Upload
jeremy-reynolds
View
213
Download
0
Tags:
Embed Size (px)
Citation preview
Amino acid sequence of His protein
• DNA provides the instructions for how to build proteins
• Each gene dictates how to build a single protein in prokaryotes
• The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that make up a protein
Protein Synthesis & Gene Expression
nucleotide sequence of His protein
Protein Synthesis & Gene Expression
Protein Synthesis & Gene Expression• Protein Synthesis = Gene Expression
The process in which the instructions encoded by a gene are used to build a protein
Gene
DNA in the nucleus
mRNA
made in nucleus, exits out of a pore in the nuclear envelope and finds a ribosome in the cytoplasm
transcription polypeptide
built out of amino acids by a ribosome in the cytoplasm using instructions from an mRNA
translation
protein
Final resulting molecule after polypeptide is modified and folded into final shape in the rough ER
Packaged into a vesicle in the golgi and shipped out to where it is needed
Protein Synthesis & Gene Expression
• Transcription RNA polymerase makes an
mRNA (messenger RNA) copy of a gene
occurs in cytoplasm of prokaryotes, nucleus of eukaryotes
Enables cell to make many copies of a gene so that a lotof protein can be made at onetime
Enables eukaryotic cells tokeep DNA protected in the nucleus, only mRNA copiesof genes leave the nucleus
(eukaryotes)
1) INITIATION
• Transcription Initiation RNA polymerase binds to a
region on DNA known as the promoter, which signals the start of a gene
Promoters are specific to genes RNA polymerase does not need
a primer
Transcription factors assemble at the promoter forming a transcription initiation complex – activator proteins help stabilize the complex
Gene expression can be regulated (turned on/off or up/down) by controlling the amount of each transcription factor
Protein Synthesis & Gene Expression
HONORS
1) INITIATION
• Transcription Elongation RNA polymerase unwinds
the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another
Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template)
• recall RNA uses uracil instead of thymine
AGTCAT
UCAGUA
Protein Synthesis & Gene Expression
HONORS
• Transcription Elongation
The gene occurs on only one of the DNA strands; each strand possesses a separate set of genes
Protein Synthesis & Gene Expression
RNA polymerase slides down the template strand connecting together RNA nucleotides
1) INITIATION
• Transcription Termination A region on DNA known as
the terminator signals the stop of a gene
RNA polymerase separates from the mRNA and the DNA
Protein Synthesis & Gene Expression
HONORS
Exons are “coding” regions provide instructionsfor one or more proteins)
Introns are removed
different combinations of exons form different mRNA resulting in multiple proteins from the same gene
Humans have 30,000 genes but are capable of producing 100,000 proteins
• Alternative Splicing (eukaryotes only)
Protein Synthesis & Gene ExpressionHONORS
Web ResourcesTranscription• http://www.biostudio.com/d_%20Transcription.htm
• http://www.youtube.com/watch?v=WsofH466lqk
• http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.html
Alternative Splicing• http://www.youtube.com/watch?v=FVuAwBGw_pQ&feature=related
Protein Synthesis & Gene Expression
• Translation mRNA is used by ribosome to build
polypeptides (Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the polypeptide)
occurs in cytoplasm of prokaryotes and eukaryotes
some polypeptides feed directly into rough ER in eukaryotes where they are modified and folded into the final protein
Transcription
Translation
mRNA
tRNA synthesis
• TranslationInitiation Start codon signals where the
gene begins (at 5’ end of mRNA)
AUGGACAUUGAACCG…5’ 3’
start codon
Translation
mRNAProtein Synthesis
• TranslationInitiation Start codon signals where the gene
begins (at 5’ end of mRNA) Ribosome binding site on the mRNA
binds to a small ribosomal subunit Then this complex binds to a large
ribosomal subunit forming the complete ribosome
Protein Synthesis & Gene Expression
• TranslationScanning The ribosome moves in 5’ to 3’ direction “reading” the mRNA and
assembling amino acids into the correct polypeptide
Protein Synthesis & Gene Expression
Transcription
Translation
mRNA
tRNA synthesis
• TranslationScanning
Every three mRNA nucleotides (codon) specify an amino acid
Protein Synthesis & Gene Expression
• TranslationScanning Each tRNA carries a specific amino acid tRNA have an anticodon region that specifically binds to its codon
Protein Synthesis & Gene Expression
anticodon
• TranslationTermination Ribosome disengages from the mRNA
when it encounters a stop codon
Protein Synthesis
Web ResourcesTranslation• Eukaryotic: http://www.youtube.com/watch?v=5bLEDd-PSTQ&feature=related
• Prokaryotic: http://www.biostudio.com/d_%20Protein%20Synthesis%20Prokaryotic.htm
• http://www.biostudio.com/d_%20Peptide%20Bond%20Formation.htm
• http://www.johnkyrk.com/DNAtranslation.html
• http://www.dnalc.org/resources/3d/TranslationBasic_withFX0.html
• http://www.dnalc.org/resources/3d/TranslationAdvanced.html
• Post-Translational Modifications Polypeptide is modified in the rough ER – this might include cutting out
sections and/or cut a section from one part of the polypeptide and moving it to another part
Chaperone proteins help to fold the polypeptide into its final tertiary shape. Now it is called a protein.
Protein Synthesis & Gene Expression
• Folded membrane that forms compartments where newly synthesized proteins are processed (cut, joined, folded into their final shape)
• Ribosomes bind to rough ER when they start to synthesize proteins that are intended to be exported from the cell – the proteins enter the ER directly from the ribosome
Rough Endoplasmic Reticulum (ER)
Protein Synthesis & Gene Expression
• Folded membranes form compartments that each contain different enzymes which selectively modify the contents depending on where they are destined to end up
• Processes and packages macromolecules produced by the cell (e.g. proteins and lipids) – sent out as excretory vesicles “labeled” for their destination
Golgi ApparatusProtein Synthesis & Gene Expression
• Multiple RNA polymerases can engage a gene at one time
• Multiple ribosomes can engage a single mRNA at one time
DNA mRNAs
Transcription
Translation
Protein Synthesis & Gene Expression
• Eukaryotes: transcription occurs in the nucleus and translation occurs in the cytoplasm
• Prokaryotes: Transcription and translation occur simultaneously in the cytoplasm
Protein Synthesis & Gene Expression
• There are three main types of RNA:
1. mRNA (messenger RNA) - RNA copy of a gene used as a template for protein synthesis
2. rRNA (ribosomal RNA) - part of structure of ribosomes
3. tRNA (transfer RNA)- amino acid carrier that matches to mRNA codon
Protein Synthesis & Gene Expression
Practice QuestionTranslate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGC
Practice QuestionTranslate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGCSerine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine
Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser
Practice QuestionTranslate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGCSerine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine
Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine
Practice QuestionTranslate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGC
S – Y –H– T – H – P – S – S – S - S
Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser
Protein Synthesis & Gene Expression
• Protein Synthesis = Gene Expression Process in which a gene is used to build a protein resulting in the
presence of a particular phenotype (physical characteristic) Phenotypic variation among organisms is due to genotypic variation
(differences in the sequence of their DNA bases) Differences exist between species and within a species
• Different genes (genomes) different proteins (proteomes)
• Different versions of the same gene = alleles
• Differences in gene expression = epigenetics
Insulin Example of Protein Synthesishttp://www.biotopics.co.uk/as/insulinproteinstructure.html
Hemoglobin Example of Protein Synthesishttp://www.biotopics.co.uk/as/insulinproteinstructure.html
Collagen Example of Protein Synthesishttp://www.biotopics.co.uk/JmolApplet/collagen.html
Web Resources