5
Cell differentiation asing on ACTB expressio

AIM Detect mouse and human ACTB gene in two co- cultured cell liens Cell Lines: MEF – Mus muscullus embroynic fibroblasts Cells infected with SV40 polyomavirus

Embed Size (px)

Citation preview

Page 1: AIM Detect mouse and human ACTB gene in two co- cultured cell liens Cell Lines: MEF – Mus muscullus embroynic fibroblasts Cells infected with SV40 polyomavirus

Cell differentiation basing on ACTB expression

Page 2: AIM Detect mouse and human ACTB gene in two co- cultured cell liens Cell Lines: MEF – Mus muscullus embroynic fibroblasts Cells infected with SV40 polyomavirus

AIM• Detect mouse and human ACTB gene in two co-

cultured cell liens

Cell Lines:MEF – Mus muscullus embroynic fibroblasts

Cells infected with SV40 polyomavirus. LargeT antigen(protein) is believed to bind and limit p53 activity – transcription factor responsible for cell death

Page 3: AIM Detect mouse and human ACTB gene in two co- cultured cell liens Cell Lines: MEF – Mus muscullus embroynic fibroblasts Cells infected with SV40 polyomavirus

AIM• Detect mouse and human ACTB gene in two co-

cultured cell liens

Cell Lines:BjhTERT – Homo sapiens sapiens fibroblast

immortalised with hTERT (human telomere reverse transcriptase)

Page 4: AIM Detect mouse and human ACTB gene in two co- cultured cell liens Cell Lines: MEF – Mus muscullus embroynic fibroblasts Cells infected with SV40 polyomavirus

CCTCAATGCTGCTGCTGTACTAC

TGCGTCTATTTAGTGGAGCC

Cy3

Cy5

AGCCTCGCCTTTGCCTTCCTTTTACGACCTCAATGCTGCTGCTGTACTACTCTTCGCCCCGCGAGCACAG TTACACCCTTTCTTTGACAATCCGAGTAGTCTTTGTGCGTCTATTTAGTGGAGCCGCAACTATCTTCTTTGACTGTTACTGAGCTGCGTT

Page 5: AIM Detect mouse and human ACTB gene in two co- cultured cell liens Cell Lines: MEF – Mus muscullus embroynic fibroblasts Cells infected with SV40 polyomavirus

No primer given for mouse ACTB padlock. We will use random priming ! (random decamers : 10 bases oligos)