1

[All multiple choice and short answer questions in section 1 are 2 points each] Section 1

_D__1. Living organisms are: A) thermally isolated. B) closed systems. C) isolated systems. D) open systems. E) none of these.

_B__2. Which of the following is not true

A) Eukaryotes, bacteria and archaea contain DNA, RNA and protein. B) Not all eukaryotes are multicellular. C) Eukaryotes contain organelles. D) Archaea lack organelles. E) Bacterial use histones to package DNA. F) Some eukaryotes and some bacteria are human pathogens.

_D__3. Which of the following is true?

A) The hydrophobic effect is caused by negative enthalpy of interaction between hydrophobic groups. B) The hydrophobic effect is caused by positive entropy of interaction between hydrophobic groups. C) The hydrophobic effect is caused by positive enthalpy of interaction between water molecules and hydrophobic groups. D) The hydrophobic effect is caused by negative entropy of interaction between water molecules and hydrophobic groups. E) The hydrophobic effect is caused by positive enthalpy of interaction between water molecules.

_A__4. Glycolysis is the process by which energy is harvested from glucose by living things. Several reactions of glycolysis are

thermodynamically unfavorable (non-spontaneous), but proceed because they are coupled with other reactions. Which reaction(s) is (are) spontaneous in the direction written?

A) fructose-1,6-bisphosphate + H2O à Pi + fructose-6-phosphate DG = -16.3 kJ/mol

B) ADP + Pi àATP + H2O DG = +30.5 kJ/mol

C) Pi + glucose à glucose-6-phosphate + H2O DG = 13.8 kJ/mol

D) None are spontaneous. E) All are spontaneous.

_C__5. A reaction with DH = 100 kJ/mol and DS = -100 J/K•mol, at 1000 K,

A) is spontaneous B) is nonspontaneous C) at equilibrium D) is exergonic E) violates the second law of thermodynamics.

_B__6. The Ka values for several acids are given below. Which acid (with its conjugate base) would be the best buffer at pH =

6? A) Tris, Ka = 6.3 x 10-9 B) MES, Ka = 7.9 x 10-7. C) Acetic Acid, Ka = 1.8 x 10-5 D) Formic Acid, Ka = 1.8 x 10-4

E) HEPES, Ka = 3.2 x 10-8

_B__7. Phosphoric acid, a polyprotic acid, has pKa values of 2.14, 6.86, and 12.38. What is the primary ionic form pH 7? A) H3PO4 B) H2PO4

1− C) HPO42− D) PO4

3− E) none of the above _C__8. Standard free energy of a reaction can be used to determine Keq using the equation

A) Keq = ln e−DG°/TDS B) Keq = e−DH°/RT C) Keq = e−DG°/RT D) Keq = e(DH° - TDS°)/RT E) Keq = e−DG°/TDS F) Keq = log e−DG°/RT

9. Kw, the ionization constant of water, is _10-14_ at __20__°C. _B__10. Which of these is true about amphiphilic molecules?

A) They have both neutral and charged groups. B) They have both hydrophilic and hydrophobic groups. C) They have both cationic and anionic groups.

2

D) They have both oxidizing and reducing groups. E) None of these.

_F__11. You have a 10 mM solution of NaOH. What is the pH of the solution?

A) 3 B) 10.0 C) 11.2 D) 0.01 E) 14.1 F) None of these. _B__12. Proteins can be quantified by their absorbance at 280 nm. If a large protein has roughly the same number of each of

the amino acids listed below, which amino acid will be providing the bulk of the signal at 280 nm? A) Leu B) Trp C) Pro D) Phe E) Tyr F) Arg

_C__13. Imagine two point charges of opposite sign separated by 5 Å in solution. In which solvent would the attractive force

between them be the smallest? A) acetone (r = 0.78; e = 21) B) methanol (r = 0.79; e = 33) C) water (r = 1.0; e = 80) D) glycerol (r = 1.26; e = 43)

14. The ability of biological amino acids to rotate linearly polarized light, or to absorb one handeness of circularly polarized

light more than the other, is called __optical activity____________. 15. (6 points) A bacterial cell has 10 copies of a given protein. Estimate the concentration of this protein within the cell.

~1µm diameter, 2µm length, ~1µm3 in volume Concentration = 10 molecules/1µm3

16. (4 points) Put an asterisk next to each asymmetric atom (chiral center) in the chemical structure on the right: 17. (5 points) Draw glucosamine in the Haworth projection.

18. (6 points) On the right is a ribbon representation of a beta-alpha-beta motif. A) Based on this structure (which is derived from an actual protein structure), and your knowledge of protein secondary structures, estimate the number of amino acids required to make this motif. B) What is the approximate length of the alpha helix (in nm).

A aa in helix: 3.6 aa/turn x 4.5 turns = 16 aa approx 6 per b-strand and 4 in the loop = 16 aa total = around 32 aa

B helix length 5.4 Å/turn x 4.5 turns = 24 Å 19. (6 points) The reaction coordinate diagrams below are for a reaction of the form y <-> a + b, where are y and a, b are different molecular species. Show how the curve changes if A) the forward reaction is catalyzed by an enzyme; B) if the free energy of the forward reaction becomes less favorable; C) if the reaction reaches equilibrium.

3

A

B

C

4

_B__20. Which of the following is (are) true of the following equation? A) The [ES] will remain constant if k2 >k1 and k-1 < k2. B) The reaction is zero order with respect to [S] if [S] >>[E] C) It describes a double displacement reaction D) All of the above are true E) None of the above is true

_E__21. Membrane proteins:

A) are sometimes covalently attached to lipid moieties B) are sometimes covalently attached to carbohydrate moieties C) are composed of the same 20 amino acids found in soluble proteins D) diffuse laterally in the membrane unless they are anchored. E) have all of the properties listed above

_D__22. Why is it surprising that the side chains of tryptophan residues in lectins can interact with sugars?

A) Because the side chain of tryptophan is hydrophilic and sugars are hydrophobic B) Because the side chain of tryptophan is (-) charged and sugars are generally (+) charged or neutral C) Because the side chain of tryptophan can make hydrogen bonds and sugars cannot D) Because the side chain of tryptophan is hydrophobic and sugars are hydrophilic E) None of the above

_D__23. The double helix of DNA in the B-form is stabilized by:

A) covalent bonds between 3’ end of one strand and the 5’ end of the other B) hydrogen bonding between the phosphate groups of two side-by-side strands C) hydrogen bonds between the riboses of each strand D) nonspecific base-stacking interactions between adjacent bases in the same strand E) ribose interactions with the planar base pairs.

_D__24. The rearrangement of T state hemoglobin to the R state

A) occurs in each protein subunit independently when its heme binds oxygen. B) requires the binding of at least three oxygen molecules. C) increases the ion pairing interactions of the C-terminal amino acids. D) involves the movement of the Fe (II) into the heme plane. E) opens a central cavity for 2, 3-bisphosphoglycerate (BPG) binding.

_B__25. The imidazole side chain of histidine can function as either a general acid catalyst or a general base catalyst because:

A) in the physiological pH range both H+ and OH- are present at high concentrations B) in the physiological pH range, the nitrogens in the ring can be easily protonated/deprotonated C) one guanidine group is protonated, and the other is deprotonated at the physiological pH D) the imidazole group is a strong reducing agent at physiological pH E) the sulfur atoms in the ring can either gain or lose a proton at the physiological pH.

_F__26. Starch is:

A) glucose and fructose B) glycogen and amylopectin C) glycogen and cellulose D) glycogen and a-amylose E) a-amylose and maltose F) a-amylose and amylopectin.

27. Chitin is a polymer of the sugar _______glucose________ with __b____ linkages. In contrast, amylose is a polymer of

the sugar___ glucose_______with__a___linkages. _C_28. Xyulose, a ketopentose, has _____ stereoisomer(s).

A) 1 B) 2 C) 4 D) 8 E) 16 29) [6 points] Draw a G-C base pair. Include the ribose sugar and 3’ phosphate on the G (just put “R” on C in place of ribose).

Label all the atoms of both bases (1’C, 2’C, N3, etc.). Indicate the lengths of all the hydrogen bonds (H---O and H---N distances).

5

30) (six points) Draw a helical wheel for this sequence: INEGFDLLRSG, and label the hydrophobic and/or hydrophilic faces of the alpha helix.

31) (six points) Draw an anti-parallel b-sheet with 2 strands and 3 amino acids per strand. Draw all hydrogen bonds, indicate correct stereochemistry at all the Ca’s. Use the letter R for each of the sidechains.

32. (six points) In the right is a Lineweaver-Burk plot of data obtained for carbonic anhydrase. A) From this graph determine the Michaelis constant and the Vmax for this set of reactions. B) Draw the plot that would be obtained if a competitive inhibitor with a = 4 was present in the same reactions. C) Draw the plot that would be obtained if an uncompetitive inhibitor with a' = 3 was present in the same reactions. Be as precise as possible for full credit. 33. (six points) Hemoglobin can be modeled as a simple monoprotic buffer that dissociates one proton per subunit as illustrated in the figure and in the equilibrium equations shown below. Calculate the quantity, in mmol, of protons released when 3 mmol of oxygen binds to deoxyhemoglobin at pH 7 and the pH then returns to 7, i.e., in going from where the dashed line crosses the top curve to where the dashed line crosses the bottom curve.

6

_C_ 34) Which statement about the bases of DNA is false?

a)basesareplanarb)bothpyrimidinesarepurinesarearomatic.c)basesstackinB-formDNAbutnotA-formDNA.d)allbasesabsorbUVlighte)basesformhydrogensbondtoformtwo,three,andfour-strandedDNAstructures.

_A_ 35) The process of bringing together two complementary DNA strands by cooling is called: a) Annealingb)denaturationc)ligatingd)disintegratione)isoelectricfocusing

_F_ 36) Polymerase chain reaction does not require:

a)aDNApolymeraseb)aDNAtemplatec)magnesiumd)primerse)dNTPsf)PCRrequiresa-e. _F_ 37) Sample One of a qPCR reaction requires six PRC cycles to reach the concentration of Sample Two. This means that

Sample Two has ___ DNA compared to Sample One a) 6-timeslessb)12-timeslessc)64-timeslessd)6-timesmoree)12-timesmoref)64-timesmore.

_A_ 38) Which statement about a cloning vector is false? A cloning vector: a)requiresaribosomalbindingsequence.b)requiresanoriginofreplicationc)cancontainapolylinkersequenced)cancontainaselectablemarkere)doesnotrequireatranscriptionpromotor.

_F_ 39) An protein expression vector: a)doesnotrequireatranscriptionpromoterb)doesnotrequireatranslationstartsitec)canbeconstructedusingacombinationofDNAandRNAd)requirespackagingbyacoatproteinf)canhaveaninduciblepromotor.

_B_ 40) RNA is less stable chemically under alkaline conditions than DNA because___. a)the2’oxygenwillattackthephosphatebackbonelinkageinRNA.b)depurinationhappensmorereadilyinRNA.c)the1’oxygenismoreeasilydeprotonatedinRNA.d)DNAcontains2’-5’phosphatelinkages.

_B_ 41) Automation of the Sanger sequencing method was made possible by:

a) the invention of PCR b) the invention of fluorescently-labeled nucleotides c) the discovery of reverse transcriptase d) radiolabeling of DNA e) the discovery of plasmids.

_D__ 42) Introns: a)areremovedduringtranslation.b)areremovedduringtranscription.c)areremovedduringreplication.d)areremovedduringsplicing.e)areshorttandemrepeats.

_B__ 43) The human genome contains____

a)T7RNApolymerasepromoters.b)about20,000genes.c)circularchromosomes.d)about30%exons.e)operons.

_D__ 44) Characteristic properties of cholesterol include:

a) disruption of membranes upon incorporation b ) high water solubility c) fast breakdown with UV light. d) a precursor to steroid hormones

_E__ 45) __________ are attractive noncovalent interactions within membranes.

a) phosphate–phosphate electrostatics b) disulfide bonds c) carbon-carbon bonds d) carbon-nitrogen bonds e) London dispersion interactions.

_D__ 46) Characteristics of unsaturated fatty acids include:

a) found in plants but not animals. b) usually contain a double bond with trans stereochemistry c) always contain multiple double bonds d) can be converted to fats with greater melting temperature by hydrogenation e) none of these.

_D__ 47) Life stores energy in fats, rather than in carbohydrates, because triglycerides:

a) are more water soluble b) are more highly oxidized c) contain stronger covalent bonds d) contain more energy per mole.

7

_E__ 48) The Central Dogma of Molecular Biology states that:

a) DNA is converted into RNA. b) RNA is converted to protein. c) once information has got into RNA it can’t get out again. d) RNA cannot be reverse transcribed. e) information flows from RNA to protein.

_C__ 49) This structure is

a) a right-handed B-form helix. b) a left-handed B-form helix. c) a right-handed A-form helix. d) a left-handed A-form helix. e) a right-handed b-helix.

50. (6 points) Two common forms of DNA damage are guanine oxidation and adenine deamination. Draw that structures that result from these forms of damage, and give the point mutations that result after DNA replication across the region that contains these damaged bases.

51) (4 points)] Below is an autoradiogram from Sanger sequencing reactions. The arrow indicates the direction of DNA migration during electrophoresis. What is the sequence of the DNA template strand in the 5’ to 3’ direction based on this data?

3’ C G C T T G C C C T G

5’ 52) (6 points) Three plasmids of 5,250 bp are imaged in solution with the structures shown below. Provide the linking number (Lk), twist (Tw) and writhe (Wr) for each. You can assume that DNA has a helical repeat of 10.5 pb per turn.

Lk:497_ Tw:_500 Wr:_-3 Lk:499_ Tw:500_ Wr:_-1 __ Lk:501_ Tw:500_ Wr:_1__

53) (6 points) Draw Elaidic acid [18:1 trans-Δ9] and Linoelaidic acid [18:2 trans,trans-Δ9,Δ12].

8

55) (6 points) Below is a schematic representation of a DNA duplex with five sections labeled A through E (with A*, B*, and C* being the complementary sequences of A, B, and C, respectively). Assume that you have PCR primers corresponding to B and D*, but want to amplify the unknown sequence C. The PCR primers you designed work perfectly. Show, with a schematic, the structure of the DNA molecules (with sequences segments labeled) that will be in the sample after 4 rounds of thermal cycling. You can assume that there is only one of the template duplexes at the start of the first thermal cycle. If there will be multiple copies of any particular structure, you only need to draw one example and give the number of copies of that structure.

Section 2 [All multiple choice and short answer questions in section 2 are 3 points each]

_C__1. The Meselson-Stahl experiment established that:

A) DNA polymerase is the primary enzyme in DNA synthesis. B) DNA synthesis in E. coli proceeds by a conservative mechanism. C) DNA synthesis in E. coli proceeds by a semiconservative mechanism. D) DNA synthesis in E. coli proceeds by a dispersive mechanism. E) newly synthesized DNA strands in E. coli are not methylated.

_A__2. Which statement about enzymes that interact with DNA is TRUE?

A) E. coli DNA polymerase I possesses a 5' to 3' polymerase activity. B) E. coli DNA polymerase I possesses a 3' to 5' polymerase activity. C) Endonucleases degrade circular but not linear DNA molecules. D) Endonucleases degrade DNA only at a free end. E) EcoRI can cleave DNA in deionized water.

_E__3. The proofreading function of DNA polymerase does not involve:

A) a 3' to 5' exonuclease. B) magnesium ions. C) detection of mismatched base pairs. D) phosphodiester bond hydrolysis. E) reversal of the polymerization reaction.

_D__4. The Ames test is used to:

A) detect bacterial viruses. B) determine the rate of DNA replication. C) examine the potency of antibiotics. D) measure the mutagenic effects of various chemical compounds. E) quantify the damaging effects of UV light on DNA molecules.

_D__5. When bacterial DNA replication introduces a mismatch in a double-stranded DNA, the methyl-directed repair system:

A) cannot distinguish the template strand from the newly replicated strand. B) changes both the template strand and the newly replicated strand. C) corrects the DNA strand that is methylated. D) corrects the mismatch by changing the newly replicated strand.

9

E) corrects the mismatch by changing the template strand.

_B__6. In the semiconservative model of DNA replication, how many rounds of replication would result in a 50% light, 50%

intermediate and 0% dense DNA in the Meselson and Stahl experiment? A) one B) two C) three D) four E) five

_A__7. In the semiconservative model, how many rounds of replication would result in a 0% light, 100% intermediate and

0% dense DNA in the Meselson and Stahl experiment? A) one B) two C) three D) four E) five

_D_8. Which does NOT describe the nucleotide addition reaction catalyzed by E. coli DNA Pol III?

A) the 3¢ OH of the newly synthesized strand is activated by a magnesium cation B) a phosphate group is precisely positioned C) the protein interacts with base-pair in the major groove D) the protein stabilizes the charges of all three phosphates on the substrate E) multiple magnesium ions are involved.

_A/B_9. RNA polymerase:

A) can interact with DNA that is thousands of base pairs away from the DNA to be transcribed. B) can initiate RNA synthesis without a primer. C) can also replicate DNA. D) separates DNA strands throughout a long region of DNA (up to thousands of bp), then copies one of them. E) synthesizes RNA chains in the 3’ to 5' direction.

_B__10. After binding by E. coli RNA polymerase, the correct order of events for transcription initiation is:

A) closed complex formation, open complex formation, promoter clearance, start of RNA synthesis. B) closed complex formation, open complex formation, start of RNA synthesis, promoter clearance. C) open complex formation, closed complex formation, start of RNA synthesis, promoter clearance. D) start of RNA synthesis, closed complex formation, open complex formation, promoter clearance. E) start of RNA synthesis, open complex formation, closed complex formation, promoter clearance.

_A__11. Which statement about E. coli RNA polymerase (core enzyme) is FALSE?

A) It can start new chains de novo or elongate old ones. B) It has no catalytic activity unless the sigma factor is bound. C) It uses nucleoside 5'-triphosphates as substrates. D) Its activity is blocked by rifampicin. E) Its RNA product will hybridize with the DNA template.

_B__12. Processing of a primary mRNA transcript in a eukaryotic cell does NOT normally involve:

A) attachment of a long poly(A) sequence at the 3' end. B) conversion of normal bases to modified bases, such as inosine and pseudouridine. C) excision of intervening sequences (introns). D) joining of exons. E) methylation of one or more guanine nucleotides at the 5' end.

_C__13. The 5'-terminal cap structure of eukaryotic mRNAs is a(n):

A) 7-methylcytosine joined to the mRNA via a 2',3'-cyclic linkage. B) 7-methylguanosine joined to the mRNA via a 5' to 3' diphosphate linkage. C) 7-methylguanosine joined to the mRNA via a 5’ to 5' triphosphate linkage. D) N6-methyladenosine joined to the mRNA via a 5’ to 5' phosphodiester bond. E) O6-methylguanosine joined to the mRNA via a 5’ to 5' triphosphate linkage.

_D__14. What acts as the nucleophile in the mechanism of nucleotide addition by RNA polymerase?

A) the 5’ phosphate of an incoming nucleotide B) a water molecule

10

C) a 5’ hydroxyl of the template DNA D) a 3’ hydroxyl from the RNA being extended E) an aspartate in the active site

_A__15. Which statement most completely describes a difference between prokaryotic and eukaryotic mRNA transcription?

A) Prokaryotic transcripts are often translated cotranscriptionally, while eukaryotic transcripts are not. B) Prokaryotic transcripts are often edited, while eukaryotic transcripts are not. C) Prokaryotic transcripts often include multiple protein-coding sequences, while eukaryotic transcripts do not. D) Prokaryotic transcripts are often translated cotranscriptionally, while eukaryotic transcripts are not, and prokaryotic transcripts are often edited, while eukaryotic transcripts are not . E) Prokaryotic transcripts are often translated cotranscriptionally, while eukaryotic transcripts are not, and prokaryotic transcripts often include multiple protein-coding sequences, while eukaryotic transcripts do not.

_E__16. For RNA polymerase II to create a transcript, what is not necessary? A) magnesium B) NTPs C) topoisomerases D) template E) All of these are necessary.

_C__17. Which of the following are not common features of transcription promotors in E. coli. A) A promoter is a region of DNA that initiates transcription. B) A promoter contains two consensus sequences at −10 (TATAAT) and −35 (TTGACA). C) A promoter contains a G-C−rich upstream promoter element between −40 and −60. D) RNA polymerase binds at a promoter. E) Promotor sequences affect levels of gene-expression.

_D__ 18. During translation, a single nucleotide change in mRNA could possibly cause

A) no change in amino acid sequence B) a single amino acid substitution C) a premature stop codon D) all of the possibilities A-C E) none of the possibilities A-C

_C__ 19. What is the molecular weight of a protein that is encoded by a 1200 nucleotide gene from the archaeon Haloarcula marismortui. Assume the average molecular weight of an amino acid is 110 Daltons.

A) 1.2 kD B) 132 kD C) 44 kD D) 32 KD E) Cannot be determined from the information provided

_E__ 20. What is the molecular weight of a protein that is encoded by a 1200 nucleotide gene from Homo sapiens. Assume

the average molecular weight of an amino acid is 110 Daltons. A) 1.2 kD B) 132 kD C) 44 kD D) 32 KD E) Cannot be determined from the information provided

_B__ 21. Which of these statements is correct?

A) The ribosome is composed of a large protein subunit and a small rRNA subunit. B) Peptidyl transfer is catalyzed by rRNA only, not by protein. C) There are hundreds of ribosomes in an E. coli. D) The decoding center is directly adjacent to the peptidyl transferase center. E) rRNA is decoded into protein.

_D__ 22. Which statement about aminoacyl-tRNA synthetases is FALSE? A) At least some of these enzymes have an editing/proofreading capability. B) These enzymes attach an amino acid to the 3' end of a tRNA. C) These enzymes hydrolyze ATP. D) These enzymes will use any tRNA species but are highly specific for a given amino acid. E) There is a different synthetase for every amino acid.

_A__ 23. Which of these statements is false?

A) Translation occurs in most living systems and dominates the universal gene set of life (which are genes shared by all living systems).

11

B) Elements of the translation system are universally conserved in sequence, three-dimensional structure and function. C) The translation system contains exact molecular replicas of pre-biological assemblies. D) The translation system is a nexus, dominating the interactome in centrality, size and complexity. E) Translation consumes the bulk of cellular resources and defines biological productivity.

_D/E_ 24. Which statement describes a feature of the wobble hypothesis?

A) A single tRNA can read both arginine and lysine codons. B) Each tRNA can recognize only one codon. C) Some tRNAs can recognize codons that specify two different amino acids if both are nonpolar. D) A wobble pair is between two nucleotides that do not follow Watson-Crick base pair rules. E) The “wobble” occurs only in the first base of the anticodon.

25. (4 points) The table below contains several errors. Correct the four errors.

26. (4 points) The DNA below is replicated from left to right. Label the templates for leading strand and lagging strand synthesis. (5') ACTTCGGATCGTTAAGGCCGCTTTCTGT…. leading strand (3') TGAAGCCTAGCAATTCCGGCGAAAGACA… lagging strand 27. (6 points) Diagram the reaction catalyzed by a DNA polymerase. Correctly represent the

chemical structures and locations of the strand termini, the incoming dNTPs and the ions. Use arrows to show the rearrangements of electrons.

12

28. (6 points) tRNA: Correctly place all the secondary structure labels (D loop, T loop, anticodon etc.) on the three-dimensional structure.

29. (6 points) Write out the peptidyl transferase reaction. Show the CCA tails of A, P and E site tRNAs. Indicate the nucleophile

and the direction of electron flow. Do not draw the chemical structures of the CCA, except to indicate connection to other components.

13

30. (10 points) Fill in the boxes in the image below.

31. What was your favorite topic in this class?