used by an adult memory B cell clone specific for (T,G)-A--L, can now be identified as a rearrangement of the VH3A1 germline gene. Elucidation of the germline variable region genes that are used in the antigen-specific neonatal response will help us understand the mechanisms that shape the preimmune B cell repertoire during B cell development.

Rogerson, B. J. (1994). "Mapping the upstream boundary of somatic mutations in rearranged immunoglobulin transgenes and endogenous genes." Molecular Immunology 31(2): 83.

http://www.sciencedirect.com/science/article/B6T9R-476N7PY-

6R/2/01f412e96ad7caac1bfde0a9c8c0d364

Mammalian B-cell specific somatic hypermutation contributes to affinity maturation of the antibody response. This mutator activity is highly focused on rearranged immunoglobulin variable regions, but the underlying mechanism remains to be elucidated. In an effort to gain insights into the mechanism of somatic hypermutation, the precise distribution and frequency of mutations upstream of murine immunoglobulin genes was determined by examining the same variable gene segments when mutated in different B-cell lines. Immunoglobulin sequences analysed included [kappa] light chain transgenes bearing mutated V[kappa]24 variable regions, and the endogenous V[kappa] gene isolated from myeloma MOPC167, which also exhibits mutations in the variable region. In addition, mutated endogenous VH1 gene segments of the S107 heavy chain variable gene family were also examined. For both VH1 and V[kappa]24, somatic mutations were generally not found upstream of the leader intron, even in genes which exhibited a high mutation frequency in the variable region itself. The 5' somatic mutation boundary identified in immunoglobulin transgenes overlaps the boundary observed in endogenous genes, suggesting that both share cis -elements required for defining the mutable domain. Furthermore, the location of this 5' boundary appears not to change when these immunoglobulin genes are examined in different cell lines. These data may be indicative of a defined start site for immunoglobulin mutator activity.

Roos, A., L. H. Bouwman, et al. (2003). "Functional characterization of the lectin pathway of complement in human serum." Molecular Immunology 39(11): 655.

http://www.sciencedirect.com/science/article/B6T9R-476K74Y-1/2/904213914d11e347e2abf2f2abbd995e

Mannan-binding lectin (MBL) is a major initiator of the lectin pathway (LP) of complement. Polymorphisms in exon 1 of the MBL gene are associated with impaired MBL function and infections. Functional assays to assess the activity of the classical pathway (CP) and the alternative pathway (AP) of complement in serum are broadly used in patient diagnostics. We have now developed a functional LP assay that enables the specific quantification of autologous MBL-dependent complement activation in human serum.Complement activation was assessed by ELISA using coated mannan to assess the LP and coated IgM to assess the CP. Normal human serum (NHS) contains IgG, IgA and IgM antibodies against mannan, as shown by ELISA. These antibodies are likely to induce CP activation. Using C1q-blocking and MBL-blocking mAb, it was confirmed that both the LP and the CP contribute to complement activation by mannan. In order to quantify LP activity without interference of the CP, LP activity was measured in serum in the presence of C1q-blocking Ab. Activation of serum on coated IgM via the CP resulted in a dose-dependent deposition of C1q, C4, C3, and C5b-9. This activation and subsequent complement deposition was completely inhibited by the C1q-blocking mAb 2204 and by polyclonal Fab anti-C1q Ab. Evaluation of the LP in the presence of mAb 2204 showed a strong dose-dependent deposition of C4, C3, and C5b-9 using serum from MBL-wildtype (AA) but not MBL-mutant donors (AB or BB genotype), indicating that complement activation under these conditions is MBL-dependent and C1q-independent. Donors with different MBL genotypes were identified using a newly developed oligonucleotide ligation assay (OLA) for detection of MBL exon 1 polymorphisms.We describe a novel functional assay that enables quantification of autologous complement activation via the LP in full human serum up to the formation of the membrane attack complex. This assay offers novel possibilities for patient diagnostics as well as for the study of disease association with the LP.

Suzuki, K., T. Hirose, et al. (1998). "The Fc receptor (FcR) [gamma] subunit is essential for IgE-binding activity of cell-surface expressed chimeric receptor molecules constructed from human high-

affinity IgE receptor (Fc[epsiv]RI) [alpha] and FcR[gamma] subunits." Molecular Immunology 35(5): 259.

http://www.sciencedirect.com/science/article/B6T9R-3V4JNSC-G/2/fbe51b106b6e7f33951ee5a28055f40d

The Fc receptor (FcR) [gamma] subunit was originally discovered as a homodimeric subunit of the high-affinity IgE receptor (Fc[epsiv]RI). But it was recently found to be a common signal-generating subunit of Fc receptors including IgG Fc receptors (Fc[gamma]Rs) and IgA Fc receptor (Fc[alpha]R), and furthermore to generate a signal also with stimuli through non-immune receptors. In addition, it plays an essential role in cell-surface expression of the Fc[epsiv]RI and the Fc[gamma]RIIIA isoform and also regulates cell-surface expression and ligand-binding affinity of the Fc[gamma]RI. In this report, we addressed the possibility that the FcR[gamma] could affect the correct folding of the IgE-binding region of the Fc[epsiv]RI[alpha] subunit by using the chimeric receptor molecules constructed from human Fc[epsiv]RI[alpha] and FcR[gamma]. Furthermore, we demonstrated that the seven amino acid residues in the C-terminal region on the extracellular domain of the Fc[epsiv]RI[alpha] were essential for maintaining the IgE-binding activity of the Fc[epsiv]RI[alpha] exodomain on the cell membrane and\or may affect the correct folding of the [alpha] subunit itself within the cell.

Talken, B. L., K. Peterson, et al. (1994). "A polymorphic residue in the amino terminal [alpha] 1 hemi-domain of the mouse Ld class I molecule affects its assembly and surface expression." Molecular Immunology 31(15): 1169.

http://www.sciencedirect.com/science/article/B6T9R-4754VTW-6/2/7957b555a0701bba81bd3c81a27ad864

In comparison to Dd and most other mouse major histocompatibility complex class I molecules, the Ld molecule is poorly expressed on the cell surface, has a lower affinity for [beta]2-microglobulin and is trafficked more slowly to the cell surface. Previous studies using Ld-Dd exon-shuffled constructs and the chimeric Ddml molecules suggested that the Ld[alpha] 1 domain was responsible for this phenotype. Two constructs, one containing an Ld-Dd hemi-exon-shuffled [alpha] 1 exon and the other containing a Dd-Ld hemi-exon-shuffled [alpha] 1 exon, were inserted into either Ld or Dd to replace the intact [alpha] 1 exon. These constructs were transfected into mouse L cells. Flow cytometric analyses of the resulting transfectants indicate that the Dd-Ld [alpha] l/Ld molecules, similar to the Dd [alpha] 1/Dd [alpha]2/Ld molecules, were expressed at a higher level on the cell surface than either the Ld-Dd [alpha] 1/Ld molecules or intact Ld molecules. Analyses of the molecules in lysates suggested that a higher proportion of the Dd-Ld [alpha] 1/Ld molecules, like the Dd [alpha]1/Dd [alpha]2/Ld molecules, as compared to the Ld-Dd [alpha] 1/Ld and intact Ld molecules were assembled as detected by [alpha] 2 domain-reactive monoclonal antibodies. Pulse-chase and lysate stability studies suggested that the lower steady state levels of assembled Ld-Dd [alpha] 1 molecules resulted from a slower assembly rate rather than instability. Collectively, these studies suggest that residues in the amino terminal half of the Ld [alpha] 1 domain are responsible for its inefficient assembly, probably leading to its low cell surface expression. To determine which polymorphic residues in the amino terminal [alpha] 1 hemi-domain might influence this phenotype, several Ld point mutants, in which a Dd amino terminal [alpha] 1 hemi-domain residue was substituted into the corresponding position of Ld, were analysed. These analyses suggested that, while the residue at position 9 has only a slight effect on [beta]2-microglobulin association, it has a striking effect on assembly and cell surface expression.

Tosi, G., S. Brunelli, et al. (1994). "The complex interplay of the DQB1 and DQA1 loci in the generation of

the susceptible and protective phenotype for insulin-dependent diabetes mellitus." Molecular Immunology 31(6): 429.

http://www.sciencedirect.com/science/article/B6T9R-476N815-96/2/94d3a72747a5815b824c1d915488004d

IDDM patients of North East Italian region were molecularly typed for their HLA-DQB1 and DQA1 loci by using allele specific oligonucleotide probes and PCR amplified genomic DNA. IDDM status strongly correlated with DQB1 alleles carrying a non-aspartic acid residue in position 57 of DQ[beta] chain and DQA1 alleles with an arginine residue in position 52 of DQ[alpha] chain. Genotype analysis revealed that individuals with two DQB1 aileles having a non-aspartic residue in position 57 and two DQA1 alleles with an arginine residue in position 52 had the highest relative risk of disease: they constituted 41% of IDDM patients as compared to 0% of controls. Heterozygosity either at residue 57 of DQB1 or residue 52 of DQA1 was sufficient to abrogate statistical significance for disease association, although 43.6% of IDDM patients were included in these two groups as compared to 21.6% of normal controls. On the other hand the presence of two DQB1 alleles with aspartic acid in position 57 was sufficient to confer resistance to disease irrespective of the DQA1 genotype. Based on the number of possible susceptible heterodimers an individual can form, it was found that 85% of IDDM cases could form two or more heterodimers (two in cis and two in trans), but no IDDM case was found to form one susceptible heterodimer in cis. These results demonstrate that the complete HLA-DQ genotype, more than single DQB1 or DQA1 alleles or DQB1-DQA1 haplotypes, is associated with the highest risk of disease. Screening of the population for preventive purposes and/or early signs of IDDM should then take advantage of this result and "susceptible homozygous" individuals should be followed very closely and considered the first group of choice for possible new therapeutical trials.

Tosi, G., G. Mantero, et al. (1993). "HLA-DQB1 typing of north east Italian IDDM patients using amplified DNA, oligonucleotide probes and a rapid DNA-enzyme immunoassay (DEIA)." Molecular Immunology 30(1): 69.

http://www.sciencedirect.com/science/article/B6T9R-476KP7N-3B/2/a1b4ffb24d6dfe6a8d5b9336ab4718c8

We report on HLA-DQB1 typing in IDDM patients of north east Italian region using an enzymatic method based on the detection of hybridization reaction between PCR amplified DNA from whole blood and allele specific oligonucleotides by an antibody directed against double stranded DNA (DNA-enzyme immunoassay or DEIA). The method is reliable, simple and sensitive as the classical radioactive method with the advantage of using a universal non radioactive detection reagent. Nineteen families, each including one subject with juvenile insulin-dependent diabetes mellitus (IDDM) were analyzed. A strong association between absence of an aspartic acid (Asp) in position 57 of DQB1[beta] chain in homozygous conditions and susceptibility to IDDM was found. In contrast with some previous observations, however, no significant association was found between Asp/non-Asp heterozygous genotype and IDDM. No patients were found with an homozygous Asp/Asp genotype, known to be protective in caucasoid population. Of particular interest was the DQB1 alleli distribution in our population sample. The non-Asp allele most frequently found in IDDM subjects was the DQB1 0201 allele and this finding was statistically significant (Pc value <0.05, relative RISK = 5.01). No significant association was found for any other allele including the DQB1 0302 (Pc VALUE = not significant although with relative RISK = 3.28) previously reported as the most frequent allele in IDDM caucasoid patients.

Viquez, O. M., K. N. Konan, et al. (2003). "Structure and organization of the genomic clone of a major peanut allergen gene, Ara h 1." Molecular Immunology 40(9): 565.

http://www.sciencedirect.com/science/article/B6T9R-49SN9FS-1/2/70aeeaefb21914d97e4d22e480075c58

Peanut is one of the most allergenic foods. It contains multiple seed storage proteins identified as allergens, which are responsible for triggering IgE-mediated allergic reactions. Ara h 1 is a major peanut allergen recognized by over 90% of peanut sensitive population. The objectives of this study were to isolate, sequence, and determine the structure and organization of at least one genomic clone encoding Ara h 1. Two 100 bp oligonucleotides were synthesized and used as probes to screen a peanut genomic library constructed in a Lambda FIX II vector. After three rounds of screening, four putative positive clones were selected and their DNA digested with SacI. A unique 12-13 kb insert fragment was released, confirmed positive by Southern hybridization, subcloned into a pBluescript vector, and sequenced. Sequence analysis revealed a full-length Ara h 1 gene of 4447 bp with four exons of 721, 176, 81 and 903 bp and three introns of 71, 249 and 74 bp. The deduced amino acid encodes a protein of 626 residues that is identical to the Ara h 1 cDNA clone P41b. Several well characterized elements for promoter strength were found in the promoter region of Ara h 1 and include two TATA-boxes (TATATAAATA and TTATATATAT) at positions -89 and -348, respectively; a CAAT-box (CAAT) at position -133, a GC-box (CGGGACCGGGCCGG GCCTTCGGGCCGGGCCGGGT) at position -475, two G-boxes (TAACACGTACAC and ATGGACGTGAAA) at positions -264 and -1808, respectively; two RY elements (CATGCAC and CATGCAT) at positions -235 and -278, respectively; and other cis-element sequences. In the 3' UTR, a poly-A signal (AATAAA) was found at +2350, two additional stop codons (TAA) at +2303 and +2306, and TTTG/CTA/G motifs. Three introns and a potentially strong promoter could explain the high expression of the Ara h 1 gene. Amino acid sequence comparisons revealed high sequence similarity with other plant vicilins, member of the cupin superfamily.

Viquez, O. M., K. N. Konan, et al. (2004). "Genomic organization of peanut allergen gene, Ara h 3." Molecular Immunology 41(12): 1235.

http://www.sciencedirect.com/science/article/B6T9R-4D5KX9F-1/2/4f3282834c09c81a345542f5b993b6ae

Type 1 hypersensitivity to peanut proteins is a well-recognized health problem. Several peanut seed storage proteins have been identified as allergens. Ara h 3, a glycinin protein, is one of the important peanut allergens. Although amino acid and cDNA sequences are available for Ara h 3, there is not information at the genomic level. The objectives of this study were to isolate, sequence, and characterize the genomic clone of peanut allergen, Ara h 3. A peanut genomic library was screened, using two [32P] end-labeled oligonucleotide probes designed based on cDNA sequences of Ara h 3 and Ara h 4. Four positives lambda FIX II clones were obtained after four rounds of screenings. Digestion with Sac I resulted in two fragments of 1.5 and 10 kb hybridizing to the probes. Both fragments were subcloned into p-Bluescript vector and sequenced. The Ara h 3 gene spans 3.5 kb and consists of four exons, three introns, 5' and 3' flanking regions. The open reading frame is 2008 bp long and can encode a polypeptide of 538 amino acids residues. Sequences analogous to a TATA-box (TATAAAT), CAAT-box (AGGA), G-box (TCCTACGTGTCC) and several cis-elements were found in the promoter region. In the 3' downstream region, three polyadenylation signals (AATAAA) were identified.

Wade, W. F., I. Khrebtukova, et al. (1995). "Truncated MHC class II cytoplasmic and transmembrane domains: Effect on plasma membrane expression." Molecular Immunology 32(6): 433.

http://www.sciencedirect.com/science/article/B6T9R-3YKM99P-47/2/184d6ef30644a17cf09d6fb4de9ffabd

Plasma membrane (PM) expression of major histocompatibility complex (MHC) class II molecule is required for the interaction of antigen (Ag) presenting cells and T lymphocytes. Class II molecules composed of an alpha and a beta chain are highly polymorphic which facilitates their interaction with Ag and Ag-specific T cells. Recently, we have focused on the less polymorphic sequences of class II molecules, the transmembrane (TM) and cytoplasmic (Cy) domains, in an attempt to understand what their function might be. Using site-directed mutagenesis to create truncations in the TM and Cy domains of IAk's alpha or beta chain, or both, we have identified some of the sequence requirements for efficient surface expression of I-Ak molecules. Ak[beta]TM mutants that are not expressed at the PM are not transported past the medial-Golgi as indicated by in situ staining and Western blot analysis of endoglycosidase-H-treated immunoprecipitates. The lack of transport of TM class II mutants is not due to lack of association with the invariant chain (Ii). Class II molecules with Cy domain truncations in both chains are not efficiently transported to the PM and also have a percentage of molecules that are endoglycosidase-H sensitive. In situ staining of class II in cells expressing Cy domain truncated class II molecules revealed a discrete vesicular pattern compared to the staining of transfectants that expressed wildtype class II molecules. The immunofluorescence data along with the endoglycosidase-H data indicate the Cy domains are required for efficient transport. Immunoprecipitation studies using a panel of I-Ak conformation-specific antibodies revealed that the truncation of the Cy domains of both chains did not effect the conformation of class II. However, further truncation of the Ak[beta] chain into the TM domain resulted in lack of transport past the ER/medial-Golgi and diminished expression (stability) of mutant class II proteins within the cells. The alpha/beta chains of the TM mutants that did associate bound a panel of conformation sensitive antibodies except for one, 3F12. We conclude that the Cy domain of the alpha and beta chains of MHC class II, as well as sequences in the TM domains of the Ak[beta] chain are required for efficient class II PM expression. The reason for the lack of PM expression of TM mutants may be the inability to access a transport competent conformation as defined by the 3F12-specific epitope, while truncation of the Ak[alpha]Cy domains is proposed to prevent complete masking of the ER retention sequence of the Ii chain.

Walter, W., M. Loos, et al. (1999). "Differential expression of alternative H2-M isoforms in B cells, dendritic cells and macrophages by proinflammatory cytokines." Molecular Immunology 36(11-12): 733.

http://www.sciencedirect.com/science/article/B6T9R-3XP0H37-4/2/54458ccf5d200e36cfd2fe78f2aa0a62

Major histocompatibility (MHC) class II heterodimers bind peptides generated by degradation of endocytosed antigens and display them on the surface of antigen presenting cells (APCs) for recognition by CD4+ T cells. Efficient loading of MHC class II molecules with peptides is catalyzed by the MHC class II-like molecule H2-M. The coordinate regulation of MHC class II and H2-M expression is a prerequisite for efficient MHC class II/peptide assembly in APCs determining both the generation of the T cell repertoire in the thymus and cellular immune responses in the periphery. Here we show that expression of H2-M and MHC class II genes is coordinately and cell type-specific regulated in splenic B cells, splenic dendritic cells (DCs) and peritoneal macrophages (M[Phi]) in response to proinflammatory and immunoregulatory cytokines, including GM-CSF, IFN-[gamma], TGF-[beta]2, IL-4, IL-10 and viral IL-10. In addition, ratio-RT-PCR expression analysis of the duplicated H2-M[beta]-chain loci demonstrates for the first time that Mb1 and Mb2 genes are differentially expressed in individual APC types. Mb2 is preferentially expressed in IL-4, GM-CSF, IL-10, vIL-10 and IFN-[gamma] stimulated splenic B cells, whereas splenic DCs express both Mb genes at almost equal levels. In contrast, peritoneal M[Phi] express predominantly Mb2 but stimulation with IFN-[gamma] induces a switch towards Mb1 expression. These data suggest a common mechanism that regulates coordinate expression of H2-M and MHC class II genes in professional APCs. Differential expression of Mb1 and Mb2, and by consequence alternative H2-M isoforms (M[alpha][beta]1 or M[alpha][beta]2), may

influence the nature of the peptide repertoire presented by different APC types.

Willett, B. J. and J. C. Neil (1995). "cDNA cloning and eukaryotic expression of feline CD9." Molecular Immunology 32(6): 417.

http://www.sciencedirect.com/science/article/B6T9R-3YKM99P-45/2/aae906e5949b72b1a91c502166c13d77

A monoclonal antibody (vpg15) has been described which can block infection with feline immunodeficiency virus (FIV) and which recognizes the feline homologue of CD9. In order to study the role of feline CD9 in infection with FIV we have molecularly cloned a cDNA encoding feline CD9 by R.A.C.E (rapid amplification of cDNA ends). The amino acid sequence of feline CD9 displays 95.1, 93.8 and 90.7% homology to human, murine and bovine CD9, respectively. Although feline CD9 appears most homologous to human CD9, it has two important features in common with bovine and murine CD9: the presence of a histidine residue at position 192 which is absent from the corresponding position (194) in human CD9; and the absence of two asparagine residues which are found at positions 51 and 52 of human CD9. Feline CD9 is unique in that it lacks a potential N-linked glycosylation site in the first extracellular loop, a feature common to CD9 of other species. Despite the high degree of sequence homology, significant cross-species variation occurred in the two predicted extracellular loops, notably between amino acids 169 to 180 of the second loop. When feline CD9 was expressed on human and murine cells, it was recognized by both the conformation-dependent feline CD9-specific antibody, vpg15, and the cross-species reactive anti-human CD9 antibody, FMC56, confirming that the feline CD9 clone encoded a protein which was synthesized, transported to the cell surface and expressed in a similar conformation to native feline CD9. However, although the vpg15 antibody did not recognize human CD9 when expressed on human epithelial cells, it reacted with human CD9 when expressed on murine fibroblast cells. It is possible therefore, that the conformational epitope recognized by the vpg15 epitope is sensitive to either species- or tissue-specific post-translational modification.

Yamamoto, R., T. Isobe, et al. "Porcine TCR CD3[zeta]-chain and [eta]-chain." Molecular Immunology In Press, Corrected Proof http://www.sciencedirect.com/science/article/B6T9R-4FPX2GX-1/2/b43d1a5cff78c561526636cf1540b34d

Complete porcine CD3[zeta]-chain cDNA sequence was obtained for the first time, and its genomic nucleotide sequence was investigated from exon 2 down to CD3[eta]-chain exon 8. The sequence of porcine CD3[zeta]-chain showed homologous amino acid sequence with human and murine counterparts, in contrast to CD3[eta]-chain exon 8 with diversity among animals previously investigated. CD3[eta]-chain peptide is an alternative splice form of CD3[zeta]-chain exon 7 splicing to CD3[eta]-chain exon 8 instead of CD3[zeta]-chain exon 8. The genomic sequences revealed that the splice acceptor sequences of CD3[eta]-chain exon 8 of all animals investigated to be completely uniform. Further, CD3[eta]-chain exon 8 amino acid sequences retained the unique characters of having high proline (Pro) and positively charged amino acid content except for rats and mice. Although the biological role of CD3[eta]-chain remains to be enigmatic, these evidences suggests the evolutional pressure to maintain its sequence.