Upload
ngokien
View
220
Download
3
Embed Size (px)
Citation preview
Hindawi Publishing CorporationStem Cells InternationalVolume 2013 Article ID 372164 9 pageshttpdxdoiorg1011552013372164
Research ArticleAge-Related Yield of Adipose-Derived Stem Cells Bearingthe Low-Affinity Nerve Growth Factor Receptor
Raquel Cuevas-Diaz Duran1 Maria Teresa Gonzaacutelez-Garza1 Alejandro Cardenas-Lopez2
Luis Chavez-Castilla1 Delia Elva Cruz-Vega1 and Jorge E Moreno-Cuevas1
1 Cell Therapy Department School of Medicine Tecnologico de Monterrey Avenue Morones Prieto 3000 Pte64710 Monterrey NL Mexico
2Neomedic Plastic Surgery Center Rio Guadalquivir 301 Ote San Pedro Garza Garcia 66220 Monterrey NL Mexico
Correspondence should be addressed to Maria Teresa Gonzalez-Garza mtgonzalezgarzaitesmmx
Received 4 September 2013 Revised 18 October 2013 Accepted 23 October 2013
Academic Editor B Bunnell
Copyright copy 2013 Raquel Cuevas-Diaz Duran et al This is an open access article distributed under the Creative CommonsAttribution License which permits unrestricted use distribution and reproduction in any medium provided the original work isproperly cited
Adipose-derived stem cells (ADSCs) are a heterogeneous cell population that may be enriched by positive selection with antibodiesagainst the low-affinity nerve growth factor receptor (LNGFR or CD271) yielding a selective cell universe with higher proliferationand differentiation potential This paper addresses the need for determining the quantity of ADSCs positive for the CD271receptor and its correlation with donorrsquos age Mononuclear cells were harvested from the lower backs of 35 female donors andpurified using magnetic beads Multipotency capacity was tested by the expression of stemness genes and through differentiationinto preosteoblasts and adipocytes A significant statistical difference was found in CD271+ concentrations between defined ageintervalsThe highest yield was found within women on the 30ndash40-year-old age range CD271+ ADSCs from all age groups showeddifferentiation capabilities as well as expression of typical multipotent stem cell genes Our data suggest that the amount of CD271+cells correlates inversely with age However the ability to obtain these cells was maintained through all age ranges with a yieldhigher than what has been reported from bone marrow Our findings propose CD271+ ADSCs as the primary choice for tissueregeneration and autologous stem cell therapies in older subjects
1 Introduction
It has been demonstrated that adipose tissue represents anabundant source of mesenchymal stem cells as well as thoseobtained from bone marrow Furthermore adipose-derivedstem cells (ADSCs) have similar differentiation capabilitymorphology and phenotype as mesenchymal stem cellscollected from umbilical cord blood or bone marrow [1ndash5]
ADSCs like bone marrow derived stem cells adhere toplastic producing fibroblast-like colonies have a high prolif-erative capacity express common surface antigens and candifferentiate in vitro and in vivo toward cells of mesodermallineage [6] Also ADSCs have the ability to be induced intocells derived from all three germ layers [6ndash10] and are capableof suppressing immunoreactivity [11] making them ideal forstem cell-based therapies
A typical ADSCs extraction protocol yields heteroge-neous cell populations which may be homogenized through
culture However time and culture conditions may causechanges in their phenotype due to sequential differences inantigen expression [12] A homogeneous fully characterizedADSCs population is desirable for use in clinical applicationsan event that can be reached using antibodies [13]
Different cell surface receptors such as the low-affinitynerve growth factor receptor (CD271) have been used as tar-gets for ADSCs antibody based isolation This cell surfacemarker defines a mesenchymal stem cell (MSC) subpopula-tion and has been used for the enrichment of cells collectedfrom bone marrow aspirates [13 14] and lipoaspirates [15]Jones and McGonagle [16] demonstrated that the CD271antigen is one of the most selective markers for enrichingMSC from human bone marrow Bone marrow MSCpositive for CD271 antigen have a 10- to 1000-fold higherproliferative capacity when compared to MSC isolated byplastic adherence [13] and have both immunosuppressive and
2 Stem Cells International
lymphohematopoietic engraftment-promoting properties[17] Similarly CD271+ cells immunomagnetically selectedfrom ADSCs showed a higher clonogenic and differentiationpotential compared to plastic adherent ADSCs [15] Addi-tionally Yamamoto et al [18] isolated CD271+ cells frommouse subcutaneous adipose tissue and demonstrated thattheir differentiation capability into adipocytes osteoblastsand neuronal cells was higher when compared to plasticadherent ADSCs
These findings suggest that CD271+ ADSCs are an excel-lent homogeneous subset of stem cells for clinical applica-tionsThis studyrsquos aim is to determine if there is a relationshipbetween donorrsquos age and CD271+ cell yield in freshly isolatedADSCs Also stem cell gene expression in CD271+ ADSCswill be addressed in order to verify their multipotency
2 Material and Methods
21 Patients and Tissue Sampling Thirty-five female healthypatients aged between 30 and 65 years undergoing cosmeticliposuction at NeoMedics (Monterrey Nuevo Leon Mexico)participated in our study Five sampleswere used for verifyingprevious reports where areas of higher cellular densities weredetermined and the rest were used for age correlation assess-ment Adipose tissue from this group was obtained frominner thigh trochanteric region lower back and abdomenin order to corroborate the best area for sample collectionExclusion criteria included diabetes mellitus allergies pre-vious liposuctions medication or vitamin intake two weeksbefore surgery hematologic disorders lipodystrophies mor-bid obesity and chronic use of corticoids For age correlationstudies 120mL of adipose tissue was harvested from 30donors within the following age periods 30ndash40 (119899 = 10) 41ndash50 (119899 = 10) and 51ndash65 (119899 = 10) Donorsrsquo body mass indexeswere within the same range (mean = 23 standard deviation= 158) Lipoaspirates were obtained under written informedconsent and all procedures were performed by the same plas-tic surgeon using the tumescent technique This techniqueconsists of infiltration of the fat compartment with a largevolume of a highly diluted local anesthetic and epinephrinesolution for induction of vasoconstriction Under generalanesthesia patients were infiltrated locally with Klein solu-tion consisting of 01 lidocaine 10mg of sodium bicar-bonate and epinephrine diluted 1 1000000 in 1000mLsterile physiologic normal saline Liposuction was performedusing a vacuum system connected to blunt-ended cannulas(Mentor California USA) with a diameter of 21mm and alength of 15 cm Fat was removed 10min after infiltration
Cell density determination and characterization studieswere performed with samples obtained from abdomen lowerback inner thigh and trochanteric regions
22 Cell Isolation and Culture ADSC isolation was per-formed as previously described by Zuk et al [19] Brieflyaspirated tissue was washed at least 3 times with phosphate-buffered saline (PBS Sigma-Aldrich St LouisMOUSA) and1 penicillin and streptomycin (Sigma-Aldrich) The pelletobtained from the first wash was collected and processedas described by Francis et al [20] Washed lipoaspirate
was digested with 01 collagenase type I-S (Sigma-Aldrich)dissolved in Hankrsquos buffer (Gibco Grand Island NY USA)Digestion took place in a shaker at 37∘C and 250 rpm during60min The enzyme was inactivated by adding an equalvolume of Dulbeccorsquos Modified Eaglersquos medium (DMEM-F12 Gibco) supplemented with 10 fetal bovine serum(FBS Gibco) Mature adipocytes and connective tissue wereseparated from pellets of mononuclear cells by centrifugationat 800 g for 10min Debris and dissociated tissue presentin pellets were eliminated through filtration using a 100 120583mcell strainer and washing with PBS All pellets were mixedand plated on a Ficoll-Paque (GE Healthcare Bio-SciencesPiscataway NJ USA) gradient to reduce erythrocyte con-tamination The collected mononuclear fraction was furtherwashed with PBS and filtered through a 40120583m cell strainer toremove debris and cell clumps
CD271+ cells were isolated using magnetic labeling beadsbearing an anti-CD271 antibody (MicroBead kit MiltenyiBiotec Gladbach Germany) Cells retained on the column(CD271+) and unlabeled cells (CD271minus) were counted using ahaemocytometer and samples of 3 times 105 cells were cultured in25 cm2 flasks with DMEM-F12 supplemented with 10 FBS50UmL penicillin and 50 120583gmL streptomycin
Cells were maintained at 37∘C and 50 CO2in humidi-
fied incubators Flasks were washedwith PBS andmedia werechanged completely every 3-4 days until reaching 70 con-fluence Maintenance medium consisted of DMEM-F12 sup-plemented with 5 FBS 50UmL penicillin and 50 120583gmLstreptomycin Cells were detachedwith 025Trypsin-EDTA(Gibco) and centrifuged at 375 g for 10min Trypsin-EDTAwas inactivated using DMEM-F12 supplemented with 20FBS The cell pellet was resuspended with maintenancemedium cells were quantified and plated on 12- and 24-wellmicroplates for RNA extraction and differentiation assaysrespectively or used directly for flow cytometry
23 Flow Cytometry To analyze the expression of specificsurface proteins one sample of 3 times 105 CD271+ ADSCs(passage 1) from each age range was incubated for 30minwith 20120583L of blocking reagent and 10 120583L of the following flu-orochrome conjugatedmonoclonal antibodies in appropriatecombinations CD34-PE CD45-FITC CD90-FITC CD105-PE and CD271-APC (BD Biosciences San Diego CA USA)After staining cells were washed with MACS-BSA stocksolution (Miltenyi Biotec Teterow Germany) centrifugedand resuspended in MACS-BSA Samples were evaluated bythe FACSCanto II Instrument and data was analyzed usingthe FACSDiva software (BD Biosciences)
24 Reverse-Transcription Polymerase Chain Reaction Sam-ples from three donors of each age range were used forgene analysis Total cellular RNA was isolated from 12 times 105cells using the GenElute Mammalian Total RNA MiniPrepKit (Sigma) Oligo (dT)-primed reverse transcription wasperformed using aliquots of 05 120583g of RNA as templatesAmplification was performed for the genes Sox2 Notch1Rex1 Oct4 Nanog and Nestin The housekeeping geneGAPDH was used as the assay basal amplification controlThe primers and annealing temperatures used are listed
Stem Cells International 3
Table 1 Primer sets and annealing temperatures used for reversetranscription PCR
Gene Primer sequence (51015840-31015840) Annealingtemperature
Sox2(fwd)(rev)
ACTTTTGTCGGAGACGGAGAGTTCATGTGCGCGTAACTGT 55∘C
Notch1(fwd)(rev)
TCACGCTGACGGAGTACAAGCCACACTCGTTGACATCCTG 55∘C
Rex1(fwd)(rev)
GGCGGAAATAGAACCTGTCACTTCCAGGATGGGTTGAGAA 55∘C
Oct4(fwd)(rev)
AGTGAGAGGCAACCTGGAGAACACTCGGACCACATCCTTC 55∘C
Nanog(fwd)(rev)
TTCCTTCCTCCATGGATCTGTCTGCTGGAGGCTGAGGTAT 55∘C
Nestin(fwd)(rev)
AACAGCGACGGAGGTCTCTATTCTCTTGTCCCGCAGACTT 60∘C
GAPDH(fwd)(rev)
GAGTCAACGGATTTGGTCGTTTGATTTTGGAGGGATCTCG 60∘C
Sox2 SRY (sex determining region Y)-box 2 Notch1 Notch homolog 1Oct4 octamer-binding transcription factor 4 GAPDH glyceraldehyde 3-phosphate dehydrogenase
in Table 1 Products were visualized by electrophoresis on15 agarose gels and images were acquired through a UVtransilluminator (DigiDoc-IT Cambridge UK)
25 Induced Differentiation To verify differentiation poten-tial CD271+ ADSCs were plated at passage 1 into 24-well microplates over poly-L-lysine (Sigma-Aldrich) coatedcoverslips at a density of 3 times 104 cellswell Cells were inducedinto preosteoblasts and adipocytes for a period of 21 daysInduction media were changed every 3 days
26 Osteogenic Differentiation The osteogenic medium con-sisted of 2mM 120573-glycerophosphate (Sigma-Aldrich) 1 nMdexamethasone (Sigma-Aldrich) and 50 120583M ascorbate-2-phosphate (Sigma-Aldrich) in 120572-MEM Basal Medium(Gibco) For fixing cells were washed with PBS and in-cubated in ice cold 70 ethanol for 1 hour at room tem-perature Cells were rinsed with water stained withAlizarin Red Solution (40mM pH 41 Sigma-Aldrich) for30min and washed with bidistilled water Extracellularcalcium mineralization was observed under a microscope(AxioImager Z1 fluorescent microscope)
27 Adipogenic Differentiation Adipogenic differentiationwas induced with 1120583M dexamethasone 200120583M indometha-cin (Sigma-Aldrich) 1mM isobutylmethylxan-thine (Sigma-Aldrich) and 10 120583Minsulin (Sigma-Aldrich) in120572-MEMBasalMedium For fixing cells were washed with cold PBS and
Table 2 Data gathered from 5 female patients 30ndash40 years old Dataexpressed in mean mononuclear cellsmL of initial fat sample
Donor site Mononuclear cellsmLInner thigh 130625 plusmn 5385Trochanteric 21333 plusmn 6308Lower back 40000 plusmn 9720Abdomen 38500 plusmn 8631
incubatedwith 10 formalin for 30min at room temperatureCells were air-dried before staining washed with PBS andincubated for 60min with 05 Oil Red O (Hycel JaliscoMexico) To avoid nonspecific staining samples were rinsedseveral times with PBS
28 Statistical Analysis Cell concentration distributionswere analyzed through means and standard deviationsModel fit was tested by analysis of residues and the dis-tributionrsquos normality was determined using the Shapiro-Wilk test and the Kolmogorov-Smirnov goodness of fit testA single factor ANOVA was used to analyze equality ofmeans between groups Group means were compared usingthe Tukey-Kramer method All analysis and graphs weredeveloped using the R programming language [21]
3 Results
31 Adipose-Derived Stem Cell Yield Meanmononuclear cellconcentrations per mL of starting adipose tissue for eachharvest site are shown in Table 2 A significant differencein cell counts (119875 value lt 00008) was found between lowerback and inner thigh donor sites Lower back and abdomenwere the sites with higher mononuclear cell counts and thereis no significant difference between their mean values (119875value = 0857) The difference between mean mononuclearcells counts from lower back and trochanteric is statisticallysignificant (119875 value lt 005)
To determine the proportion of ADSCs positive for theCD271 receptor and its relationship with age lipoaspiratesamples from the lower back of 10 female patients from eachage range were processed CD271+ ADSCs were isolated andcounted Proportions of CD271+ to CD271minus ADSCs for eachage range were calculated and the results are listed in Table 3Through a single factor ANOVA analysis mean CD271+ cellcounts differ between age groups with a 119875 value lt 0001
The box and whisker plots describing the distributionof the CD271+ ADSC concentration for each age range aredepicted in Figure 1(b) Each box plot shows the medianCD271+ ADSC count calculated for each age group aswell as the lower and upper quartiles The 30ndash40-year-oldrange had the highest CD271+ ADSC concentration and wassignificantly different to the amounts obtained from the 41ndash50-year-old range with a 119875 value = 001 and to the age range51ndash65 with a 119875 value lt 0001 as calculated with the Tukey-Kramer test The difference between the CD271+ cell countsbetween the age ranges 41ndash50 and 51ndash65 was also significantwith a 119875 value = 000845 With respect to the analysis of
4 Stem Cells International
R2= 071
P = 4195162e minus 09
y = minus23064x + 1835581
CD271+
(cel
lsm
L)
1200
1000
800
600
400
Donorrsquos age30 35 40 45 50 55 60 65
(a)
CD271+
(cel
lsm
L)
1200
1000
800
600
400
Donorrsquos age35 45 55
(b)
Figure 1 Frequency of CD271+ ADSCs per mL of initial adipose tissue taken from the lower backs of 30 healthy female donors with similarbody mass index (a) Distribution of CD271+ stem cellmL of initial adipose tissue and donorrsquos age Data appear normal and a straight line isadjusted with a goodness of fit of 1198772 = 071 The fitted regression equation and its 119875 value are shown (b) Box and whisker plots representingthe median lower and upper quartiles of CD271+ ADSC yieldmL of processed adipose tissue for each age range
Table 3 Data gathered from 10 female patients per age rangeSamples were obtained from lower back Data is expressed as meanplusmn standard deviation of CD271minus and CD271+ cellsmL of initial fatsample
Donorrsquos age CD271minuscellsmL
CD271 +
cellsmL CD271 +CD271minus
30ndash40 34189 plusmn 8190 991 plusmn 205 28941ndash50 33733 plusmn 5100 789 plusmn 104 23351ndash65 32619 plusmn 4607 595 plusmn 146 182
variance model data appeared normal and adjusted to astraight line with a goodness of fit of 1198772 = 071 (Figure 1(a))Normalitywas verified by theKolmogorov-Smirnov test (119863 =1) and the Shapiro-Wilk test (119875 = 0078)
32 Surface Protein Expression by Flow Cytometry AnalysisMore than 90 of cultured CD271+ ADSCs from all ageranges were positive for stem cell markers CD90 and CD105There was no expression of the hematopoietic marker CD45Approximately 70 of CD271+ passage 1 ADSC yieldedpositive for CD271 indicating that this marker is diminishedin culture The expression of CD34 is variable with a meanvalue of 852 The percentage of mean maker incidence isshown inTable 4 Flow cytometric analysis histograms for cellsurface marker expressions are shown in Figure 2
33 Multidifferentiation Potential The differentiation poten-tial of CD271+ ADSCs was tested using the induction mediafor 21 days Morphological changes with respect to a controlwithout induction are shown in Figure 3 Cells induced
Table 4 Mean expression of cell surface CD markers of CD271+ADSCs passage one
Antibody Conjugate Mean CD271+ cellsmLCD271+ APC 709CD90+CD105+ FITCPE 99CD45minusCD105+ FITCPE 985CD45minus FITC 996CD34+ PE 852
into adipocytes showed intracellular lipid filled vacuoles andexhibited an expanded volume (Figure 3(b))The amount andsize of intracellular lipid vacuoles increased with time After21 days of incubation in adipogenicmediumOil Red stainingwas used to unveil lipid droplets in red color Cells incubatedwith osteogenic induction media appeared polygonal inshape (Figure 3(c)) Extracellular calcium deposition wasdemonstrated at day 21 byAlizarinRed staining (Figure 3(d))Control cells without induction lacked red stain
34 Transcription Factor Expression With respect to geno-types CD271+ ADSCs expressed mRNA for the stem cellgenes Sox2 Notch1 Rex1 Oct4 Nanog and Nestin
Although the selected stem cell genes were expressed onthe samples from the three groups there was a variationbetween the groups and among subjects of the same groupVariations were not significant in patients from 30 to 50 yearsold however on subjects from the older group there wasa decrease on the expression of all the analyzed genes Arepresentative gel image of the RT-PCR products from thethree groups is shown in Figure 4
Stem Cells International 5
CD271 control tube250
200
150
100
50
SSC-
A
times1000
times1000
P1
50 100 150 200 250FSC-A
(a)
CD271APC
Cou
nt
90
80
70
60
50
40
30
20
10
0
APC-A10
210
310
410
5
(b)
CD45FITCCD105PE
Cou
nt
908070605040302010
0
FITC-A10
210
310
410
5
(c)
CD45FITCCD105PE
Cou
nt150
100
50
0
PE-A10
210
310
410
5
(d)
CD34PECD45FITC
Cou
nt
70
60
50
40
30
20
10
0
PE-A10
210
310
410
5
(e)
CD90FITCCD105PE
Cou
nt
125
100
75
50
25
0
FITC-A10
210
310
410
5
(f)
Figure 2 Representative results of flow cytometry analysis are shown for samples of 3 times 105 CD271+ ADSCs passage 1 from a 42-year-olddonor (a) The CD271+ ADSC population indicated with gage P1 comprises 754 of the 10000 events analyzed (b) Histogram showingthat 73 of cells from gage P1 yield positive for the CD271-APC receptor (c) Histogram depicting that the CD271+ ADSC population isnegative for CD45-FITC receptor (d) Histogram demonstrating that the CD271+ ADSC population is positive for the CD105-PE receptor (e)The histogram shows that 87 of the CD271+ ADSC population is positive for the CD34-PE (f) Histogram demonstrating that 97 of theCD271+ ADSC population yields positive for the CD90-FITC receptor
6 Stem Cells International
(a) (b)
(c) (d)
Figure 3 Morphological changes through different induction media (a) CD271+ ADSCs passage 1 after 21 days in culture without induction(20x) (b) Morphological changes visible at day 21 of adipogenic differentiation (20x) (c) Osteogenic differentiation observed at inductionday 21 (20x) (d) Microphotograph showing extracellular mineralization unveiled through Alizarin Red staining in CD271+ ADSCs after 21days of osteogenic induction (20x)
GADPH Nestin Nanog Sox2Notch1Rex1Oct40000
0200
0400
0600
0800
1000
1200
Nestin Nanog Oct4 Rex1 Notch1 Sox2
(a)
(b)
(c)
(d)
Group age 30ndash40Group age 41ndash50
Group age 51ndash65
GADPH
rela
tive a
ctiv
ity
Figure 4 Gene expression analysis The upper image shows a representative agarose gel electrophoresis showing the expression of selectedstem cell genes from the following donor age groups (a) 30ndash40 years old (b) 41ndash50 years old and (c) 51ndash65 years old (d) shows the averageof the GADPH relative gene expression and the error bars indicate the standard deviation in samples from the same age group
Stem Cells International 7
4 Discussion
Adult stem cells can be isolated from various tissue sourcesbone marrow being the most widely used in clinical applica-tionsThe commonproblem in isolating adult stem cells is thelow yield and the limited amount of tissue to harvest fromRecently researchers found that the frequency of stem cellswithin adipose tissue is approximately 8-fold higher than inbone marrow [22] Our results demonstrated that lower backand abdomen were the sites with the highest mononuclearcell concentrations in agreement with the results reported byPadoin et al [23]
Cells harvested from the stromal vascular fraction com-prise a heterogeneous population including preadipocytesadipocytes pericytes endothelial cells ADSCs fibroblastsmonocytes macrophages and lymphocytes [10] respondingdifferently to stimuli For the above it is important to reducecell heterogeneity before the use of adipose-derived stemcells for regenerative therapies Exposing a heterogeneouspopulation of stem cells to an inductionmediummight resultin subpopulations undergoing differentiation into differentlineages which could decrease its effectiveness Thereforethe use of monoclonal antibodies has been proposed forstem cell isolation and selection in order to decrease thisheterogeneity
Recently CD271 (LNGFR) has been described as theoptimal selective marker for the purification and isolation ofADSCs [15] and bonemarrow derived stem cells [13 14] Cellsbearing this receptor have a higher multipotency and prolif-erative capability when compared to the whole populationof unselected ADSCs Studies performed at our laboratoryhave demonstrated that the expression of CD271 decreaseswith culture time perhaps induced by plastic adherence andculture conditions Such results are in agreement with whatwas found for bonemarrowderived stem cells leadingQuiriciet al [13] to the hypothesis that CD271 might be a marker forresting primitive MSC
Cultured CD271+ ADSCs from all age groups studiedwere positive for stem cellmarkersThy1 (CD90) and endoglin(CD105) No expression was found for the hematopoieticmarker CD45 Positive expression of CD90 and CD105 aswell as negative expression of CD45 is some of the minimalcriteria for stem cells definition proposed by the Mes-enchymal and Tissue Stem Cell Committee of the Interna-tional Society for Cellular Therapy [24] Our results showedthat CD271+ ADSCs samples from all groups includingthose from older patients express the core transcriptionfactors associated with cell self-renewal Sox2 Oct4 andNanog [25ndash29] Similarly CD271+ ADSCs samples expressedRex1ZFP42 a known marker of pluripotency [30] andNotch1 a receptor of the Notch signaling pathway whichplays a role in stem cell self-renewal and differentiation [31]CD271+ ADSCs highly expressed Nestin a gene responsiblefor synthesizing nestin an intermediate cytoskeletal proteinwhich has been related with proliferative cells in whichspeedy cytoskeleton organization is vital [32] A reductionin these genesrsquo expression was seen in donors from the olderage range suggesting that in older subjects the stemness geneexpressions decrease however remain active and give the
possibility to respond to any induction Nevertheless it isimportant to perform several induction protocols in orderto establish its potential capability
Studying CD271+ ADSCs is important for elucidating therelationship between the CD271 receptor with multipotencyand proliferation as compared to CD271minus ADSCs SinceCD271+ ADSCs are a subset of mononuclear cells it is safeto correlate CD271+ concentrations with the size of mononu-clear cell populations We found the highest concentration ofmononuclear cells in the patients in the range of 30ndash40 yearsas well as CD271+ ADSCs
The cell distribution behaved similarly decreasing bothwith age Our results show that there is a significant statisticaldifference between the CD271+ ADSCs concentrations foreach age group range with the 30ndash40-year-old range contain-ing the highest cell concentration Data appeared normal anda straight line was fitted indicating that there is a correlationbetween the CD271+ ADSCs concentration and age Weattribute this correlation to a decrease in stem cell numberThis finding is similar to what was found by Yamada et al[33] who concluded that the number of ADSCs positive forCD271 per adipose tissue weight decreased in aged mice
The proportion of cells bearing the CD271 receptor ascompared tomononuclear cells decreased bymore than 30from the youngest age group (30ndash40) to the oldest group(51ndash65) Such a decrease is less than what was found byStolzing et al [34] whodetermined that the number of colonyforming unit fibroblasts (CFU-Frsquos) formed by bone marrowMSC declined by more than 50 from the youngest to theaged subjects
The frequency of CD271+ ADSCs found per mL oflipoaspirate is higher than what has been reported in bonemarrow aspirates The average lowest proportion of CD271+to CD271minus ADSCs obtained in our study was 18 while therelation of CD271+ MSC from bone marrow was 034 inQuirici et al [13] 028 inCox et al [35] and 00017ndash00201in Alvarez-Viejo et al studies [36] In this sense a hallmark ofour study is that regarding frequency CD271+ ADSCs are abetter source of donor cells for stem cell-based therapies andtissue engineering
In conclusion our results suggest that the proportion ofCD271+ ADSCs isolated from lower back decreases with agehowever cells positive for this marker were present in all ourage groups and their frequency was higher than what hasbeen found in bone marrowThese findings strongly proposeCD271+ ADSCs homogeneous subpopulations as the primarycollection choice for tissue regeneration and for autologousstem cell therapies in older subjects
Abbreviations
ADSCs Adipose-derived stem cellsLNGFR CD271 Low-affinity nerve growth factor receptorMSC Mesenchymal stem cell
Conflict of Interests
The authors have no financial interest to declare in relation tothe content of this paper
8 Stem Cells International
Acknowledgments
The authors wish to acknowledge Dr Victor TrevinoAlvarado for his valuable observations and assistance withdata analysis They are also indebted to the InstitutoTecnologico de Estudios Superiores de Monterrey theZambrano-Hellion Foundation and CONACYT for thePhD student grant
References
[1] D A De Ugarte K Morizono A Elbarbary et al ldquoComparisonof multi-lineage cells from human adipose tissue and bonemarrowrdquo Cells Tissues Organs vol 174 no 3 pp 101ndash109 2003
[2] S Kern H Eichler J Stoeve H Kluter and K BiebackldquoComparative analysis of mesenchymal stem cells from bonemarrow umbilical cord blood or adipose tissuerdquo StemCells vol24 no 5 pp 1294ndash1301 2006
[3] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[4] H J Jin Y K Bae M Kim et al ldquoComparative analysis ofhuman mesenchymal stem cells from bone marrow adiposetissue and umbilical cord blood as sources of cell therapyrdquoInternational Journal of Molecular Sciences vol 14 no 9 pp17986ndash18001 2013
[5] Y Zhu T Liu K Song X Fan X Ma and Z Cui ldquoAdipose-derived stem cell a better stem cell than BMSCrdquo Cell Biochem-istry and Function vol 26 no 6 pp 664ndash675 2008
[6] P A Zuk ldquoThe adipose-derived stem cell looking back andlooking aheadrdquoMolecular Biology of the Cell vol 21 no 11 pp1783ndash1787 2010
[7] M Locke J Windsor and P R Dunbar ldquoHuman adipose-derived stem cells isolation characterization and applicationsin surgeryrdquo ANZ Journal of Surgery vol 79 no 4 pp 235ndash2442009
[8] H Mizuno ldquoAdipose-derived stem cells for tissue repair andregeneration ten years of research and a literature reviewrdquoJournal of NipponMedical School vol 76 no 2 pp 56ndash66 2009
[9] H Mizuno M Tobita and A C Uysal ldquoConcise reviewadipose-derived stem cells as a novel tool for future regenerativemedicinerdquo Stem Cells vol 30 no 5 pp 804ndash810 2012
[10] A Schaffler and C Buchler ldquoConcise review adipose tissue-derived stromal cellsmdashbasic and clinical implications for novelcell-based therapiesrdquo StemCells vol 25 no 4 pp 818ndash827 2007
[11] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[12] P C Baer ldquoAdipose-derived stem cells and their potentialto differentiate into the epithelial lineagerdquo Stem Cells andDevelopment vol 20 no 10 pp 1805ndash1816 2011
[13] NQuirici D Soligo P Bossolasco F Servida C Lumini andGL Deliliers ldquoIsolation of bone marrow mesenchymal stem cellsby anti-nerve growth factor receptor antibodiesrdquo ExperimentalHematology vol 30 no 7 pp 783ndash791 2002
[14] E A Jones A English S E Kinsey et al ldquoOptimization of aflow cytometry-based protocol for detection and phenotypiccharacterization of multipotent mesenchymal stromal cells
from human bone marrowrdquo Cytometry B vol 70 no 6 pp 391ndash399 2006
[15] N Quirici C Scavullo L De Girolamo et al ldquoAnti-L-NGFRand -CD34 monoclonal antibodies identify multipotent mes-enchymal stem cells in human adipose tissuerdquo Stem Cells andDevelopment vol 19 no 6 pp 915ndash925 2010
[16] E Jones and D McGonagle ldquoHuman bone marrow mesenchy-mal stem cells in vivordquo Rheumatology vol 47 no 2 pp 126ndash1312008
[17] Z Kuci S Kuci S Zircher et al ldquoMesenchymal stromal cellsderived from CD271+ bone marrow mononuclear cells exertpotent allosuppressive propertiesrdquo Cytotherapy vol 13 no 10pp 1193ndash1204 2011
[18] N Yamamoto H Akamatsu S Hasegawa et al ldquoIsolation ofmultipotent stem cells from mouse adipose tissuerdquo Journal ofDermatological Science vol 48 no 1 pp 43ndash52 2007
[19] P A Zuk M Zhu H Mizuno et al ldquoMultilineage cells fromhuman adipose tissue implications for cell-based therapiesrdquoTissue Engineering vol 7 no 2 pp 211ndash228 2001
[20] M P Francis P C Sachs LW Elmore and S E Holt ldquoIsolatingadipose-derived mesenchymal stem cells from lipoaspirateblood and saline fractionrdquo Organogenesis vol 6 no 1 pp 11ndash14 2010
[21] The R Project for Statistical Computing httpwwwr-projectorg
[22] B M Strem K C Hicok M Zhu et al ldquoMultipotential differ-entiation of adipose tissue-derived stem cellsrdquo Keio Journal ofMedicine vol 54 no 3 pp 132ndash141 2005
[23] A V Padoin J Braga-Silva P Martins et al ldquoSources ofprocessed lipoaspirate cells influence of donor site on cellconcentrationrdquo Plastic and Reconstructive Surgery vol 122 no2 pp 614ndash618 2008
[24] M Dominici K Le Blanc I Mueller et al ldquoMinimal crite-ria for defining multipotent mesenchymal stromal cells TheInternational Society for Cellular Therapy position statementrdquoCytotherapy vol 8 no 4 pp 315ndash317 2006
[25] I Chambers D Colby M Robertson et al ldquoFunctional expres-sion cloning of Nanog a pluripotency sustaining factor inembryonic stem cellsrdquo Cell vol 113 no 5 pp 643ndash655 2003
[26] A Gagliardi N P Mullin Z Ying Tan et al ldquoA direct physicalinteraction between Nanog and Sox2 regulates embryonic stemcell self-renewalrdquo The EMBO Journal vol 32 no 16 pp 2231ndash2247 2013
[27] SMasui Y Nakatake Y Toyooka et al ldquoPluripotency governedby Sox2 via regulation of Oct34 expression in mouse embry-onic stem cellsrdquo Nature Cell Biology vol 9 no 6 pp 625ndash6352007
[28] V Karwacki-Neisius J Goke R Osorno et al ldquoReducedOct4 expression directs a robust pluripotent state with distinctsignaling activity and increased enhancer occupancy by Oct4and Nanogrdquo Cell Stem Cell vol 12 no 5 pp 531ndash545 2013
[29] S J Bray ldquoNotch signalling a simple pathway becomes com-plexrdquo Nature Reviews Molecular Cell Biology vol 7 no 9 pp678ndash689 2006
[30] M Y Son H Choi Y M Han et al ldquoUnveiling the criticalrole of REX1 in the regulation of human stem cell pluripotencyrdquoStem Cells 2013
[31] J Liu C Sato M Cerletti and A Wagers ldquoNotch signalingin the regulation of stem cell self-renewal and differentiationrdquoCurrent Topics in Developmental Biology vol 92 pp 367ndash4092010
Stem Cells International 9
[32] K Michalczyk and M Ziman ldquoNestin structure and predictedfunction in cellular cytoskeletal organisationrdquo Histology andHistopathology vol 20 no 2 pp 665ndash671 2005
[33] T Yamada H Akamatsu S Hasegawa et al ldquoAge-relatedchanges of p75Neurotrophin receptor-positive adipose-derivedstem cellsrdquo Journal of Dermatological Science vol 58 no 1 pp36ndash42 2010
[34] A Stolzing E Jones D McGonagle and A Scutt ldquoAge-relatedchanges in human bone marrow-derived mesenchymal stemcells consequences for cell therapiesrdquoMechanisms ofAgeing andDevelopment vol 129 no 3 pp 163ndash173 2008
[35] G Cox S A Boxall P V Giannoudis et al ldquoHigh abundance ofCD271+ multipotential stromal cells (MSCs) in intramedullarycavities of long bonesrdquo Bone vol 50 no 2 pp 510ndash517 2012
[36] M Alvarez-Viejo Y Menendez-Menendez M A Blanco-Gelazet al ldquoQuantifyingmesenchymal stem cells in themononuclearcell fraction of bone marrow samples obtained for cell therapyrdquoTransplantation Proceedings vol 45 no 1 pp 434ndash439 2013
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
2 Stem Cells International
lymphohematopoietic engraftment-promoting properties[17] Similarly CD271+ cells immunomagnetically selectedfrom ADSCs showed a higher clonogenic and differentiationpotential compared to plastic adherent ADSCs [15] Addi-tionally Yamamoto et al [18] isolated CD271+ cells frommouse subcutaneous adipose tissue and demonstrated thattheir differentiation capability into adipocytes osteoblastsand neuronal cells was higher when compared to plasticadherent ADSCs
These findings suggest that CD271+ ADSCs are an excel-lent homogeneous subset of stem cells for clinical applica-tionsThis studyrsquos aim is to determine if there is a relationshipbetween donorrsquos age and CD271+ cell yield in freshly isolatedADSCs Also stem cell gene expression in CD271+ ADSCswill be addressed in order to verify their multipotency
2 Material and Methods
21 Patients and Tissue Sampling Thirty-five female healthypatients aged between 30 and 65 years undergoing cosmeticliposuction at NeoMedics (Monterrey Nuevo Leon Mexico)participated in our study Five sampleswere used for verifyingprevious reports where areas of higher cellular densities weredetermined and the rest were used for age correlation assess-ment Adipose tissue from this group was obtained frominner thigh trochanteric region lower back and abdomenin order to corroborate the best area for sample collectionExclusion criteria included diabetes mellitus allergies pre-vious liposuctions medication or vitamin intake two weeksbefore surgery hematologic disorders lipodystrophies mor-bid obesity and chronic use of corticoids For age correlationstudies 120mL of adipose tissue was harvested from 30donors within the following age periods 30ndash40 (119899 = 10) 41ndash50 (119899 = 10) and 51ndash65 (119899 = 10) Donorsrsquo body mass indexeswere within the same range (mean = 23 standard deviation= 158) Lipoaspirates were obtained under written informedconsent and all procedures were performed by the same plas-tic surgeon using the tumescent technique This techniqueconsists of infiltration of the fat compartment with a largevolume of a highly diluted local anesthetic and epinephrinesolution for induction of vasoconstriction Under generalanesthesia patients were infiltrated locally with Klein solu-tion consisting of 01 lidocaine 10mg of sodium bicar-bonate and epinephrine diluted 1 1000000 in 1000mLsterile physiologic normal saline Liposuction was performedusing a vacuum system connected to blunt-ended cannulas(Mentor California USA) with a diameter of 21mm and alength of 15 cm Fat was removed 10min after infiltration
Cell density determination and characterization studieswere performed with samples obtained from abdomen lowerback inner thigh and trochanteric regions
22 Cell Isolation and Culture ADSC isolation was per-formed as previously described by Zuk et al [19] Brieflyaspirated tissue was washed at least 3 times with phosphate-buffered saline (PBS Sigma-Aldrich St LouisMOUSA) and1 penicillin and streptomycin (Sigma-Aldrich) The pelletobtained from the first wash was collected and processedas described by Francis et al [20] Washed lipoaspirate
was digested with 01 collagenase type I-S (Sigma-Aldrich)dissolved in Hankrsquos buffer (Gibco Grand Island NY USA)Digestion took place in a shaker at 37∘C and 250 rpm during60min The enzyme was inactivated by adding an equalvolume of Dulbeccorsquos Modified Eaglersquos medium (DMEM-F12 Gibco) supplemented with 10 fetal bovine serum(FBS Gibco) Mature adipocytes and connective tissue wereseparated from pellets of mononuclear cells by centrifugationat 800 g for 10min Debris and dissociated tissue presentin pellets were eliminated through filtration using a 100 120583mcell strainer and washing with PBS All pellets were mixedand plated on a Ficoll-Paque (GE Healthcare Bio-SciencesPiscataway NJ USA) gradient to reduce erythrocyte con-tamination The collected mononuclear fraction was furtherwashed with PBS and filtered through a 40120583m cell strainer toremove debris and cell clumps
CD271+ cells were isolated using magnetic labeling beadsbearing an anti-CD271 antibody (MicroBead kit MiltenyiBiotec Gladbach Germany) Cells retained on the column(CD271+) and unlabeled cells (CD271minus) were counted using ahaemocytometer and samples of 3 times 105 cells were cultured in25 cm2 flasks with DMEM-F12 supplemented with 10 FBS50UmL penicillin and 50 120583gmL streptomycin
Cells were maintained at 37∘C and 50 CO2in humidi-
fied incubators Flasks were washedwith PBS andmedia werechanged completely every 3-4 days until reaching 70 con-fluence Maintenance medium consisted of DMEM-F12 sup-plemented with 5 FBS 50UmL penicillin and 50 120583gmLstreptomycin Cells were detachedwith 025Trypsin-EDTA(Gibco) and centrifuged at 375 g for 10min Trypsin-EDTAwas inactivated using DMEM-F12 supplemented with 20FBS The cell pellet was resuspended with maintenancemedium cells were quantified and plated on 12- and 24-wellmicroplates for RNA extraction and differentiation assaysrespectively or used directly for flow cytometry
23 Flow Cytometry To analyze the expression of specificsurface proteins one sample of 3 times 105 CD271+ ADSCs(passage 1) from each age range was incubated for 30minwith 20120583L of blocking reagent and 10 120583L of the following flu-orochrome conjugatedmonoclonal antibodies in appropriatecombinations CD34-PE CD45-FITC CD90-FITC CD105-PE and CD271-APC (BD Biosciences San Diego CA USA)After staining cells were washed with MACS-BSA stocksolution (Miltenyi Biotec Teterow Germany) centrifugedand resuspended in MACS-BSA Samples were evaluated bythe FACSCanto II Instrument and data was analyzed usingthe FACSDiva software (BD Biosciences)
24 Reverse-Transcription Polymerase Chain Reaction Sam-ples from three donors of each age range were used forgene analysis Total cellular RNA was isolated from 12 times 105cells using the GenElute Mammalian Total RNA MiniPrepKit (Sigma) Oligo (dT)-primed reverse transcription wasperformed using aliquots of 05 120583g of RNA as templatesAmplification was performed for the genes Sox2 Notch1Rex1 Oct4 Nanog and Nestin The housekeeping geneGAPDH was used as the assay basal amplification controlThe primers and annealing temperatures used are listed
Stem Cells International 3
Table 1 Primer sets and annealing temperatures used for reversetranscription PCR
Gene Primer sequence (51015840-31015840) Annealingtemperature
Sox2(fwd)(rev)
ACTTTTGTCGGAGACGGAGAGTTCATGTGCGCGTAACTGT 55∘C
Notch1(fwd)(rev)
TCACGCTGACGGAGTACAAGCCACACTCGTTGACATCCTG 55∘C
Rex1(fwd)(rev)
GGCGGAAATAGAACCTGTCACTTCCAGGATGGGTTGAGAA 55∘C
Oct4(fwd)(rev)
AGTGAGAGGCAACCTGGAGAACACTCGGACCACATCCTTC 55∘C
Nanog(fwd)(rev)
TTCCTTCCTCCATGGATCTGTCTGCTGGAGGCTGAGGTAT 55∘C
Nestin(fwd)(rev)
AACAGCGACGGAGGTCTCTATTCTCTTGTCCCGCAGACTT 60∘C
GAPDH(fwd)(rev)
GAGTCAACGGATTTGGTCGTTTGATTTTGGAGGGATCTCG 60∘C
Sox2 SRY (sex determining region Y)-box 2 Notch1 Notch homolog 1Oct4 octamer-binding transcription factor 4 GAPDH glyceraldehyde 3-phosphate dehydrogenase
in Table 1 Products were visualized by electrophoresis on15 agarose gels and images were acquired through a UVtransilluminator (DigiDoc-IT Cambridge UK)
25 Induced Differentiation To verify differentiation poten-tial CD271+ ADSCs were plated at passage 1 into 24-well microplates over poly-L-lysine (Sigma-Aldrich) coatedcoverslips at a density of 3 times 104 cellswell Cells were inducedinto preosteoblasts and adipocytes for a period of 21 daysInduction media were changed every 3 days
26 Osteogenic Differentiation The osteogenic medium con-sisted of 2mM 120573-glycerophosphate (Sigma-Aldrich) 1 nMdexamethasone (Sigma-Aldrich) and 50 120583M ascorbate-2-phosphate (Sigma-Aldrich) in 120572-MEM Basal Medium(Gibco) For fixing cells were washed with PBS and in-cubated in ice cold 70 ethanol for 1 hour at room tem-perature Cells were rinsed with water stained withAlizarin Red Solution (40mM pH 41 Sigma-Aldrich) for30min and washed with bidistilled water Extracellularcalcium mineralization was observed under a microscope(AxioImager Z1 fluorescent microscope)
27 Adipogenic Differentiation Adipogenic differentiationwas induced with 1120583M dexamethasone 200120583M indometha-cin (Sigma-Aldrich) 1mM isobutylmethylxan-thine (Sigma-Aldrich) and 10 120583Minsulin (Sigma-Aldrich) in120572-MEMBasalMedium For fixing cells were washed with cold PBS and
Table 2 Data gathered from 5 female patients 30ndash40 years old Dataexpressed in mean mononuclear cellsmL of initial fat sample
Donor site Mononuclear cellsmLInner thigh 130625 plusmn 5385Trochanteric 21333 plusmn 6308Lower back 40000 plusmn 9720Abdomen 38500 plusmn 8631
incubatedwith 10 formalin for 30min at room temperatureCells were air-dried before staining washed with PBS andincubated for 60min with 05 Oil Red O (Hycel JaliscoMexico) To avoid nonspecific staining samples were rinsedseveral times with PBS
28 Statistical Analysis Cell concentration distributionswere analyzed through means and standard deviationsModel fit was tested by analysis of residues and the dis-tributionrsquos normality was determined using the Shapiro-Wilk test and the Kolmogorov-Smirnov goodness of fit testA single factor ANOVA was used to analyze equality ofmeans between groups Group means were compared usingthe Tukey-Kramer method All analysis and graphs weredeveloped using the R programming language [21]
3 Results
31 Adipose-Derived Stem Cell Yield Meanmononuclear cellconcentrations per mL of starting adipose tissue for eachharvest site are shown in Table 2 A significant differencein cell counts (119875 value lt 00008) was found between lowerback and inner thigh donor sites Lower back and abdomenwere the sites with higher mononuclear cell counts and thereis no significant difference between their mean values (119875value = 0857) The difference between mean mononuclearcells counts from lower back and trochanteric is statisticallysignificant (119875 value lt 005)
To determine the proportion of ADSCs positive for theCD271 receptor and its relationship with age lipoaspiratesamples from the lower back of 10 female patients from eachage range were processed CD271+ ADSCs were isolated andcounted Proportions of CD271+ to CD271minus ADSCs for eachage range were calculated and the results are listed in Table 3Through a single factor ANOVA analysis mean CD271+ cellcounts differ between age groups with a 119875 value lt 0001
The box and whisker plots describing the distributionof the CD271+ ADSC concentration for each age range aredepicted in Figure 1(b) Each box plot shows the medianCD271+ ADSC count calculated for each age group aswell as the lower and upper quartiles The 30ndash40-year-oldrange had the highest CD271+ ADSC concentration and wassignificantly different to the amounts obtained from the 41ndash50-year-old range with a 119875 value = 001 and to the age range51ndash65 with a 119875 value lt 0001 as calculated with the Tukey-Kramer test The difference between the CD271+ cell countsbetween the age ranges 41ndash50 and 51ndash65 was also significantwith a 119875 value = 000845 With respect to the analysis of
4 Stem Cells International
R2= 071
P = 4195162e minus 09
y = minus23064x + 1835581
CD271+
(cel
lsm
L)
1200
1000
800
600
400
Donorrsquos age30 35 40 45 50 55 60 65
(a)
CD271+
(cel
lsm
L)
1200
1000
800
600
400
Donorrsquos age35 45 55
(b)
Figure 1 Frequency of CD271+ ADSCs per mL of initial adipose tissue taken from the lower backs of 30 healthy female donors with similarbody mass index (a) Distribution of CD271+ stem cellmL of initial adipose tissue and donorrsquos age Data appear normal and a straight line isadjusted with a goodness of fit of 1198772 = 071 The fitted regression equation and its 119875 value are shown (b) Box and whisker plots representingthe median lower and upper quartiles of CD271+ ADSC yieldmL of processed adipose tissue for each age range
Table 3 Data gathered from 10 female patients per age rangeSamples were obtained from lower back Data is expressed as meanplusmn standard deviation of CD271minus and CD271+ cellsmL of initial fatsample
Donorrsquos age CD271minuscellsmL
CD271 +
cellsmL CD271 +CD271minus
30ndash40 34189 plusmn 8190 991 plusmn 205 28941ndash50 33733 plusmn 5100 789 plusmn 104 23351ndash65 32619 plusmn 4607 595 plusmn 146 182
variance model data appeared normal and adjusted to astraight line with a goodness of fit of 1198772 = 071 (Figure 1(a))Normalitywas verified by theKolmogorov-Smirnov test (119863 =1) and the Shapiro-Wilk test (119875 = 0078)
32 Surface Protein Expression by Flow Cytometry AnalysisMore than 90 of cultured CD271+ ADSCs from all ageranges were positive for stem cell markers CD90 and CD105There was no expression of the hematopoietic marker CD45Approximately 70 of CD271+ passage 1 ADSC yieldedpositive for CD271 indicating that this marker is diminishedin culture The expression of CD34 is variable with a meanvalue of 852 The percentage of mean maker incidence isshown inTable 4 Flow cytometric analysis histograms for cellsurface marker expressions are shown in Figure 2
33 Multidifferentiation Potential The differentiation poten-tial of CD271+ ADSCs was tested using the induction mediafor 21 days Morphological changes with respect to a controlwithout induction are shown in Figure 3 Cells induced
Table 4 Mean expression of cell surface CD markers of CD271+ADSCs passage one
Antibody Conjugate Mean CD271+ cellsmLCD271+ APC 709CD90+CD105+ FITCPE 99CD45minusCD105+ FITCPE 985CD45minus FITC 996CD34+ PE 852
into adipocytes showed intracellular lipid filled vacuoles andexhibited an expanded volume (Figure 3(b))The amount andsize of intracellular lipid vacuoles increased with time After21 days of incubation in adipogenicmediumOil Red stainingwas used to unveil lipid droplets in red color Cells incubatedwith osteogenic induction media appeared polygonal inshape (Figure 3(c)) Extracellular calcium deposition wasdemonstrated at day 21 byAlizarinRed staining (Figure 3(d))Control cells without induction lacked red stain
34 Transcription Factor Expression With respect to geno-types CD271+ ADSCs expressed mRNA for the stem cellgenes Sox2 Notch1 Rex1 Oct4 Nanog and Nestin
Although the selected stem cell genes were expressed onthe samples from the three groups there was a variationbetween the groups and among subjects of the same groupVariations were not significant in patients from 30 to 50 yearsold however on subjects from the older group there wasa decrease on the expression of all the analyzed genes Arepresentative gel image of the RT-PCR products from thethree groups is shown in Figure 4
Stem Cells International 5
CD271 control tube250
200
150
100
50
SSC-
A
times1000
times1000
P1
50 100 150 200 250FSC-A
(a)
CD271APC
Cou
nt
90
80
70
60
50
40
30
20
10
0
APC-A10
210
310
410
5
(b)
CD45FITCCD105PE
Cou
nt
908070605040302010
0
FITC-A10
210
310
410
5
(c)
CD45FITCCD105PE
Cou
nt150
100
50
0
PE-A10
210
310
410
5
(d)
CD34PECD45FITC
Cou
nt
70
60
50
40
30
20
10
0
PE-A10
210
310
410
5
(e)
CD90FITCCD105PE
Cou
nt
125
100
75
50
25
0
FITC-A10
210
310
410
5
(f)
Figure 2 Representative results of flow cytometry analysis are shown for samples of 3 times 105 CD271+ ADSCs passage 1 from a 42-year-olddonor (a) The CD271+ ADSC population indicated with gage P1 comprises 754 of the 10000 events analyzed (b) Histogram showingthat 73 of cells from gage P1 yield positive for the CD271-APC receptor (c) Histogram depicting that the CD271+ ADSC population isnegative for CD45-FITC receptor (d) Histogram demonstrating that the CD271+ ADSC population is positive for the CD105-PE receptor (e)The histogram shows that 87 of the CD271+ ADSC population is positive for the CD34-PE (f) Histogram demonstrating that 97 of theCD271+ ADSC population yields positive for the CD90-FITC receptor
6 Stem Cells International
(a) (b)
(c) (d)
Figure 3 Morphological changes through different induction media (a) CD271+ ADSCs passage 1 after 21 days in culture without induction(20x) (b) Morphological changes visible at day 21 of adipogenic differentiation (20x) (c) Osteogenic differentiation observed at inductionday 21 (20x) (d) Microphotograph showing extracellular mineralization unveiled through Alizarin Red staining in CD271+ ADSCs after 21days of osteogenic induction (20x)
GADPH Nestin Nanog Sox2Notch1Rex1Oct40000
0200
0400
0600
0800
1000
1200
Nestin Nanog Oct4 Rex1 Notch1 Sox2
(a)
(b)
(c)
(d)
Group age 30ndash40Group age 41ndash50
Group age 51ndash65
GADPH
rela
tive a
ctiv
ity
Figure 4 Gene expression analysis The upper image shows a representative agarose gel electrophoresis showing the expression of selectedstem cell genes from the following donor age groups (a) 30ndash40 years old (b) 41ndash50 years old and (c) 51ndash65 years old (d) shows the averageof the GADPH relative gene expression and the error bars indicate the standard deviation in samples from the same age group
Stem Cells International 7
4 Discussion
Adult stem cells can be isolated from various tissue sourcesbone marrow being the most widely used in clinical applica-tionsThe commonproblem in isolating adult stem cells is thelow yield and the limited amount of tissue to harvest fromRecently researchers found that the frequency of stem cellswithin adipose tissue is approximately 8-fold higher than inbone marrow [22] Our results demonstrated that lower backand abdomen were the sites with the highest mononuclearcell concentrations in agreement with the results reported byPadoin et al [23]
Cells harvested from the stromal vascular fraction com-prise a heterogeneous population including preadipocytesadipocytes pericytes endothelial cells ADSCs fibroblastsmonocytes macrophages and lymphocytes [10] respondingdifferently to stimuli For the above it is important to reducecell heterogeneity before the use of adipose-derived stemcells for regenerative therapies Exposing a heterogeneouspopulation of stem cells to an inductionmediummight resultin subpopulations undergoing differentiation into differentlineages which could decrease its effectiveness Thereforethe use of monoclonal antibodies has been proposed forstem cell isolation and selection in order to decrease thisheterogeneity
Recently CD271 (LNGFR) has been described as theoptimal selective marker for the purification and isolation ofADSCs [15] and bonemarrow derived stem cells [13 14] Cellsbearing this receptor have a higher multipotency and prolif-erative capability when compared to the whole populationof unselected ADSCs Studies performed at our laboratoryhave demonstrated that the expression of CD271 decreaseswith culture time perhaps induced by plastic adherence andculture conditions Such results are in agreement with whatwas found for bonemarrowderived stem cells leadingQuiriciet al [13] to the hypothesis that CD271 might be a marker forresting primitive MSC
Cultured CD271+ ADSCs from all age groups studiedwere positive for stem cellmarkersThy1 (CD90) and endoglin(CD105) No expression was found for the hematopoieticmarker CD45 Positive expression of CD90 and CD105 aswell as negative expression of CD45 is some of the minimalcriteria for stem cells definition proposed by the Mes-enchymal and Tissue Stem Cell Committee of the Interna-tional Society for Cellular Therapy [24] Our results showedthat CD271+ ADSCs samples from all groups includingthose from older patients express the core transcriptionfactors associated with cell self-renewal Sox2 Oct4 andNanog [25ndash29] Similarly CD271+ ADSCs samples expressedRex1ZFP42 a known marker of pluripotency [30] andNotch1 a receptor of the Notch signaling pathway whichplays a role in stem cell self-renewal and differentiation [31]CD271+ ADSCs highly expressed Nestin a gene responsiblefor synthesizing nestin an intermediate cytoskeletal proteinwhich has been related with proliferative cells in whichspeedy cytoskeleton organization is vital [32] A reductionin these genesrsquo expression was seen in donors from the olderage range suggesting that in older subjects the stemness geneexpressions decrease however remain active and give the
possibility to respond to any induction Nevertheless it isimportant to perform several induction protocols in orderto establish its potential capability
Studying CD271+ ADSCs is important for elucidating therelationship between the CD271 receptor with multipotencyand proliferation as compared to CD271minus ADSCs SinceCD271+ ADSCs are a subset of mononuclear cells it is safeto correlate CD271+ concentrations with the size of mononu-clear cell populations We found the highest concentration ofmononuclear cells in the patients in the range of 30ndash40 yearsas well as CD271+ ADSCs
The cell distribution behaved similarly decreasing bothwith age Our results show that there is a significant statisticaldifference between the CD271+ ADSCs concentrations foreach age group range with the 30ndash40-year-old range contain-ing the highest cell concentration Data appeared normal anda straight line was fitted indicating that there is a correlationbetween the CD271+ ADSCs concentration and age Weattribute this correlation to a decrease in stem cell numberThis finding is similar to what was found by Yamada et al[33] who concluded that the number of ADSCs positive forCD271 per adipose tissue weight decreased in aged mice
The proportion of cells bearing the CD271 receptor ascompared tomononuclear cells decreased bymore than 30from the youngest age group (30ndash40) to the oldest group(51ndash65) Such a decrease is less than what was found byStolzing et al [34] whodetermined that the number of colonyforming unit fibroblasts (CFU-Frsquos) formed by bone marrowMSC declined by more than 50 from the youngest to theaged subjects
The frequency of CD271+ ADSCs found per mL oflipoaspirate is higher than what has been reported in bonemarrow aspirates The average lowest proportion of CD271+to CD271minus ADSCs obtained in our study was 18 while therelation of CD271+ MSC from bone marrow was 034 inQuirici et al [13] 028 inCox et al [35] and 00017ndash00201in Alvarez-Viejo et al studies [36] In this sense a hallmark ofour study is that regarding frequency CD271+ ADSCs are abetter source of donor cells for stem cell-based therapies andtissue engineering
In conclusion our results suggest that the proportion ofCD271+ ADSCs isolated from lower back decreases with agehowever cells positive for this marker were present in all ourage groups and their frequency was higher than what hasbeen found in bone marrowThese findings strongly proposeCD271+ ADSCs homogeneous subpopulations as the primarycollection choice for tissue regeneration and for autologousstem cell therapies in older subjects
Abbreviations
ADSCs Adipose-derived stem cellsLNGFR CD271 Low-affinity nerve growth factor receptorMSC Mesenchymal stem cell
Conflict of Interests
The authors have no financial interest to declare in relation tothe content of this paper
8 Stem Cells International
Acknowledgments
The authors wish to acknowledge Dr Victor TrevinoAlvarado for his valuable observations and assistance withdata analysis They are also indebted to the InstitutoTecnologico de Estudios Superiores de Monterrey theZambrano-Hellion Foundation and CONACYT for thePhD student grant
References
[1] D A De Ugarte K Morizono A Elbarbary et al ldquoComparisonof multi-lineage cells from human adipose tissue and bonemarrowrdquo Cells Tissues Organs vol 174 no 3 pp 101ndash109 2003
[2] S Kern H Eichler J Stoeve H Kluter and K BiebackldquoComparative analysis of mesenchymal stem cells from bonemarrow umbilical cord blood or adipose tissuerdquo StemCells vol24 no 5 pp 1294ndash1301 2006
[3] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[4] H J Jin Y K Bae M Kim et al ldquoComparative analysis ofhuman mesenchymal stem cells from bone marrow adiposetissue and umbilical cord blood as sources of cell therapyrdquoInternational Journal of Molecular Sciences vol 14 no 9 pp17986ndash18001 2013
[5] Y Zhu T Liu K Song X Fan X Ma and Z Cui ldquoAdipose-derived stem cell a better stem cell than BMSCrdquo Cell Biochem-istry and Function vol 26 no 6 pp 664ndash675 2008
[6] P A Zuk ldquoThe adipose-derived stem cell looking back andlooking aheadrdquoMolecular Biology of the Cell vol 21 no 11 pp1783ndash1787 2010
[7] M Locke J Windsor and P R Dunbar ldquoHuman adipose-derived stem cells isolation characterization and applicationsin surgeryrdquo ANZ Journal of Surgery vol 79 no 4 pp 235ndash2442009
[8] H Mizuno ldquoAdipose-derived stem cells for tissue repair andregeneration ten years of research and a literature reviewrdquoJournal of NipponMedical School vol 76 no 2 pp 56ndash66 2009
[9] H Mizuno M Tobita and A C Uysal ldquoConcise reviewadipose-derived stem cells as a novel tool for future regenerativemedicinerdquo Stem Cells vol 30 no 5 pp 804ndash810 2012
[10] A Schaffler and C Buchler ldquoConcise review adipose tissue-derived stromal cellsmdashbasic and clinical implications for novelcell-based therapiesrdquo StemCells vol 25 no 4 pp 818ndash827 2007
[11] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[12] P C Baer ldquoAdipose-derived stem cells and their potentialto differentiate into the epithelial lineagerdquo Stem Cells andDevelopment vol 20 no 10 pp 1805ndash1816 2011
[13] NQuirici D Soligo P Bossolasco F Servida C Lumini andGL Deliliers ldquoIsolation of bone marrow mesenchymal stem cellsby anti-nerve growth factor receptor antibodiesrdquo ExperimentalHematology vol 30 no 7 pp 783ndash791 2002
[14] E A Jones A English S E Kinsey et al ldquoOptimization of aflow cytometry-based protocol for detection and phenotypiccharacterization of multipotent mesenchymal stromal cells
from human bone marrowrdquo Cytometry B vol 70 no 6 pp 391ndash399 2006
[15] N Quirici C Scavullo L De Girolamo et al ldquoAnti-L-NGFRand -CD34 monoclonal antibodies identify multipotent mes-enchymal stem cells in human adipose tissuerdquo Stem Cells andDevelopment vol 19 no 6 pp 915ndash925 2010
[16] E Jones and D McGonagle ldquoHuman bone marrow mesenchy-mal stem cells in vivordquo Rheumatology vol 47 no 2 pp 126ndash1312008
[17] Z Kuci S Kuci S Zircher et al ldquoMesenchymal stromal cellsderived from CD271+ bone marrow mononuclear cells exertpotent allosuppressive propertiesrdquo Cytotherapy vol 13 no 10pp 1193ndash1204 2011
[18] N Yamamoto H Akamatsu S Hasegawa et al ldquoIsolation ofmultipotent stem cells from mouse adipose tissuerdquo Journal ofDermatological Science vol 48 no 1 pp 43ndash52 2007
[19] P A Zuk M Zhu H Mizuno et al ldquoMultilineage cells fromhuman adipose tissue implications for cell-based therapiesrdquoTissue Engineering vol 7 no 2 pp 211ndash228 2001
[20] M P Francis P C Sachs LW Elmore and S E Holt ldquoIsolatingadipose-derived mesenchymal stem cells from lipoaspirateblood and saline fractionrdquo Organogenesis vol 6 no 1 pp 11ndash14 2010
[21] The R Project for Statistical Computing httpwwwr-projectorg
[22] B M Strem K C Hicok M Zhu et al ldquoMultipotential differ-entiation of adipose tissue-derived stem cellsrdquo Keio Journal ofMedicine vol 54 no 3 pp 132ndash141 2005
[23] A V Padoin J Braga-Silva P Martins et al ldquoSources ofprocessed lipoaspirate cells influence of donor site on cellconcentrationrdquo Plastic and Reconstructive Surgery vol 122 no2 pp 614ndash618 2008
[24] M Dominici K Le Blanc I Mueller et al ldquoMinimal crite-ria for defining multipotent mesenchymal stromal cells TheInternational Society for Cellular Therapy position statementrdquoCytotherapy vol 8 no 4 pp 315ndash317 2006
[25] I Chambers D Colby M Robertson et al ldquoFunctional expres-sion cloning of Nanog a pluripotency sustaining factor inembryonic stem cellsrdquo Cell vol 113 no 5 pp 643ndash655 2003
[26] A Gagliardi N P Mullin Z Ying Tan et al ldquoA direct physicalinteraction between Nanog and Sox2 regulates embryonic stemcell self-renewalrdquo The EMBO Journal vol 32 no 16 pp 2231ndash2247 2013
[27] SMasui Y Nakatake Y Toyooka et al ldquoPluripotency governedby Sox2 via regulation of Oct34 expression in mouse embry-onic stem cellsrdquo Nature Cell Biology vol 9 no 6 pp 625ndash6352007
[28] V Karwacki-Neisius J Goke R Osorno et al ldquoReducedOct4 expression directs a robust pluripotent state with distinctsignaling activity and increased enhancer occupancy by Oct4and Nanogrdquo Cell Stem Cell vol 12 no 5 pp 531ndash545 2013
[29] S J Bray ldquoNotch signalling a simple pathway becomes com-plexrdquo Nature Reviews Molecular Cell Biology vol 7 no 9 pp678ndash689 2006
[30] M Y Son H Choi Y M Han et al ldquoUnveiling the criticalrole of REX1 in the regulation of human stem cell pluripotencyrdquoStem Cells 2013
[31] J Liu C Sato M Cerletti and A Wagers ldquoNotch signalingin the regulation of stem cell self-renewal and differentiationrdquoCurrent Topics in Developmental Biology vol 92 pp 367ndash4092010
Stem Cells International 9
[32] K Michalczyk and M Ziman ldquoNestin structure and predictedfunction in cellular cytoskeletal organisationrdquo Histology andHistopathology vol 20 no 2 pp 665ndash671 2005
[33] T Yamada H Akamatsu S Hasegawa et al ldquoAge-relatedchanges of p75Neurotrophin receptor-positive adipose-derivedstem cellsrdquo Journal of Dermatological Science vol 58 no 1 pp36ndash42 2010
[34] A Stolzing E Jones D McGonagle and A Scutt ldquoAge-relatedchanges in human bone marrow-derived mesenchymal stemcells consequences for cell therapiesrdquoMechanisms ofAgeing andDevelopment vol 129 no 3 pp 163ndash173 2008
[35] G Cox S A Boxall P V Giannoudis et al ldquoHigh abundance ofCD271+ multipotential stromal cells (MSCs) in intramedullarycavities of long bonesrdquo Bone vol 50 no 2 pp 510ndash517 2012
[36] M Alvarez-Viejo Y Menendez-Menendez M A Blanco-Gelazet al ldquoQuantifyingmesenchymal stem cells in themononuclearcell fraction of bone marrow samples obtained for cell therapyrdquoTransplantation Proceedings vol 45 no 1 pp 434ndash439 2013
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
Stem Cells International 3
Table 1 Primer sets and annealing temperatures used for reversetranscription PCR
Gene Primer sequence (51015840-31015840) Annealingtemperature
Sox2(fwd)(rev)
ACTTTTGTCGGAGACGGAGAGTTCATGTGCGCGTAACTGT 55∘C
Notch1(fwd)(rev)
TCACGCTGACGGAGTACAAGCCACACTCGTTGACATCCTG 55∘C
Rex1(fwd)(rev)
GGCGGAAATAGAACCTGTCACTTCCAGGATGGGTTGAGAA 55∘C
Oct4(fwd)(rev)
AGTGAGAGGCAACCTGGAGAACACTCGGACCACATCCTTC 55∘C
Nanog(fwd)(rev)
TTCCTTCCTCCATGGATCTGTCTGCTGGAGGCTGAGGTAT 55∘C
Nestin(fwd)(rev)
AACAGCGACGGAGGTCTCTATTCTCTTGTCCCGCAGACTT 60∘C
GAPDH(fwd)(rev)
GAGTCAACGGATTTGGTCGTTTGATTTTGGAGGGATCTCG 60∘C
Sox2 SRY (sex determining region Y)-box 2 Notch1 Notch homolog 1Oct4 octamer-binding transcription factor 4 GAPDH glyceraldehyde 3-phosphate dehydrogenase
in Table 1 Products were visualized by electrophoresis on15 agarose gels and images were acquired through a UVtransilluminator (DigiDoc-IT Cambridge UK)
25 Induced Differentiation To verify differentiation poten-tial CD271+ ADSCs were plated at passage 1 into 24-well microplates over poly-L-lysine (Sigma-Aldrich) coatedcoverslips at a density of 3 times 104 cellswell Cells were inducedinto preosteoblasts and adipocytes for a period of 21 daysInduction media were changed every 3 days
26 Osteogenic Differentiation The osteogenic medium con-sisted of 2mM 120573-glycerophosphate (Sigma-Aldrich) 1 nMdexamethasone (Sigma-Aldrich) and 50 120583M ascorbate-2-phosphate (Sigma-Aldrich) in 120572-MEM Basal Medium(Gibco) For fixing cells were washed with PBS and in-cubated in ice cold 70 ethanol for 1 hour at room tem-perature Cells were rinsed with water stained withAlizarin Red Solution (40mM pH 41 Sigma-Aldrich) for30min and washed with bidistilled water Extracellularcalcium mineralization was observed under a microscope(AxioImager Z1 fluorescent microscope)
27 Adipogenic Differentiation Adipogenic differentiationwas induced with 1120583M dexamethasone 200120583M indometha-cin (Sigma-Aldrich) 1mM isobutylmethylxan-thine (Sigma-Aldrich) and 10 120583Minsulin (Sigma-Aldrich) in120572-MEMBasalMedium For fixing cells were washed with cold PBS and
Table 2 Data gathered from 5 female patients 30ndash40 years old Dataexpressed in mean mononuclear cellsmL of initial fat sample
Donor site Mononuclear cellsmLInner thigh 130625 plusmn 5385Trochanteric 21333 plusmn 6308Lower back 40000 plusmn 9720Abdomen 38500 plusmn 8631
incubatedwith 10 formalin for 30min at room temperatureCells were air-dried before staining washed with PBS andincubated for 60min with 05 Oil Red O (Hycel JaliscoMexico) To avoid nonspecific staining samples were rinsedseveral times with PBS
28 Statistical Analysis Cell concentration distributionswere analyzed through means and standard deviationsModel fit was tested by analysis of residues and the dis-tributionrsquos normality was determined using the Shapiro-Wilk test and the Kolmogorov-Smirnov goodness of fit testA single factor ANOVA was used to analyze equality ofmeans between groups Group means were compared usingthe Tukey-Kramer method All analysis and graphs weredeveloped using the R programming language [21]
3 Results
31 Adipose-Derived Stem Cell Yield Meanmononuclear cellconcentrations per mL of starting adipose tissue for eachharvest site are shown in Table 2 A significant differencein cell counts (119875 value lt 00008) was found between lowerback and inner thigh donor sites Lower back and abdomenwere the sites with higher mononuclear cell counts and thereis no significant difference between their mean values (119875value = 0857) The difference between mean mononuclearcells counts from lower back and trochanteric is statisticallysignificant (119875 value lt 005)
To determine the proportion of ADSCs positive for theCD271 receptor and its relationship with age lipoaspiratesamples from the lower back of 10 female patients from eachage range were processed CD271+ ADSCs were isolated andcounted Proportions of CD271+ to CD271minus ADSCs for eachage range were calculated and the results are listed in Table 3Through a single factor ANOVA analysis mean CD271+ cellcounts differ between age groups with a 119875 value lt 0001
The box and whisker plots describing the distributionof the CD271+ ADSC concentration for each age range aredepicted in Figure 1(b) Each box plot shows the medianCD271+ ADSC count calculated for each age group aswell as the lower and upper quartiles The 30ndash40-year-oldrange had the highest CD271+ ADSC concentration and wassignificantly different to the amounts obtained from the 41ndash50-year-old range with a 119875 value = 001 and to the age range51ndash65 with a 119875 value lt 0001 as calculated with the Tukey-Kramer test The difference between the CD271+ cell countsbetween the age ranges 41ndash50 and 51ndash65 was also significantwith a 119875 value = 000845 With respect to the analysis of
4 Stem Cells International
R2= 071
P = 4195162e minus 09
y = minus23064x + 1835581
CD271+
(cel
lsm
L)
1200
1000
800
600
400
Donorrsquos age30 35 40 45 50 55 60 65
(a)
CD271+
(cel
lsm
L)
1200
1000
800
600
400
Donorrsquos age35 45 55
(b)
Figure 1 Frequency of CD271+ ADSCs per mL of initial adipose tissue taken from the lower backs of 30 healthy female donors with similarbody mass index (a) Distribution of CD271+ stem cellmL of initial adipose tissue and donorrsquos age Data appear normal and a straight line isadjusted with a goodness of fit of 1198772 = 071 The fitted regression equation and its 119875 value are shown (b) Box and whisker plots representingthe median lower and upper quartiles of CD271+ ADSC yieldmL of processed adipose tissue for each age range
Table 3 Data gathered from 10 female patients per age rangeSamples were obtained from lower back Data is expressed as meanplusmn standard deviation of CD271minus and CD271+ cellsmL of initial fatsample
Donorrsquos age CD271minuscellsmL
CD271 +
cellsmL CD271 +CD271minus
30ndash40 34189 plusmn 8190 991 plusmn 205 28941ndash50 33733 plusmn 5100 789 plusmn 104 23351ndash65 32619 plusmn 4607 595 plusmn 146 182
variance model data appeared normal and adjusted to astraight line with a goodness of fit of 1198772 = 071 (Figure 1(a))Normalitywas verified by theKolmogorov-Smirnov test (119863 =1) and the Shapiro-Wilk test (119875 = 0078)
32 Surface Protein Expression by Flow Cytometry AnalysisMore than 90 of cultured CD271+ ADSCs from all ageranges were positive for stem cell markers CD90 and CD105There was no expression of the hematopoietic marker CD45Approximately 70 of CD271+ passage 1 ADSC yieldedpositive for CD271 indicating that this marker is diminishedin culture The expression of CD34 is variable with a meanvalue of 852 The percentage of mean maker incidence isshown inTable 4 Flow cytometric analysis histograms for cellsurface marker expressions are shown in Figure 2
33 Multidifferentiation Potential The differentiation poten-tial of CD271+ ADSCs was tested using the induction mediafor 21 days Morphological changes with respect to a controlwithout induction are shown in Figure 3 Cells induced
Table 4 Mean expression of cell surface CD markers of CD271+ADSCs passage one
Antibody Conjugate Mean CD271+ cellsmLCD271+ APC 709CD90+CD105+ FITCPE 99CD45minusCD105+ FITCPE 985CD45minus FITC 996CD34+ PE 852
into adipocytes showed intracellular lipid filled vacuoles andexhibited an expanded volume (Figure 3(b))The amount andsize of intracellular lipid vacuoles increased with time After21 days of incubation in adipogenicmediumOil Red stainingwas used to unveil lipid droplets in red color Cells incubatedwith osteogenic induction media appeared polygonal inshape (Figure 3(c)) Extracellular calcium deposition wasdemonstrated at day 21 byAlizarinRed staining (Figure 3(d))Control cells without induction lacked red stain
34 Transcription Factor Expression With respect to geno-types CD271+ ADSCs expressed mRNA for the stem cellgenes Sox2 Notch1 Rex1 Oct4 Nanog and Nestin
Although the selected stem cell genes were expressed onthe samples from the three groups there was a variationbetween the groups and among subjects of the same groupVariations were not significant in patients from 30 to 50 yearsold however on subjects from the older group there wasa decrease on the expression of all the analyzed genes Arepresentative gel image of the RT-PCR products from thethree groups is shown in Figure 4
Stem Cells International 5
CD271 control tube250
200
150
100
50
SSC-
A
times1000
times1000
P1
50 100 150 200 250FSC-A
(a)
CD271APC
Cou
nt
90
80
70
60
50
40
30
20
10
0
APC-A10
210
310
410
5
(b)
CD45FITCCD105PE
Cou
nt
908070605040302010
0
FITC-A10
210
310
410
5
(c)
CD45FITCCD105PE
Cou
nt150
100
50
0
PE-A10
210
310
410
5
(d)
CD34PECD45FITC
Cou
nt
70
60
50
40
30
20
10
0
PE-A10
210
310
410
5
(e)
CD90FITCCD105PE
Cou
nt
125
100
75
50
25
0
FITC-A10
210
310
410
5
(f)
Figure 2 Representative results of flow cytometry analysis are shown for samples of 3 times 105 CD271+ ADSCs passage 1 from a 42-year-olddonor (a) The CD271+ ADSC population indicated with gage P1 comprises 754 of the 10000 events analyzed (b) Histogram showingthat 73 of cells from gage P1 yield positive for the CD271-APC receptor (c) Histogram depicting that the CD271+ ADSC population isnegative for CD45-FITC receptor (d) Histogram demonstrating that the CD271+ ADSC population is positive for the CD105-PE receptor (e)The histogram shows that 87 of the CD271+ ADSC population is positive for the CD34-PE (f) Histogram demonstrating that 97 of theCD271+ ADSC population yields positive for the CD90-FITC receptor
6 Stem Cells International
(a) (b)
(c) (d)
Figure 3 Morphological changes through different induction media (a) CD271+ ADSCs passage 1 after 21 days in culture without induction(20x) (b) Morphological changes visible at day 21 of adipogenic differentiation (20x) (c) Osteogenic differentiation observed at inductionday 21 (20x) (d) Microphotograph showing extracellular mineralization unveiled through Alizarin Red staining in CD271+ ADSCs after 21days of osteogenic induction (20x)
GADPH Nestin Nanog Sox2Notch1Rex1Oct40000
0200
0400
0600
0800
1000
1200
Nestin Nanog Oct4 Rex1 Notch1 Sox2
(a)
(b)
(c)
(d)
Group age 30ndash40Group age 41ndash50
Group age 51ndash65
GADPH
rela
tive a
ctiv
ity
Figure 4 Gene expression analysis The upper image shows a representative agarose gel electrophoresis showing the expression of selectedstem cell genes from the following donor age groups (a) 30ndash40 years old (b) 41ndash50 years old and (c) 51ndash65 years old (d) shows the averageof the GADPH relative gene expression and the error bars indicate the standard deviation in samples from the same age group
Stem Cells International 7
4 Discussion
Adult stem cells can be isolated from various tissue sourcesbone marrow being the most widely used in clinical applica-tionsThe commonproblem in isolating adult stem cells is thelow yield and the limited amount of tissue to harvest fromRecently researchers found that the frequency of stem cellswithin adipose tissue is approximately 8-fold higher than inbone marrow [22] Our results demonstrated that lower backand abdomen were the sites with the highest mononuclearcell concentrations in agreement with the results reported byPadoin et al [23]
Cells harvested from the stromal vascular fraction com-prise a heterogeneous population including preadipocytesadipocytes pericytes endothelial cells ADSCs fibroblastsmonocytes macrophages and lymphocytes [10] respondingdifferently to stimuli For the above it is important to reducecell heterogeneity before the use of adipose-derived stemcells for regenerative therapies Exposing a heterogeneouspopulation of stem cells to an inductionmediummight resultin subpopulations undergoing differentiation into differentlineages which could decrease its effectiveness Thereforethe use of monoclonal antibodies has been proposed forstem cell isolation and selection in order to decrease thisheterogeneity
Recently CD271 (LNGFR) has been described as theoptimal selective marker for the purification and isolation ofADSCs [15] and bonemarrow derived stem cells [13 14] Cellsbearing this receptor have a higher multipotency and prolif-erative capability when compared to the whole populationof unselected ADSCs Studies performed at our laboratoryhave demonstrated that the expression of CD271 decreaseswith culture time perhaps induced by plastic adherence andculture conditions Such results are in agreement with whatwas found for bonemarrowderived stem cells leadingQuiriciet al [13] to the hypothesis that CD271 might be a marker forresting primitive MSC
Cultured CD271+ ADSCs from all age groups studiedwere positive for stem cellmarkersThy1 (CD90) and endoglin(CD105) No expression was found for the hematopoieticmarker CD45 Positive expression of CD90 and CD105 aswell as negative expression of CD45 is some of the minimalcriteria for stem cells definition proposed by the Mes-enchymal and Tissue Stem Cell Committee of the Interna-tional Society for Cellular Therapy [24] Our results showedthat CD271+ ADSCs samples from all groups includingthose from older patients express the core transcriptionfactors associated with cell self-renewal Sox2 Oct4 andNanog [25ndash29] Similarly CD271+ ADSCs samples expressedRex1ZFP42 a known marker of pluripotency [30] andNotch1 a receptor of the Notch signaling pathway whichplays a role in stem cell self-renewal and differentiation [31]CD271+ ADSCs highly expressed Nestin a gene responsiblefor synthesizing nestin an intermediate cytoskeletal proteinwhich has been related with proliferative cells in whichspeedy cytoskeleton organization is vital [32] A reductionin these genesrsquo expression was seen in donors from the olderage range suggesting that in older subjects the stemness geneexpressions decrease however remain active and give the
possibility to respond to any induction Nevertheless it isimportant to perform several induction protocols in orderto establish its potential capability
Studying CD271+ ADSCs is important for elucidating therelationship between the CD271 receptor with multipotencyand proliferation as compared to CD271minus ADSCs SinceCD271+ ADSCs are a subset of mononuclear cells it is safeto correlate CD271+ concentrations with the size of mononu-clear cell populations We found the highest concentration ofmononuclear cells in the patients in the range of 30ndash40 yearsas well as CD271+ ADSCs
The cell distribution behaved similarly decreasing bothwith age Our results show that there is a significant statisticaldifference between the CD271+ ADSCs concentrations foreach age group range with the 30ndash40-year-old range contain-ing the highest cell concentration Data appeared normal anda straight line was fitted indicating that there is a correlationbetween the CD271+ ADSCs concentration and age Weattribute this correlation to a decrease in stem cell numberThis finding is similar to what was found by Yamada et al[33] who concluded that the number of ADSCs positive forCD271 per adipose tissue weight decreased in aged mice
The proportion of cells bearing the CD271 receptor ascompared tomononuclear cells decreased bymore than 30from the youngest age group (30ndash40) to the oldest group(51ndash65) Such a decrease is less than what was found byStolzing et al [34] whodetermined that the number of colonyforming unit fibroblasts (CFU-Frsquos) formed by bone marrowMSC declined by more than 50 from the youngest to theaged subjects
The frequency of CD271+ ADSCs found per mL oflipoaspirate is higher than what has been reported in bonemarrow aspirates The average lowest proportion of CD271+to CD271minus ADSCs obtained in our study was 18 while therelation of CD271+ MSC from bone marrow was 034 inQuirici et al [13] 028 inCox et al [35] and 00017ndash00201in Alvarez-Viejo et al studies [36] In this sense a hallmark ofour study is that regarding frequency CD271+ ADSCs are abetter source of donor cells for stem cell-based therapies andtissue engineering
In conclusion our results suggest that the proportion ofCD271+ ADSCs isolated from lower back decreases with agehowever cells positive for this marker were present in all ourage groups and their frequency was higher than what hasbeen found in bone marrowThese findings strongly proposeCD271+ ADSCs homogeneous subpopulations as the primarycollection choice for tissue regeneration and for autologousstem cell therapies in older subjects
Abbreviations
ADSCs Adipose-derived stem cellsLNGFR CD271 Low-affinity nerve growth factor receptorMSC Mesenchymal stem cell
Conflict of Interests
The authors have no financial interest to declare in relation tothe content of this paper
8 Stem Cells International
Acknowledgments
The authors wish to acknowledge Dr Victor TrevinoAlvarado for his valuable observations and assistance withdata analysis They are also indebted to the InstitutoTecnologico de Estudios Superiores de Monterrey theZambrano-Hellion Foundation and CONACYT for thePhD student grant
References
[1] D A De Ugarte K Morizono A Elbarbary et al ldquoComparisonof multi-lineage cells from human adipose tissue and bonemarrowrdquo Cells Tissues Organs vol 174 no 3 pp 101ndash109 2003
[2] S Kern H Eichler J Stoeve H Kluter and K BiebackldquoComparative analysis of mesenchymal stem cells from bonemarrow umbilical cord blood or adipose tissuerdquo StemCells vol24 no 5 pp 1294ndash1301 2006
[3] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[4] H J Jin Y K Bae M Kim et al ldquoComparative analysis ofhuman mesenchymal stem cells from bone marrow adiposetissue and umbilical cord blood as sources of cell therapyrdquoInternational Journal of Molecular Sciences vol 14 no 9 pp17986ndash18001 2013
[5] Y Zhu T Liu K Song X Fan X Ma and Z Cui ldquoAdipose-derived stem cell a better stem cell than BMSCrdquo Cell Biochem-istry and Function vol 26 no 6 pp 664ndash675 2008
[6] P A Zuk ldquoThe adipose-derived stem cell looking back andlooking aheadrdquoMolecular Biology of the Cell vol 21 no 11 pp1783ndash1787 2010
[7] M Locke J Windsor and P R Dunbar ldquoHuman adipose-derived stem cells isolation characterization and applicationsin surgeryrdquo ANZ Journal of Surgery vol 79 no 4 pp 235ndash2442009
[8] H Mizuno ldquoAdipose-derived stem cells for tissue repair andregeneration ten years of research and a literature reviewrdquoJournal of NipponMedical School vol 76 no 2 pp 56ndash66 2009
[9] H Mizuno M Tobita and A C Uysal ldquoConcise reviewadipose-derived stem cells as a novel tool for future regenerativemedicinerdquo Stem Cells vol 30 no 5 pp 804ndash810 2012
[10] A Schaffler and C Buchler ldquoConcise review adipose tissue-derived stromal cellsmdashbasic and clinical implications for novelcell-based therapiesrdquo StemCells vol 25 no 4 pp 818ndash827 2007
[11] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[12] P C Baer ldquoAdipose-derived stem cells and their potentialto differentiate into the epithelial lineagerdquo Stem Cells andDevelopment vol 20 no 10 pp 1805ndash1816 2011
[13] NQuirici D Soligo P Bossolasco F Servida C Lumini andGL Deliliers ldquoIsolation of bone marrow mesenchymal stem cellsby anti-nerve growth factor receptor antibodiesrdquo ExperimentalHematology vol 30 no 7 pp 783ndash791 2002
[14] E A Jones A English S E Kinsey et al ldquoOptimization of aflow cytometry-based protocol for detection and phenotypiccharacterization of multipotent mesenchymal stromal cells
from human bone marrowrdquo Cytometry B vol 70 no 6 pp 391ndash399 2006
[15] N Quirici C Scavullo L De Girolamo et al ldquoAnti-L-NGFRand -CD34 monoclonal antibodies identify multipotent mes-enchymal stem cells in human adipose tissuerdquo Stem Cells andDevelopment vol 19 no 6 pp 915ndash925 2010
[16] E Jones and D McGonagle ldquoHuman bone marrow mesenchy-mal stem cells in vivordquo Rheumatology vol 47 no 2 pp 126ndash1312008
[17] Z Kuci S Kuci S Zircher et al ldquoMesenchymal stromal cellsderived from CD271+ bone marrow mononuclear cells exertpotent allosuppressive propertiesrdquo Cytotherapy vol 13 no 10pp 1193ndash1204 2011
[18] N Yamamoto H Akamatsu S Hasegawa et al ldquoIsolation ofmultipotent stem cells from mouse adipose tissuerdquo Journal ofDermatological Science vol 48 no 1 pp 43ndash52 2007
[19] P A Zuk M Zhu H Mizuno et al ldquoMultilineage cells fromhuman adipose tissue implications for cell-based therapiesrdquoTissue Engineering vol 7 no 2 pp 211ndash228 2001
[20] M P Francis P C Sachs LW Elmore and S E Holt ldquoIsolatingadipose-derived mesenchymal stem cells from lipoaspirateblood and saline fractionrdquo Organogenesis vol 6 no 1 pp 11ndash14 2010
[21] The R Project for Statistical Computing httpwwwr-projectorg
[22] B M Strem K C Hicok M Zhu et al ldquoMultipotential differ-entiation of adipose tissue-derived stem cellsrdquo Keio Journal ofMedicine vol 54 no 3 pp 132ndash141 2005
[23] A V Padoin J Braga-Silva P Martins et al ldquoSources ofprocessed lipoaspirate cells influence of donor site on cellconcentrationrdquo Plastic and Reconstructive Surgery vol 122 no2 pp 614ndash618 2008
[24] M Dominici K Le Blanc I Mueller et al ldquoMinimal crite-ria for defining multipotent mesenchymal stromal cells TheInternational Society for Cellular Therapy position statementrdquoCytotherapy vol 8 no 4 pp 315ndash317 2006
[25] I Chambers D Colby M Robertson et al ldquoFunctional expres-sion cloning of Nanog a pluripotency sustaining factor inembryonic stem cellsrdquo Cell vol 113 no 5 pp 643ndash655 2003
[26] A Gagliardi N P Mullin Z Ying Tan et al ldquoA direct physicalinteraction between Nanog and Sox2 regulates embryonic stemcell self-renewalrdquo The EMBO Journal vol 32 no 16 pp 2231ndash2247 2013
[27] SMasui Y Nakatake Y Toyooka et al ldquoPluripotency governedby Sox2 via regulation of Oct34 expression in mouse embry-onic stem cellsrdquo Nature Cell Biology vol 9 no 6 pp 625ndash6352007
[28] V Karwacki-Neisius J Goke R Osorno et al ldquoReducedOct4 expression directs a robust pluripotent state with distinctsignaling activity and increased enhancer occupancy by Oct4and Nanogrdquo Cell Stem Cell vol 12 no 5 pp 531ndash545 2013
[29] S J Bray ldquoNotch signalling a simple pathway becomes com-plexrdquo Nature Reviews Molecular Cell Biology vol 7 no 9 pp678ndash689 2006
[30] M Y Son H Choi Y M Han et al ldquoUnveiling the criticalrole of REX1 in the regulation of human stem cell pluripotencyrdquoStem Cells 2013
[31] J Liu C Sato M Cerletti and A Wagers ldquoNotch signalingin the regulation of stem cell self-renewal and differentiationrdquoCurrent Topics in Developmental Biology vol 92 pp 367ndash4092010
Stem Cells International 9
[32] K Michalczyk and M Ziman ldquoNestin structure and predictedfunction in cellular cytoskeletal organisationrdquo Histology andHistopathology vol 20 no 2 pp 665ndash671 2005
[33] T Yamada H Akamatsu S Hasegawa et al ldquoAge-relatedchanges of p75Neurotrophin receptor-positive adipose-derivedstem cellsrdquo Journal of Dermatological Science vol 58 no 1 pp36ndash42 2010
[34] A Stolzing E Jones D McGonagle and A Scutt ldquoAge-relatedchanges in human bone marrow-derived mesenchymal stemcells consequences for cell therapiesrdquoMechanisms ofAgeing andDevelopment vol 129 no 3 pp 163ndash173 2008
[35] G Cox S A Boxall P V Giannoudis et al ldquoHigh abundance ofCD271+ multipotential stromal cells (MSCs) in intramedullarycavities of long bonesrdquo Bone vol 50 no 2 pp 510ndash517 2012
[36] M Alvarez-Viejo Y Menendez-Menendez M A Blanco-Gelazet al ldquoQuantifyingmesenchymal stem cells in themononuclearcell fraction of bone marrow samples obtained for cell therapyrdquoTransplantation Proceedings vol 45 no 1 pp 434ndash439 2013
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
4 Stem Cells International
R2= 071
P = 4195162e minus 09
y = minus23064x + 1835581
CD271+
(cel
lsm
L)
1200
1000
800
600
400
Donorrsquos age30 35 40 45 50 55 60 65
(a)
CD271+
(cel
lsm
L)
1200
1000
800
600
400
Donorrsquos age35 45 55
(b)
Figure 1 Frequency of CD271+ ADSCs per mL of initial adipose tissue taken from the lower backs of 30 healthy female donors with similarbody mass index (a) Distribution of CD271+ stem cellmL of initial adipose tissue and donorrsquos age Data appear normal and a straight line isadjusted with a goodness of fit of 1198772 = 071 The fitted regression equation and its 119875 value are shown (b) Box and whisker plots representingthe median lower and upper quartiles of CD271+ ADSC yieldmL of processed adipose tissue for each age range
Table 3 Data gathered from 10 female patients per age rangeSamples were obtained from lower back Data is expressed as meanplusmn standard deviation of CD271minus and CD271+ cellsmL of initial fatsample
Donorrsquos age CD271minuscellsmL
CD271 +
cellsmL CD271 +CD271minus
30ndash40 34189 plusmn 8190 991 plusmn 205 28941ndash50 33733 plusmn 5100 789 plusmn 104 23351ndash65 32619 plusmn 4607 595 plusmn 146 182
variance model data appeared normal and adjusted to astraight line with a goodness of fit of 1198772 = 071 (Figure 1(a))Normalitywas verified by theKolmogorov-Smirnov test (119863 =1) and the Shapiro-Wilk test (119875 = 0078)
32 Surface Protein Expression by Flow Cytometry AnalysisMore than 90 of cultured CD271+ ADSCs from all ageranges were positive for stem cell markers CD90 and CD105There was no expression of the hematopoietic marker CD45Approximately 70 of CD271+ passage 1 ADSC yieldedpositive for CD271 indicating that this marker is diminishedin culture The expression of CD34 is variable with a meanvalue of 852 The percentage of mean maker incidence isshown inTable 4 Flow cytometric analysis histograms for cellsurface marker expressions are shown in Figure 2
33 Multidifferentiation Potential The differentiation poten-tial of CD271+ ADSCs was tested using the induction mediafor 21 days Morphological changes with respect to a controlwithout induction are shown in Figure 3 Cells induced
Table 4 Mean expression of cell surface CD markers of CD271+ADSCs passage one
Antibody Conjugate Mean CD271+ cellsmLCD271+ APC 709CD90+CD105+ FITCPE 99CD45minusCD105+ FITCPE 985CD45minus FITC 996CD34+ PE 852
into adipocytes showed intracellular lipid filled vacuoles andexhibited an expanded volume (Figure 3(b))The amount andsize of intracellular lipid vacuoles increased with time After21 days of incubation in adipogenicmediumOil Red stainingwas used to unveil lipid droplets in red color Cells incubatedwith osteogenic induction media appeared polygonal inshape (Figure 3(c)) Extracellular calcium deposition wasdemonstrated at day 21 byAlizarinRed staining (Figure 3(d))Control cells without induction lacked red stain
34 Transcription Factor Expression With respect to geno-types CD271+ ADSCs expressed mRNA for the stem cellgenes Sox2 Notch1 Rex1 Oct4 Nanog and Nestin
Although the selected stem cell genes were expressed onthe samples from the three groups there was a variationbetween the groups and among subjects of the same groupVariations were not significant in patients from 30 to 50 yearsold however on subjects from the older group there wasa decrease on the expression of all the analyzed genes Arepresentative gel image of the RT-PCR products from thethree groups is shown in Figure 4
Stem Cells International 5
CD271 control tube250
200
150
100
50
SSC-
A
times1000
times1000
P1
50 100 150 200 250FSC-A
(a)
CD271APC
Cou
nt
90
80
70
60
50
40
30
20
10
0
APC-A10
210
310
410
5
(b)
CD45FITCCD105PE
Cou
nt
908070605040302010
0
FITC-A10
210
310
410
5
(c)
CD45FITCCD105PE
Cou
nt150
100
50
0
PE-A10
210
310
410
5
(d)
CD34PECD45FITC
Cou
nt
70
60
50
40
30
20
10
0
PE-A10
210
310
410
5
(e)
CD90FITCCD105PE
Cou
nt
125
100
75
50
25
0
FITC-A10
210
310
410
5
(f)
Figure 2 Representative results of flow cytometry analysis are shown for samples of 3 times 105 CD271+ ADSCs passage 1 from a 42-year-olddonor (a) The CD271+ ADSC population indicated with gage P1 comprises 754 of the 10000 events analyzed (b) Histogram showingthat 73 of cells from gage P1 yield positive for the CD271-APC receptor (c) Histogram depicting that the CD271+ ADSC population isnegative for CD45-FITC receptor (d) Histogram demonstrating that the CD271+ ADSC population is positive for the CD105-PE receptor (e)The histogram shows that 87 of the CD271+ ADSC population is positive for the CD34-PE (f) Histogram demonstrating that 97 of theCD271+ ADSC population yields positive for the CD90-FITC receptor
6 Stem Cells International
(a) (b)
(c) (d)
Figure 3 Morphological changes through different induction media (a) CD271+ ADSCs passage 1 after 21 days in culture without induction(20x) (b) Morphological changes visible at day 21 of adipogenic differentiation (20x) (c) Osteogenic differentiation observed at inductionday 21 (20x) (d) Microphotograph showing extracellular mineralization unveiled through Alizarin Red staining in CD271+ ADSCs after 21days of osteogenic induction (20x)
GADPH Nestin Nanog Sox2Notch1Rex1Oct40000
0200
0400
0600
0800
1000
1200
Nestin Nanog Oct4 Rex1 Notch1 Sox2
(a)
(b)
(c)
(d)
Group age 30ndash40Group age 41ndash50
Group age 51ndash65
GADPH
rela
tive a
ctiv
ity
Figure 4 Gene expression analysis The upper image shows a representative agarose gel electrophoresis showing the expression of selectedstem cell genes from the following donor age groups (a) 30ndash40 years old (b) 41ndash50 years old and (c) 51ndash65 years old (d) shows the averageof the GADPH relative gene expression and the error bars indicate the standard deviation in samples from the same age group
Stem Cells International 7
4 Discussion
Adult stem cells can be isolated from various tissue sourcesbone marrow being the most widely used in clinical applica-tionsThe commonproblem in isolating adult stem cells is thelow yield and the limited amount of tissue to harvest fromRecently researchers found that the frequency of stem cellswithin adipose tissue is approximately 8-fold higher than inbone marrow [22] Our results demonstrated that lower backand abdomen were the sites with the highest mononuclearcell concentrations in agreement with the results reported byPadoin et al [23]
Cells harvested from the stromal vascular fraction com-prise a heterogeneous population including preadipocytesadipocytes pericytes endothelial cells ADSCs fibroblastsmonocytes macrophages and lymphocytes [10] respondingdifferently to stimuli For the above it is important to reducecell heterogeneity before the use of adipose-derived stemcells for regenerative therapies Exposing a heterogeneouspopulation of stem cells to an inductionmediummight resultin subpopulations undergoing differentiation into differentlineages which could decrease its effectiveness Thereforethe use of monoclonal antibodies has been proposed forstem cell isolation and selection in order to decrease thisheterogeneity
Recently CD271 (LNGFR) has been described as theoptimal selective marker for the purification and isolation ofADSCs [15] and bonemarrow derived stem cells [13 14] Cellsbearing this receptor have a higher multipotency and prolif-erative capability when compared to the whole populationof unselected ADSCs Studies performed at our laboratoryhave demonstrated that the expression of CD271 decreaseswith culture time perhaps induced by plastic adherence andculture conditions Such results are in agreement with whatwas found for bonemarrowderived stem cells leadingQuiriciet al [13] to the hypothesis that CD271 might be a marker forresting primitive MSC
Cultured CD271+ ADSCs from all age groups studiedwere positive for stem cellmarkersThy1 (CD90) and endoglin(CD105) No expression was found for the hematopoieticmarker CD45 Positive expression of CD90 and CD105 aswell as negative expression of CD45 is some of the minimalcriteria for stem cells definition proposed by the Mes-enchymal and Tissue Stem Cell Committee of the Interna-tional Society for Cellular Therapy [24] Our results showedthat CD271+ ADSCs samples from all groups includingthose from older patients express the core transcriptionfactors associated with cell self-renewal Sox2 Oct4 andNanog [25ndash29] Similarly CD271+ ADSCs samples expressedRex1ZFP42 a known marker of pluripotency [30] andNotch1 a receptor of the Notch signaling pathway whichplays a role in stem cell self-renewal and differentiation [31]CD271+ ADSCs highly expressed Nestin a gene responsiblefor synthesizing nestin an intermediate cytoskeletal proteinwhich has been related with proliferative cells in whichspeedy cytoskeleton organization is vital [32] A reductionin these genesrsquo expression was seen in donors from the olderage range suggesting that in older subjects the stemness geneexpressions decrease however remain active and give the
possibility to respond to any induction Nevertheless it isimportant to perform several induction protocols in orderto establish its potential capability
Studying CD271+ ADSCs is important for elucidating therelationship between the CD271 receptor with multipotencyand proliferation as compared to CD271minus ADSCs SinceCD271+ ADSCs are a subset of mononuclear cells it is safeto correlate CD271+ concentrations with the size of mononu-clear cell populations We found the highest concentration ofmononuclear cells in the patients in the range of 30ndash40 yearsas well as CD271+ ADSCs
The cell distribution behaved similarly decreasing bothwith age Our results show that there is a significant statisticaldifference between the CD271+ ADSCs concentrations foreach age group range with the 30ndash40-year-old range contain-ing the highest cell concentration Data appeared normal anda straight line was fitted indicating that there is a correlationbetween the CD271+ ADSCs concentration and age Weattribute this correlation to a decrease in stem cell numberThis finding is similar to what was found by Yamada et al[33] who concluded that the number of ADSCs positive forCD271 per adipose tissue weight decreased in aged mice
The proportion of cells bearing the CD271 receptor ascompared tomononuclear cells decreased bymore than 30from the youngest age group (30ndash40) to the oldest group(51ndash65) Such a decrease is less than what was found byStolzing et al [34] whodetermined that the number of colonyforming unit fibroblasts (CFU-Frsquos) formed by bone marrowMSC declined by more than 50 from the youngest to theaged subjects
The frequency of CD271+ ADSCs found per mL oflipoaspirate is higher than what has been reported in bonemarrow aspirates The average lowest proportion of CD271+to CD271minus ADSCs obtained in our study was 18 while therelation of CD271+ MSC from bone marrow was 034 inQuirici et al [13] 028 inCox et al [35] and 00017ndash00201in Alvarez-Viejo et al studies [36] In this sense a hallmark ofour study is that regarding frequency CD271+ ADSCs are abetter source of donor cells for stem cell-based therapies andtissue engineering
In conclusion our results suggest that the proportion ofCD271+ ADSCs isolated from lower back decreases with agehowever cells positive for this marker were present in all ourage groups and their frequency was higher than what hasbeen found in bone marrowThese findings strongly proposeCD271+ ADSCs homogeneous subpopulations as the primarycollection choice for tissue regeneration and for autologousstem cell therapies in older subjects
Abbreviations
ADSCs Adipose-derived stem cellsLNGFR CD271 Low-affinity nerve growth factor receptorMSC Mesenchymal stem cell
Conflict of Interests
The authors have no financial interest to declare in relation tothe content of this paper
8 Stem Cells International
Acknowledgments
The authors wish to acknowledge Dr Victor TrevinoAlvarado for his valuable observations and assistance withdata analysis They are also indebted to the InstitutoTecnologico de Estudios Superiores de Monterrey theZambrano-Hellion Foundation and CONACYT for thePhD student grant
References
[1] D A De Ugarte K Morizono A Elbarbary et al ldquoComparisonof multi-lineage cells from human adipose tissue and bonemarrowrdquo Cells Tissues Organs vol 174 no 3 pp 101ndash109 2003
[2] S Kern H Eichler J Stoeve H Kluter and K BiebackldquoComparative analysis of mesenchymal stem cells from bonemarrow umbilical cord blood or adipose tissuerdquo StemCells vol24 no 5 pp 1294ndash1301 2006
[3] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[4] H J Jin Y K Bae M Kim et al ldquoComparative analysis ofhuman mesenchymal stem cells from bone marrow adiposetissue and umbilical cord blood as sources of cell therapyrdquoInternational Journal of Molecular Sciences vol 14 no 9 pp17986ndash18001 2013
[5] Y Zhu T Liu K Song X Fan X Ma and Z Cui ldquoAdipose-derived stem cell a better stem cell than BMSCrdquo Cell Biochem-istry and Function vol 26 no 6 pp 664ndash675 2008
[6] P A Zuk ldquoThe adipose-derived stem cell looking back andlooking aheadrdquoMolecular Biology of the Cell vol 21 no 11 pp1783ndash1787 2010
[7] M Locke J Windsor and P R Dunbar ldquoHuman adipose-derived stem cells isolation characterization and applicationsin surgeryrdquo ANZ Journal of Surgery vol 79 no 4 pp 235ndash2442009
[8] H Mizuno ldquoAdipose-derived stem cells for tissue repair andregeneration ten years of research and a literature reviewrdquoJournal of NipponMedical School vol 76 no 2 pp 56ndash66 2009
[9] H Mizuno M Tobita and A C Uysal ldquoConcise reviewadipose-derived stem cells as a novel tool for future regenerativemedicinerdquo Stem Cells vol 30 no 5 pp 804ndash810 2012
[10] A Schaffler and C Buchler ldquoConcise review adipose tissue-derived stromal cellsmdashbasic and clinical implications for novelcell-based therapiesrdquo StemCells vol 25 no 4 pp 818ndash827 2007
[11] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[12] P C Baer ldquoAdipose-derived stem cells and their potentialto differentiate into the epithelial lineagerdquo Stem Cells andDevelopment vol 20 no 10 pp 1805ndash1816 2011
[13] NQuirici D Soligo P Bossolasco F Servida C Lumini andGL Deliliers ldquoIsolation of bone marrow mesenchymal stem cellsby anti-nerve growth factor receptor antibodiesrdquo ExperimentalHematology vol 30 no 7 pp 783ndash791 2002
[14] E A Jones A English S E Kinsey et al ldquoOptimization of aflow cytometry-based protocol for detection and phenotypiccharacterization of multipotent mesenchymal stromal cells
from human bone marrowrdquo Cytometry B vol 70 no 6 pp 391ndash399 2006
[15] N Quirici C Scavullo L De Girolamo et al ldquoAnti-L-NGFRand -CD34 monoclonal antibodies identify multipotent mes-enchymal stem cells in human adipose tissuerdquo Stem Cells andDevelopment vol 19 no 6 pp 915ndash925 2010
[16] E Jones and D McGonagle ldquoHuman bone marrow mesenchy-mal stem cells in vivordquo Rheumatology vol 47 no 2 pp 126ndash1312008
[17] Z Kuci S Kuci S Zircher et al ldquoMesenchymal stromal cellsderived from CD271+ bone marrow mononuclear cells exertpotent allosuppressive propertiesrdquo Cytotherapy vol 13 no 10pp 1193ndash1204 2011
[18] N Yamamoto H Akamatsu S Hasegawa et al ldquoIsolation ofmultipotent stem cells from mouse adipose tissuerdquo Journal ofDermatological Science vol 48 no 1 pp 43ndash52 2007
[19] P A Zuk M Zhu H Mizuno et al ldquoMultilineage cells fromhuman adipose tissue implications for cell-based therapiesrdquoTissue Engineering vol 7 no 2 pp 211ndash228 2001
[20] M P Francis P C Sachs LW Elmore and S E Holt ldquoIsolatingadipose-derived mesenchymal stem cells from lipoaspirateblood and saline fractionrdquo Organogenesis vol 6 no 1 pp 11ndash14 2010
[21] The R Project for Statistical Computing httpwwwr-projectorg
[22] B M Strem K C Hicok M Zhu et al ldquoMultipotential differ-entiation of adipose tissue-derived stem cellsrdquo Keio Journal ofMedicine vol 54 no 3 pp 132ndash141 2005
[23] A V Padoin J Braga-Silva P Martins et al ldquoSources ofprocessed lipoaspirate cells influence of donor site on cellconcentrationrdquo Plastic and Reconstructive Surgery vol 122 no2 pp 614ndash618 2008
[24] M Dominici K Le Blanc I Mueller et al ldquoMinimal crite-ria for defining multipotent mesenchymal stromal cells TheInternational Society for Cellular Therapy position statementrdquoCytotherapy vol 8 no 4 pp 315ndash317 2006
[25] I Chambers D Colby M Robertson et al ldquoFunctional expres-sion cloning of Nanog a pluripotency sustaining factor inembryonic stem cellsrdquo Cell vol 113 no 5 pp 643ndash655 2003
[26] A Gagliardi N P Mullin Z Ying Tan et al ldquoA direct physicalinteraction between Nanog and Sox2 regulates embryonic stemcell self-renewalrdquo The EMBO Journal vol 32 no 16 pp 2231ndash2247 2013
[27] SMasui Y Nakatake Y Toyooka et al ldquoPluripotency governedby Sox2 via regulation of Oct34 expression in mouse embry-onic stem cellsrdquo Nature Cell Biology vol 9 no 6 pp 625ndash6352007
[28] V Karwacki-Neisius J Goke R Osorno et al ldquoReducedOct4 expression directs a robust pluripotent state with distinctsignaling activity and increased enhancer occupancy by Oct4and Nanogrdquo Cell Stem Cell vol 12 no 5 pp 531ndash545 2013
[29] S J Bray ldquoNotch signalling a simple pathway becomes com-plexrdquo Nature Reviews Molecular Cell Biology vol 7 no 9 pp678ndash689 2006
[30] M Y Son H Choi Y M Han et al ldquoUnveiling the criticalrole of REX1 in the regulation of human stem cell pluripotencyrdquoStem Cells 2013
[31] J Liu C Sato M Cerletti and A Wagers ldquoNotch signalingin the regulation of stem cell self-renewal and differentiationrdquoCurrent Topics in Developmental Biology vol 92 pp 367ndash4092010
Stem Cells International 9
[32] K Michalczyk and M Ziman ldquoNestin structure and predictedfunction in cellular cytoskeletal organisationrdquo Histology andHistopathology vol 20 no 2 pp 665ndash671 2005
[33] T Yamada H Akamatsu S Hasegawa et al ldquoAge-relatedchanges of p75Neurotrophin receptor-positive adipose-derivedstem cellsrdquo Journal of Dermatological Science vol 58 no 1 pp36ndash42 2010
[34] A Stolzing E Jones D McGonagle and A Scutt ldquoAge-relatedchanges in human bone marrow-derived mesenchymal stemcells consequences for cell therapiesrdquoMechanisms ofAgeing andDevelopment vol 129 no 3 pp 163ndash173 2008
[35] G Cox S A Boxall P V Giannoudis et al ldquoHigh abundance ofCD271+ multipotential stromal cells (MSCs) in intramedullarycavities of long bonesrdquo Bone vol 50 no 2 pp 510ndash517 2012
[36] M Alvarez-Viejo Y Menendez-Menendez M A Blanco-Gelazet al ldquoQuantifyingmesenchymal stem cells in themononuclearcell fraction of bone marrow samples obtained for cell therapyrdquoTransplantation Proceedings vol 45 no 1 pp 434ndash439 2013
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
Stem Cells International 5
CD271 control tube250
200
150
100
50
SSC-
A
times1000
times1000
P1
50 100 150 200 250FSC-A
(a)
CD271APC
Cou
nt
90
80
70
60
50
40
30
20
10
0
APC-A10
210
310
410
5
(b)
CD45FITCCD105PE
Cou
nt
908070605040302010
0
FITC-A10
210
310
410
5
(c)
CD45FITCCD105PE
Cou
nt150
100
50
0
PE-A10
210
310
410
5
(d)
CD34PECD45FITC
Cou
nt
70
60
50
40
30
20
10
0
PE-A10
210
310
410
5
(e)
CD90FITCCD105PE
Cou
nt
125
100
75
50
25
0
FITC-A10
210
310
410
5
(f)
Figure 2 Representative results of flow cytometry analysis are shown for samples of 3 times 105 CD271+ ADSCs passage 1 from a 42-year-olddonor (a) The CD271+ ADSC population indicated with gage P1 comprises 754 of the 10000 events analyzed (b) Histogram showingthat 73 of cells from gage P1 yield positive for the CD271-APC receptor (c) Histogram depicting that the CD271+ ADSC population isnegative for CD45-FITC receptor (d) Histogram demonstrating that the CD271+ ADSC population is positive for the CD105-PE receptor (e)The histogram shows that 87 of the CD271+ ADSC population is positive for the CD34-PE (f) Histogram demonstrating that 97 of theCD271+ ADSC population yields positive for the CD90-FITC receptor
6 Stem Cells International
(a) (b)
(c) (d)
Figure 3 Morphological changes through different induction media (a) CD271+ ADSCs passage 1 after 21 days in culture without induction(20x) (b) Morphological changes visible at day 21 of adipogenic differentiation (20x) (c) Osteogenic differentiation observed at inductionday 21 (20x) (d) Microphotograph showing extracellular mineralization unveiled through Alizarin Red staining in CD271+ ADSCs after 21days of osteogenic induction (20x)
GADPH Nestin Nanog Sox2Notch1Rex1Oct40000
0200
0400
0600
0800
1000
1200
Nestin Nanog Oct4 Rex1 Notch1 Sox2
(a)
(b)
(c)
(d)
Group age 30ndash40Group age 41ndash50
Group age 51ndash65
GADPH
rela
tive a
ctiv
ity
Figure 4 Gene expression analysis The upper image shows a representative agarose gel electrophoresis showing the expression of selectedstem cell genes from the following donor age groups (a) 30ndash40 years old (b) 41ndash50 years old and (c) 51ndash65 years old (d) shows the averageof the GADPH relative gene expression and the error bars indicate the standard deviation in samples from the same age group
Stem Cells International 7
4 Discussion
Adult stem cells can be isolated from various tissue sourcesbone marrow being the most widely used in clinical applica-tionsThe commonproblem in isolating adult stem cells is thelow yield and the limited amount of tissue to harvest fromRecently researchers found that the frequency of stem cellswithin adipose tissue is approximately 8-fold higher than inbone marrow [22] Our results demonstrated that lower backand abdomen were the sites with the highest mononuclearcell concentrations in agreement with the results reported byPadoin et al [23]
Cells harvested from the stromal vascular fraction com-prise a heterogeneous population including preadipocytesadipocytes pericytes endothelial cells ADSCs fibroblastsmonocytes macrophages and lymphocytes [10] respondingdifferently to stimuli For the above it is important to reducecell heterogeneity before the use of adipose-derived stemcells for regenerative therapies Exposing a heterogeneouspopulation of stem cells to an inductionmediummight resultin subpopulations undergoing differentiation into differentlineages which could decrease its effectiveness Thereforethe use of monoclonal antibodies has been proposed forstem cell isolation and selection in order to decrease thisheterogeneity
Recently CD271 (LNGFR) has been described as theoptimal selective marker for the purification and isolation ofADSCs [15] and bonemarrow derived stem cells [13 14] Cellsbearing this receptor have a higher multipotency and prolif-erative capability when compared to the whole populationof unselected ADSCs Studies performed at our laboratoryhave demonstrated that the expression of CD271 decreaseswith culture time perhaps induced by plastic adherence andculture conditions Such results are in agreement with whatwas found for bonemarrowderived stem cells leadingQuiriciet al [13] to the hypothesis that CD271 might be a marker forresting primitive MSC
Cultured CD271+ ADSCs from all age groups studiedwere positive for stem cellmarkersThy1 (CD90) and endoglin(CD105) No expression was found for the hematopoieticmarker CD45 Positive expression of CD90 and CD105 aswell as negative expression of CD45 is some of the minimalcriteria for stem cells definition proposed by the Mes-enchymal and Tissue Stem Cell Committee of the Interna-tional Society for Cellular Therapy [24] Our results showedthat CD271+ ADSCs samples from all groups includingthose from older patients express the core transcriptionfactors associated with cell self-renewal Sox2 Oct4 andNanog [25ndash29] Similarly CD271+ ADSCs samples expressedRex1ZFP42 a known marker of pluripotency [30] andNotch1 a receptor of the Notch signaling pathway whichplays a role in stem cell self-renewal and differentiation [31]CD271+ ADSCs highly expressed Nestin a gene responsiblefor synthesizing nestin an intermediate cytoskeletal proteinwhich has been related with proliferative cells in whichspeedy cytoskeleton organization is vital [32] A reductionin these genesrsquo expression was seen in donors from the olderage range suggesting that in older subjects the stemness geneexpressions decrease however remain active and give the
possibility to respond to any induction Nevertheless it isimportant to perform several induction protocols in orderto establish its potential capability
Studying CD271+ ADSCs is important for elucidating therelationship between the CD271 receptor with multipotencyand proliferation as compared to CD271minus ADSCs SinceCD271+ ADSCs are a subset of mononuclear cells it is safeto correlate CD271+ concentrations with the size of mononu-clear cell populations We found the highest concentration ofmononuclear cells in the patients in the range of 30ndash40 yearsas well as CD271+ ADSCs
The cell distribution behaved similarly decreasing bothwith age Our results show that there is a significant statisticaldifference between the CD271+ ADSCs concentrations foreach age group range with the 30ndash40-year-old range contain-ing the highest cell concentration Data appeared normal anda straight line was fitted indicating that there is a correlationbetween the CD271+ ADSCs concentration and age Weattribute this correlation to a decrease in stem cell numberThis finding is similar to what was found by Yamada et al[33] who concluded that the number of ADSCs positive forCD271 per adipose tissue weight decreased in aged mice
The proportion of cells bearing the CD271 receptor ascompared tomononuclear cells decreased bymore than 30from the youngest age group (30ndash40) to the oldest group(51ndash65) Such a decrease is less than what was found byStolzing et al [34] whodetermined that the number of colonyforming unit fibroblasts (CFU-Frsquos) formed by bone marrowMSC declined by more than 50 from the youngest to theaged subjects
The frequency of CD271+ ADSCs found per mL oflipoaspirate is higher than what has been reported in bonemarrow aspirates The average lowest proportion of CD271+to CD271minus ADSCs obtained in our study was 18 while therelation of CD271+ MSC from bone marrow was 034 inQuirici et al [13] 028 inCox et al [35] and 00017ndash00201in Alvarez-Viejo et al studies [36] In this sense a hallmark ofour study is that regarding frequency CD271+ ADSCs are abetter source of donor cells for stem cell-based therapies andtissue engineering
In conclusion our results suggest that the proportion ofCD271+ ADSCs isolated from lower back decreases with agehowever cells positive for this marker were present in all ourage groups and their frequency was higher than what hasbeen found in bone marrowThese findings strongly proposeCD271+ ADSCs homogeneous subpopulations as the primarycollection choice for tissue regeneration and for autologousstem cell therapies in older subjects
Abbreviations
ADSCs Adipose-derived stem cellsLNGFR CD271 Low-affinity nerve growth factor receptorMSC Mesenchymal stem cell
Conflict of Interests
The authors have no financial interest to declare in relation tothe content of this paper
8 Stem Cells International
Acknowledgments
The authors wish to acknowledge Dr Victor TrevinoAlvarado for his valuable observations and assistance withdata analysis They are also indebted to the InstitutoTecnologico de Estudios Superiores de Monterrey theZambrano-Hellion Foundation and CONACYT for thePhD student grant
References
[1] D A De Ugarte K Morizono A Elbarbary et al ldquoComparisonof multi-lineage cells from human adipose tissue and bonemarrowrdquo Cells Tissues Organs vol 174 no 3 pp 101ndash109 2003
[2] S Kern H Eichler J Stoeve H Kluter and K BiebackldquoComparative analysis of mesenchymal stem cells from bonemarrow umbilical cord blood or adipose tissuerdquo StemCells vol24 no 5 pp 1294ndash1301 2006
[3] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[4] H J Jin Y K Bae M Kim et al ldquoComparative analysis ofhuman mesenchymal stem cells from bone marrow adiposetissue and umbilical cord blood as sources of cell therapyrdquoInternational Journal of Molecular Sciences vol 14 no 9 pp17986ndash18001 2013
[5] Y Zhu T Liu K Song X Fan X Ma and Z Cui ldquoAdipose-derived stem cell a better stem cell than BMSCrdquo Cell Biochem-istry and Function vol 26 no 6 pp 664ndash675 2008
[6] P A Zuk ldquoThe adipose-derived stem cell looking back andlooking aheadrdquoMolecular Biology of the Cell vol 21 no 11 pp1783ndash1787 2010
[7] M Locke J Windsor and P R Dunbar ldquoHuman adipose-derived stem cells isolation characterization and applicationsin surgeryrdquo ANZ Journal of Surgery vol 79 no 4 pp 235ndash2442009
[8] H Mizuno ldquoAdipose-derived stem cells for tissue repair andregeneration ten years of research and a literature reviewrdquoJournal of NipponMedical School vol 76 no 2 pp 56ndash66 2009
[9] H Mizuno M Tobita and A C Uysal ldquoConcise reviewadipose-derived stem cells as a novel tool for future regenerativemedicinerdquo Stem Cells vol 30 no 5 pp 804ndash810 2012
[10] A Schaffler and C Buchler ldquoConcise review adipose tissue-derived stromal cellsmdashbasic and clinical implications for novelcell-based therapiesrdquo StemCells vol 25 no 4 pp 818ndash827 2007
[11] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[12] P C Baer ldquoAdipose-derived stem cells and their potentialto differentiate into the epithelial lineagerdquo Stem Cells andDevelopment vol 20 no 10 pp 1805ndash1816 2011
[13] NQuirici D Soligo P Bossolasco F Servida C Lumini andGL Deliliers ldquoIsolation of bone marrow mesenchymal stem cellsby anti-nerve growth factor receptor antibodiesrdquo ExperimentalHematology vol 30 no 7 pp 783ndash791 2002
[14] E A Jones A English S E Kinsey et al ldquoOptimization of aflow cytometry-based protocol for detection and phenotypiccharacterization of multipotent mesenchymal stromal cells
from human bone marrowrdquo Cytometry B vol 70 no 6 pp 391ndash399 2006
[15] N Quirici C Scavullo L De Girolamo et al ldquoAnti-L-NGFRand -CD34 monoclonal antibodies identify multipotent mes-enchymal stem cells in human adipose tissuerdquo Stem Cells andDevelopment vol 19 no 6 pp 915ndash925 2010
[16] E Jones and D McGonagle ldquoHuman bone marrow mesenchy-mal stem cells in vivordquo Rheumatology vol 47 no 2 pp 126ndash1312008
[17] Z Kuci S Kuci S Zircher et al ldquoMesenchymal stromal cellsderived from CD271+ bone marrow mononuclear cells exertpotent allosuppressive propertiesrdquo Cytotherapy vol 13 no 10pp 1193ndash1204 2011
[18] N Yamamoto H Akamatsu S Hasegawa et al ldquoIsolation ofmultipotent stem cells from mouse adipose tissuerdquo Journal ofDermatological Science vol 48 no 1 pp 43ndash52 2007
[19] P A Zuk M Zhu H Mizuno et al ldquoMultilineage cells fromhuman adipose tissue implications for cell-based therapiesrdquoTissue Engineering vol 7 no 2 pp 211ndash228 2001
[20] M P Francis P C Sachs LW Elmore and S E Holt ldquoIsolatingadipose-derived mesenchymal stem cells from lipoaspirateblood and saline fractionrdquo Organogenesis vol 6 no 1 pp 11ndash14 2010
[21] The R Project for Statistical Computing httpwwwr-projectorg
[22] B M Strem K C Hicok M Zhu et al ldquoMultipotential differ-entiation of adipose tissue-derived stem cellsrdquo Keio Journal ofMedicine vol 54 no 3 pp 132ndash141 2005
[23] A V Padoin J Braga-Silva P Martins et al ldquoSources ofprocessed lipoaspirate cells influence of donor site on cellconcentrationrdquo Plastic and Reconstructive Surgery vol 122 no2 pp 614ndash618 2008
[24] M Dominici K Le Blanc I Mueller et al ldquoMinimal crite-ria for defining multipotent mesenchymal stromal cells TheInternational Society for Cellular Therapy position statementrdquoCytotherapy vol 8 no 4 pp 315ndash317 2006
[25] I Chambers D Colby M Robertson et al ldquoFunctional expres-sion cloning of Nanog a pluripotency sustaining factor inembryonic stem cellsrdquo Cell vol 113 no 5 pp 643ndash655 2003
[26] A Gagliardi N P Mullin Z Ying Tan et al ldquoA direct physicalinteraction between Nanog and Sox2 regulates embryonic stemcell self-renewalrdquo The EMBO Journal vol 32 no 16 pp 2231ndash2247 2013
[27] SMasui Y Nakatake Y Toyooka et al ldquoPluripotency governedby Sox2 via regulation of Oct34 expression in mouse embry-onic stem cellsrdquo Nature Cell Biology vol 9 no 6 pp 625ndash6352007
[28] V Karwacki-Neisius J Goke R Osorno et al ldquoReducedOct4 expression directs a robust pluripotent state with distinctsignaling activity and increased enhancer occupancy by Oct4and Nanogrdquo Cell Stem Cell vol 12 no 5 pp 531ndash545 2013
[29] S J Bray ldquoNotch signalling a simple pathway becomes com-plexrdquo Nature Reviews Molecular Cell Biology vol 7 no 9 pp678ndash689 2006
[30] M Y Son H Choi Y M Han et al ldquoUnveiling the criticalrole of REX1 in the regulation of human stem cell pluripotencyrdquoStem Cells 2013
[31] J Liu C Sato M Cerletti and A Wagers ldquoNotch signalingin the regulation of stem cell self-renewal and differentiationrdquoCurrent Topics in Developmental Biology vol 92 pp 367ndash4092010
Stem Cells International 9
[32] K Michalczyk and M Ziman ldquoNestin structure and predictedfunction in cellular cytoskeletal organisationrdquo Histology andHistopathology vol 20 no 2 pp 665ndash671 2005
[33] T Yamada H Akamatsu S Hasegawa et al ldquoAge-relatedchanges of p75Neurotrophin receptor-positive adipose-derivedstem cellsrdquo Journal of Dermatological Science vol 58 no 1 pp36ndash42 2010
[34] A Stolzing E Jones D McGonagle and A Scutt ldquoAge-relatedchanges in human bone marrow-derived mesenchymal stemcells consequences for cell therapiesrdquoMechanisms ofAgeing andDevelopment vol 129 no 3 pp 163ndash173 2008
[35] G Cox S A Boxall P V Giannoudis et al ldquoHigh abundance ofCD271+ multipotential stromal cells (MSCs) in intramedullarycavities of long bonesrdquo Bone vol 50 no 2 pp 510ndash517 2012
[36] M Alvarez-Viejo Y Menendez-Menendez M A Blanco-Gelazet al ldquoQuantifyingmesenchymal stem cells in themononuclearcell fraction of bone marrow samples obtained for cell therapyrdquoTransplantation Proceedings vol 45 no 1 pp 434ndash439 2013
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
6 Stem Cells International
(a) (b)
(c) (d)
Figure 3 Morphological changes through different induction media (a) CD271+ ADSCs passage 1 after 21 days in culture without induction(20x) (b) Morphological changes visible at day 21 of adipogenic differentiation (20x) (c) Osteogenic differentiation observed at inductionday 21 (20x) (d) Microphotograph showing extracellular mineralization unveiled through Alizarin Red staining in CD271+ ADSCs after 21days of osteogenic induction (20x)
GADPH Nestin Nanog Sox2Notch1Rex1Oct40000
0200
0400
0600
0800
1000
1200
Nestin Nanog Oct4 Rex1 Notch1 Sox2
(a)
(b)
(c)
(d)
Group age 30ndash40Group age 41ndash50
Group age 51ndash65
GADPH
rela
tive a
ctiv
ity
Figure 4 Gene expression analysis The upper image shows a representative agarose gel electrophoresis showing the expression of selectedstem cell genes from the following donor age groups (a) 30ndash40 years old (b) 41ndash50 years old and (c) 51ndash65 years old (d) shows the averageof the GADPH relative gene expression and the error bars indicate the standard deviation in samples from the same age group
Stem Cells International 7
4 Discussion
Adult stem cells can be isolated from various tissue sourcesbone marrow being the most widely used in clinical applica-tionsThe commonproblem in isolating adult stem cells is thelow yield and the limited amount of tissue to harvest fromRecently researchers found that the frequency of stem cellswithin adipose tissue is approximately 8-fold higher than inbone marrow [22] Our results demonstrated that lower backand abdomen were the sites with the highest mononuclearcell concentrations in agreement with the results reported byPadoin et al [23]
Cells harvested from the stromal vascular fraction com-prise a heterogeneous population including preadipocytesadipocytes pericytes endothelial cells ADSCs fibroblastsmonocytes macrophages and lymphocytes [10] respondingdifferently to stimuli For the above it is important to reducecell heterogeneity before the use of adipose-derived stemcells for regenerative therapies Exposing a heterogeneouspopulation of stem cells to an inductionmediummight resultin subpopulations undergoing differentiation into differentlineages which could decrease its effectiveness Thereforethe use of monoclonal antibodies has been proposed forstem cell isolation and selection in order to decrease thisheterogeneity
Recently CD271 (LNGFR) has been described as theoptimal selective marker for the purification and isolation ofADSCs [15] and bonemarrow derived stem cells [13 14] Cellsbearing this receptor have a higher multipotency and prolif-erative capability when compared to the whole populationof unselected ADSCs Studies performed at our laboratoryhave demonstrated that the expression of CD271 decreaseswith culture time perhaps induced by plastic adherence andculture conditions Such results are in agreement with whatwas found for bonemarrowderived stem cells leadingQuiriciet al [13] to the hypothesis that CD271 might be a marker forresting primitive MSC
Cultured CD271+ ADSCs from all age groups studiedwere positive for stem cellmarkersThy1 (CD90) and endoglin(CD105) No expression was found for the hematopoieticmarker CD45 Positive expression of CD90 and CD105 aswell as negative expression of CD45 is some of the minimalcriteria for stem cells definition proposed by the Mes-enchymal and Tissue Stem Cell Committee of the Interna-tional Society for Cellular Therapy [24] Our results showedthat CD271+ ADSCs samples from all groups includingthose from older patients express the core transcriptionfactors associated with cell self-renewal Sox2 Oct4 andNanog [25ndash29] Similarly CD271+ ADSCs samples expressedRex1ZFP42 a known marker of pluripotency [30] andNotch1 a receptor of the Notch signaling pathway whichplays a role in stem cell self-renewal and differentiation [31]CD271+ ADSCs highly expressed Nestin a gene responsiblefor synthesizing nestin an intermediate cytoskeletal proteinwhich has been related with proliferative cells in whichspeedy cytoskeleton organization is vital [32] A reductionin these genesrsquo expression was seen in donors from the olderage range suggesting that in older subjects the stemness geneexpressions decrease however remain active and give the
possibility to respond to any induction Nevertheless it isimportant to perform several induction protocols in orderto establish its potential capability
Studying CD271+ ADSCs is important for elucidating therelationship between the CD271 receptor with multipotencyand proliferation as compared to CD271minus ADSCs SinceCD271+ ADSCs are a subset of mononuclear cells it is safeto correlate CD271+ concentrations with the size of mononu-clear cell populations We found the highest concentration ofmononuclear cells in the patients in the range of 30ndash40 yearsas well as CD271+ ADSCs
The cell distribution behaved similarly decreasing bothwith age Our results show that there is a significant statisticaldifference between the CD271+ ADSCs concentrations foreach age group range with the 30ndash40-year-old range contain-ing the highest cell concentration Data appeared normal anda straight line was fitted indicating that there is a correlationbetween the CD271+ ADSCs concentration and age Weattribute this correlation to a decrease in stem cell numberThis finding is similar to what was found by Yamada et al[33] who concluded that the number of ADSCs positive forCD271 per adipose tissue weight decreased in aged mice
The proportion of cells bearing the CD271 receptor ascompared tomononuclear cells decreased bymore than 30from the youngest age group (30ndash40) to the oldest group(51ndash65) Such a decrease is less than what was found byStolzing et al [34] whodetermined that the number of colonyforming unit fibroblasts (CFU-Frsquos) formed by bone marrowMSC declined by more than 50 from the youngest to theaged subjects
The frequency of CD271+ ADSCs found per mL oflipoaspirate is higher than what has been reported in bonemarrow aspirates The average lowest proportion of CD271+to CD271minus ADSCs obtained in our study was 18 while therelation of CD271+ MSC from bone marrow was 034 inQuirici et al [13] 028 inCox et al [35] and 00017ndash00201in Alvarez-Viejo et al studies [36] In this sense a hallmark ofour study is that regarding frequency CD271+ ADSCs are abetter source of donor cells for stem cell-based therapies andtissue engineering
In conclusion our results suggest that the proportion ofCD271+ ADSCs isolated from lower back decreases with agehowever cells positive for this marker were present in all ourage groups and their frequency was higher than what hasbeen found in bone marrowThese findings strongly proposeCD271+ ADSCs homogeneous subpopulations as the primarycollection choice for tissue regeneration and for autologousstem cell therapies in older subjects
Abbreviations
ADSCs Adipose-derived stem cellsLNGFR CD271 Low-affinity nerve growth factor receptorMSC Mesenchymal stem cell
Conflict of Interests
The authors have no financial interest to declare in relation tothe content of this paper
8 Stem Cells International
Acknowledgments
The authors wish to acknowledge Dr Victor TrevinoAlvarado for his valuable observations and assistance withdata analysis They are also indebted to the InstitutoTecnologico de Estudios Superiores de Monterrey theZambrano-Hellion Foundation and CONACYT for thePhD student grant
References
[1] D A De Ugarte K Morizono A Elbarbary et al ldquoComparisonof multi-lineage cells from human adipose tissue and bonemarrowrdquo Cells Tissues Organs vol 174 no 3 pp 101ndash109 2003
[2] S Kern H Eichler J Stoeve H Kluter and K BiebackldquoComparative analysis of mesenchymal stem cells from bonemarrow umbilical cord blood or adipose tissuerdquo StemCells vol24 no 5 pp 1294ndash1301 2006
[3] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[4] H J Jin Y K Bae M Kim et al ldquoComparative analysis ofhuman mesenchymal stem cells from bone marrow adiposetissue and umbilical cord blood as sources of cell therapyrdquoInternational Journal of Molecular Sciences vol 14 no 9 pp17986ndash18001 2013
[5] Y Zhu T Liu K Song X Fan X Ma and Z Cui ldquoAdipose-derived stem cell a better stem cell than BMSCrdquo Cell Biochem-istry and Function vol 26 no 6 pp 664ndash675 2008
[6] P A Zuk ldquoThe adipose-derived stem cell looking back andlooking aheadrdquoMolecular Biology of the Cell vol 21 no 11 pp1783ndash1787 2010
[7] M Locke J Windsor and P R Dunbar ldquoHuman adipose-derived stem cells isolation characterization and applicationsin surgeryrdquo ANZ Journal of Surgery vol 79 no 4 pp 235ndash2442009
[8] H Mizuno ldquoAdipose-derived stem cells for tissue repair andregeneration ten years of research and a literature reviewrdquoJournal of NipponMedical School vol 76 no 2 pp 56ndash66 2009
[9] H Mizuno M Tobita and A C Uysal ldquoConcise reviewadipose-derived stem cells as a novel tool for future regenerativemedicinerdquo Stem Cells vol 30 no 5 pp 804ndash810 2012
[10] A Schaffler and C Buchler ldquoConcise review adipose tissue-derived stromal cellsmdashbasic and clinical implications for novelcell-based therapiesrdquo StemCells vol 25 no 4 pp 818ndash827 2007
[11] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[12] P C Baer ldquoAdipose-derived stem cells and their potentialto differentiate into the epithelial lineagerdquo Stem Cells andDevelopment vol 20 no 10 pp 1805ndash1816 2011
[13] NQuirici D Soligo P Bossolasco F Servida C Lumini andGL Deliliers ldquoIsolation of bone marrow mesenchymal stem cellsby anti-nerve growth factor receptor antibodiesrdquo ExperimentalHematology vol 30 no 7 pp 783ndash791 2002
[14] E A Jones A English S E Kinsey et al ldquoOptimization of aflow cytometry-based protocol for detection and phenotypiccharacterization of multipotent mesenchymal stromal cells
from human bone marrowrdquo Cytometry B vol 70 no 6 pp 391ndash399 2006
[15] N Quirici C Scavullo L De Girolamo et al ldquoAnti-L-NGFRand -CD34 monoclonal antibodies identify multipotent mes-enchymal stem cells in human adipose tissuerdquo Stem Cells andDevelopment vol 19 no 6 pp 915ndash925 2010
[16] E Jones and D McGonagle ldquoHuman bone marrow mesenchy-mal stem cells in vivordquo Rheumatology vol 47 no 2 pp 126ndash1312008
[17] Z Kuci S Kuci S Zircher et al ldquoMesenchymal stromal cellsderived from CD271+ bone marrow mononuclear cells exertpotent allosuppressive propertiesrdquo Cytotherapy vol 13 no 10pp 1193ndash1204 2011
[18] N Yamamoto H Akamatsu S Hasegawa et al ldquoIsolation ofmultipotent stem cells from mouse adipose tissuerdquo Journal ofDermatological Science vol 48 no 1 pp 43ndash52 2007
[19] P A Zuk M Zhu H Mizuno et al ldquoMultilineage cells fromhuman adipose tissue implications for cell-based therapiesrdquoTissue Engineering vol 7 no 2 pp 211ndash228 2001
[20] M P Francis P C Sachs LW Elmore and S E Holt ldquoIsolatingadipose-derived mesenchymal stem cells from lipoaspirateblood and saline fractionrdquo Organogenesis vol 6 no 1 pp 11ndash14 2010
[21] The R Project for Statistical Computing httpwwwr-projectorg
[22] B M Strem K C Hicok M Zhu et al ldquoMultipotential differ-entiation of adipose tissue-derived stem cellsrdquo Keio Journal ofMedicine vol 54 no 3 pp 132ndash141 2005
[23] A V Padoin J Braga-Silva P Martins et al ldquoSources ofprocessed lipoaspirate cells influence of donor site on cellconcentrationrdquo Plastic and Reconstructive Surgery vol 122 no2 pp 614ndash618 2008
[24] M Dominici K Le Blanc I Mueller et al ldquoMinimal crite-ria for defining multipotent mesenchymal stromal cells TheInternational Society for Cellular Therapy position statementrdquoCytotherapy vol 8 no 4 pp 315ndash317 2006
[25] I Chambers D Colby M Robertson et al ldquoFunctional expres-sion cloning of Nanog a pluripotency sustaining factor inembryonic stem cellsrdquo Cell vol 113 no 5 pp 643ndash655 2003
[26] A Gagliardi N P Mullin Z Ying Tan et al ldquoA direct physicalinteraction between Nanog and Sox2 regulates embryonic stemcell self-renewalrdquo The EMBO Journal vol 32 no 16 pp 2231ndash2247 2013
[27] SMasui Y Nakatake Y Toyooka et al ldquoPluripotency governedby Sox2 via regulation of Oct34 expression in mouse embry-onic stem cellsrdquo Nature Cell Biology vol 9 no 6 pp 625ndash6352007
[28] V Karwacki-Neisius J Goke R Osorno et al ldquoReducedOct4 expression directs a robust pluripotent state with distinctsignaling activity and increased enhancer occupancy by Oct4and Nanogrdquo Cell Stem Cell vol 12 no 5 pp 531ndash545 2013
[29] S J Bray ldquoNotch signalling a simple pathway becomes com-plexrdquo Nature Reviews Molecular Cell Biology vol 7 no 9 pp678ndash689 2006
[30] M Y Son H Choi Y M Han et al ldquoUnveiling the criticalrole of REX1 in the regulation of human stem cell pluripotencyrdquoStem Cells 2013
[31] J Liu C Sato M Cerletti and A Wagers ldquoNotch signalingin the regulation of stem cell self-renewal and differentiationrdquoCurrent Topics in Developmental Biology vol 92 pp 367ndash4092010
Stem Cells International 9
[32] K Michalczyk and M Ziman ldquoNestin structure and predictedfunction in cellular cytoskeletal organisationrdquo Histology andHistopathology vol 20 no 2 pp 665ndash671 2005
[33] T Yamada H Akamatsu S Hasegawa et al ldquoAge-relatedchanges of p75Neurotrophin receptor-positive adipose-derivedstem cellsrdquo Journal of Dermatological Science vol 58 no 1 pp36ndash42 2010
[34] A Stolzing E Jones D McGonagle and A Scutt ldquoAge-relatedchanges in human bone marrow-derived mesenchymal stemcells consequences for cell therapiesrdquoMechanisms ofAgeing andDevelopment vol 129 no 3 pp 163ndash173 2008
[35] G Cox S A Boxall P V Giannoudis et al ldquoHigh abundance ofCD271+ multipotential stromal cells (MSCs) in intramedullarycavities of long bonesrdquo Bone vol 50 no 2 pp 510ndash517 2012
[36] M Alvarez-Viejo Y Menendez-Menendez M A Blanco-Gelazet al ldquoQuantifyingmesenchymal stem cells in themononuclearcell fraction of bone marrow samples obtained for cell therapyrdquoTransplantation Proceedings vol 45 no 1 pp 434ndash439 2013
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
Stem Cells International 7
4 Discussion
Adult stem cells can be isolated from various tissue sourcesbone marrow being the most widely used in clinical applica-tionsThe commonproblem in isolating adult stem cells is thelow yield and the limited amount of tissue to harvest fromRecently researchers found that the frequency of stem cellswithin adipose tissue is approximately 8-fold higher than inbone marrow [22] Our results demonstrated that lower backand abdomen were the sites with the highest mononuclearcell concentrations in agreement with the results reported byPadoin et al [23]
Cells harvested from the stromal vascular fraction com-prise a heterogeneous population including preadipocytesadipocytes pericytes endothelial cells ADSCs fibroblastsmonocytes macrophages and lymphocytes [10] respondingdifferently to stimuli For the above it is important to reducecell heterogeneity before the use of adipose-derived stemcells for regenerative therapies Exposing a heterogeneouspopulation of stem cells to an inductionmediummight resultin subpopulations undergoing differentiation into differentlineages which could decrease its effectiveness Thereforethe use of monoclonal antibodies has been proposed forstem cell isolation and selection in order to decrease thisheterogeneity
Recently CD271 (LNGFR) has been described as theoptimal selective marker for the purification and isolation ofADSCs [15] and bonemarrow derived stem cells [13 14] Cellsbearing this receptor have a higher multipotency and prolif-erative capability when compared to the whole populationof unselected ADSCs Studies performed at our laboratoryhave demonstrated that the expression of CD271 decreaseswith culture time perhaps induced by plastic adherence andculture conditions Such results are in agreement with whatwas found for bonemarrowderived stem cells leadingQuiriciet al [13] to the hypothesis that CD271 might be a marker forresting primitive MSC
Cultured CD271+ ADSCs from all age groups studiedwere positive for stem cellmarkersThy1 (CD90) and endoglin(CD105) No expression was found for the hematopoieticmarker CD45 Positive expression of CD90 and CD105 aswell as negative expression of CD45 is some of the minimalcriteria for stem cells definition proposed by the Mes-enchymal and Tissue Stem Cell Committee of the Interna-tional Society for Cellular Therapy [24] Our results showedthat CD271+ ADSCs samples from all groups includingthose from older patients express the core transcriptionfactors associated with cell self-renewal Sox2 Oct4 andNanog [25ndash29] Similarly CD271+ ADSCs samples expressedRex1ZFP42 a known marker of pluripotency [30] andNotch1 a receptor of the Notch signaling pathway whichplays a role in stem cell self-renewal and differentiation [31]CD271+ ADSCs highly expressed Nestin a gene responsiblefor synthesizing nestin an intermediate cytoskeletal proteinwhich has been related with proliferative cells in whichspeedy cytoskeleton organization is vital [32] A reductionin these genesrsquo expression was seen in donors from the olderage range suggesting that in older subjects the stemness geneexpressions decrease however remain active and give the
possibility to respond to any induction Nevertheless it isimportant to perform several induction protocols in orderto establish its potential capability
Studying CD271+ ADSCs is important for elucidating therelationship between the CD271 receptor with multipotencyand proliferation as compared to CD271minus ADSCs SinceCD271+ ADSCs are a subset of mononuclear cells it is safeto correlate CD271+ concentrations with the size of mononu-clear cell populations We found the highest concentration ofmononuclear cells in the patients in the range of 30ndash40 yearsas well as CD271+ ADSCs
The cell distribution behaved similarly decreasing bothwith age Our results show that there is a significant statisticaldifference between the CD271+ ADSCs concentrations foreach age group range with the 30ndash40-year-old range contain-ing the highest cell concentration Data appeared normal anda straight line was fitted indicating that there is a correlationbetween the CD271+ ADSCs concentration and age Weattribute this correlation to a decrease in stem cell numberThis finding is similar to what was found by Yamada et al[33] who concluded that the number of ADSCs positive forCD271 per adipose tissue weight decreased in aged mice
The proportion of cells bearing the CD271 receptor ascompared tomononuclear cells decreased bymore than 30from the youngest age group (30ndash40) to the oldest group(51ndash65) Such a decrease is less than what was found byStolzing et al [34] whodetermined that the number of colonyforming unit fibroblasts (CFU-Frsquos) formed by bone marrowMSC declined by more than 50 from the youngest to theaged subjects
The frequency of CD271+ ADSCs found per mL oflipoaspirate is higher than what has been reported in bonemarrow aspirates The average lowest proportion of CD271+to CD271minus ADSCs obtained in our study was 18 while therelation of CD271+ MSC from bone marrow was 034 inQuirici et al [13] 028 inCox et al [35] and 00017ndash00201in Alvarez-Viejo et al studies [36] In this sense a hallmark ofour study is that regarding frequency CD271+ ADSCs are abetter source of donor cells for stem cell-based therapies andtissue engineering
In conclusion our results suggest that the proportion ofCD271+ ADSCs isolated from lower back decreases with agehowever cells positive for this marker were present in all ourage groups and their frequency was higher than what hasbeen found in bone marrowThese findings strongly proposeCD271+ ADSCs homogeneous subpopulations as the primarycollection choice for tissue regeneration and for autologousstem cell therapies in older subjects
Abbreviations
ADSCs Adipose-derived stem cellsLNGFR CD271 Low-affinity nerve growth factor receptorMSC Mesenchymal stem cell
Conflict of Interests
The authors have no financial interest to declare in relation tothe content of this paper
8 Stem Cells International
Acknowledgments
The authors wish to acknowledge Dr Victor TrevinoAlvarado for his valuable observations and assistance withdata analysis They are also indebted to the InstitutoTecnologico de Estudios Superiores de Monterrey theZambrano-Hellion Foundation and CONACYT for thePhD student grant
References
[1] D A De Ugarte K Morizono A Elbarbary et al ldquoComparisonof multi-lineage cells from human adipose tissue and bonemarrowrdquo Cells Tissues Organs vol 174 no 3 pp 101ndash109 2003
[2] S Kern H Eichler J Stoeve H Kluter and K BiebackldquoComparative analysis of mesenchymal stem cells from bonemarrow umbilical cord blood or adipose tissuerdquo StemCells vol24 no 5 pp 1294ndash1301 2006
[3] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[4] H J Jin Y K Bae M Kim et al ldquoComparative analysis ofhuman mesenchymal stem cells from bone marrow adiposetissue and umbilical cord blood as sources of cell therapyrdquoInternational Journal of Molecular Sciences vol 14 no 9 pp17986ndash18001 2013
[5] Y Zhu T Liu K Song X Fan X Ma and Z Cui ldquoAdipose-derived stem cell a better stem cell than BMSCrdquo Cell Biochem-istry and Function vol 26 no 6 pp 664ndash675 2008
[6] P A Zuk ldquoThe adipose-derived stem cell looking back andlooking aheadrdquoMolecular Biology of the Cell vol 21 no 11 pp1783ndash1787 2010
[7] M Locke J Windsor and P R Dunbar ldquoHuman adipose-derived stem cells isolation characterization and applicationsin surgeryrdquo ANZ Journal of Surgery vol 79 no 4 pp 235ndash2442009
[8] H Mizuno ldquoAdipose-derived stem cells for tissue repair andregeneration ten years of research and a literature reviewrdquoJournal of NipponMedical School vol 76 no 2 pp 56ndash66 2009
[9] H Mizuno M Tobita and A C Uysal ldquoConcise reviewadipose-derived stem cells as a novel tool for future regenerativemedicinerdquo Stem Cells vol 30 no 5 pp 804ndash810 2012
[10] A Schaffler and C Buchler ldquoConcise review adipose tissue-derived stromal cellsmdashbasic and clinical implications for novelcell-based therapiesrdquo StemCells vol 25 no 4 pp 818ndash827 2007
[11] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[12] P C Baer ldquoAdipose-derived stem cells and their potentialto differentiate into the epithelial lineagerdquo Stem Cells andDevelopment vol 20 no 10 pp 1805ndash1816 2011
[13] NQuirici D Soligo P Bossolasco F Servida C Lumini andGL Deliliers ldquoIsolation of bone marrow mesenchymal stem cellsby anti-nerve growth factor receptor antibodiesrdquo ExperimentalHematology vol 30 no 7 pp 783ndash791 2002
[14] E A Jones A English S E Kinsey et al ldquoOptimization of aflow cytometry-based protocol for detection and phenotypiccharacterization of multipotent mesenchymal stromal cells
from human bone marrowrdquo Cytometry B vol 70 no 6 pp 391ndash399 2006
[15] N Quirici C Scavullo L De Girolamo et al ldquoAnti-L-NGFRand -CD34 monoclonal antibodies identify multipotent mes-enchymal stem cells in human adipose tissuerdquo Stem Cells andDevelopment vol 19 no 6 pp 915ndash925 2010
[16] E Jones and D McGonagle ldquoHuman bone marrow mesenchy-mal stem cells in vivordquo Rheumatology vol 47 no 2 pp 126ndash1312008
[17] Z Kuci S Kuci S Zircher et al ldquoMesenchymal stromal cellsderived from CD271+ bone marrow mononuclear cells exertpotent allosuppressive propertiesrdquo Cytotherapy vol 13 no 10pp 1193ndash1204 2011
[18] N Yamamoto H Akamatsu S Hasegawa et al ldquoIsolation ofmultipotent stem cells from mouse adipose tissuerdquo Journal ofDermatological Science vol 48 no 1 pp 43ndash52 2007
[19] P A Zuk M Zhu H Mizuno et al ldquoMultilineage cells fromhuman adipose tissue implications for cell-based therapiesrdquoTissue Engineering vol 7 no 2 pp 211ndash228 2001
[20] M P Francis P C Sachs LW Elmore and S E Holt ldquoIsolatingadipose-derived mesenchymal stem cells from lipoaspirateblood and saline fractionrdquo Organogenesis vol 6 no 1 pp 11ndash14 2010
[21] The R Project for Statistical Computing httpwwwr-projectorg
[22] B M Strem K C Hicok M Zhu et al ldquoMultipotential differ-entiation of adipose tissue-derived stem cellsrdquo Keio Journal ofMedicine vol 54 no 3 pp 132ndash141 2005
[23] A V Padoin J Braga-Silva P Martins et al ldquoSources ofprocessed lipoaspirate cells influence of donor site on cellconcentrationrdquo Plastic and Reconstructive Surgery vol 122 no2 pp 614ndash618 2008
[24] M Dominici K Le Blanc I Mueller et al ldquoMinimal crite-ria for defining multipotent mesenchymal stromal cells TheInternational Society for Cellular Therapy position statementrdquoCytotherapy vol 8 no 4 pp 315ndash317 2006
[25] I Chambers D Colby M Robertson et al ldquoFunctional expres-sion cloning of Nanog a pluripotency sustaining factor inembryonic stem cellsrdquo Cell vol 113 no 5 pp 643ndash655 2003
[26] A Gagliardi N P Mullin Z Ying Tan et al ldquoA direct physicalinteraction between Nanog and Sox2 regulates embryonic stemcell self-renewalrdquo The EMBO Journal vol 32 no 16 pp 2231ndash2247 2013
[27] SMasui Y Nakatake Y Toyooka et al ldquoPluripotency governedby Sox2 via regulation of Oct34 expression in mouse embry-onic stem cellsrdquo Nature Cell Biology vol 9 no 6 pp 625ndash6352007
[28] V Karwacki-Neisius J Goke R Osorno et al ldquoReducedOct4 expression directs a robust pluripotent state with distinctsignaling activity and increased enhancer occupancy by Oct4and Nanogrdquo Cell Stem Cell vol 12 no 5 pp 531ndash545 2013
[29] S J Bray ldquoNotch signalling a simple pathway becomes com-plexrdquo Nature Reviews Molecular Cell Biology vol 7 no 9 pp678ndash689 2006
[30] M Y Son H Choi Y M Han et al ldquoUnveiling the criticalrole of REX1 in the regulation of human stem cell pluripotencyrdquoStem Cells 2013
[31] J Liu C Sato M Cerletti and A Wagers ldquoNotch signalingin the regulation of stem cell self-renewal and differentiationrdquoCurrent Topics in Developmental Biology vol 92 pp 367ndash4092010
Stem Cells International 9
[32] K Michalczyk and M Ziman ldquoNestin structure and predictedfunction in cellular cytoskeletal organisationrdquo Histology andHistopathology vol 20 no 2 pp 665ndash671 2005
[33] T Yamada H Akamatsu S Hasegawa et al ldquoAge-relatedchanges of p75Neurotrophin receptor-positive adipose-derivedstem cellsrdquo Journal of Dermatological Science vol 58 no 1 pp36ndash42 2010
[34] A Stolzing E Jones D McGonagle and A Scutt ldquoAge-relatedchanges in human bone marrow-derived mesenchymal stemcells consequences for cell therapiesrdquoMechanisms ofAgeing andDevelopment vol 129 no 3 pp 163ndash173 2008
[35] G Cox S A Boxall P V Giannoudis et al ldquoHigh abundance ofCD271+ multipotential stromal cells (MSCs) in intramedullarycavities of long bonesrdquo Bone vol 50 no 2 pp 510ndash517 2012
[36] M Alvarez-Viejo Y Menendez-Menendez M A Blanco-Gelazet al ldquoQuantifyingmesenchymal stem cells in themononuclearcell fraction of bone marrow samples obtained for cell therapyrdquoTransplantation Proceedings vol 45 no 1 pp 434ndash439 2013
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
8 Stem Cells International
Acknowledgments
The authors wish to acknowledge Dr Victor TrevinoAlvarado for his valuable observations and assistance withdata analysis They are also indebted to the InstitutoTecnologico de Estudios Superiores de Monterrey theZambrano-Hellion Foundation and CONACYT for thePhD student grant
References
[1] D A De Ugarte K Morizono A Elbarbary et al ldquoComparisonof multi-lineage cells from human adipose tissue and bonemarrowrdquo Cells Tissues Organs vol 174 no 3 pp 101ndash109 2003
[2] S Kern H Eichler J Stoeve H Kluter and K BiebackldquoComparative analysis of mesenchymal stem cells from bonemarrow umbilical cord blood or adipose tissuerdquo StemCells vol24 no 5 pp 1294ndash1301 2006
[3] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[4] H J Jin Y K Bae M Kim et al ldquoComparative analysis ofhuman mesenchymal stem cells from bone marrow adiposetissue and umbilical cord blood as sources of cell therapyrdquoInternational Journal of Molecular Sciences vol 14 no 9 pp17986ndash18001 2013
[5] Y Zhu T Liu K Song X Fan X Ma and Z Cui ldquoAdipose-derived stem cell a better stem cell than BMSCrdquo Cell Biochem-istry and Function vol 26 no 6 pp 664ndash675 2008
[6] P A Zuk ldquoThe adipose-derived stem cell looking back andlooking aheadrdquoMolecular Biology of the Cell vol 21 no 11 pp1783ndash1787 2010
[7] M Locke J Windsor and P R Dunbar ldquoHuman adipose-derived stem cells isolation characterization and applicationsin surgeryrdquo ANZ Journal of Surgery vol 79 no 4 pp 235ndash2442009
[8] H Mizuno ldquoAdipose-derived stem cells for tissue repair andregeneration ten years of research and a literature reviewrdquoJournal of NipponMedical School vol 76 no 2 pp 56ndash66 2009
[9] H Mizuno M Tobita and A C Uysal ldquoConcise reviewadipose-derived stem cells as a novel tool for future regenerativemedicinerdquo Stem Cells vol 30 no 5 pp 804ndash810 2012
[10] A Schaffler and C Buchler ldquoConcise review adipose tissue-derived stromal cellsmdashbasic and clinical implications for novelcell-based therapiesrdquo StemCells vol 25 no 4 pp 818ndash827 2007
[11] B Puissant C Barreau P Bourin et al ldquoImmunomodulatoryeffect of human adipose tissue-derived adult stem cells compar-isonwith bonemarrowmesenchymal stem cellsrdquoBritish Journalof Haematology vol 129 no 1 pp 118ndash129 2005
[12] P C Baer ldquoAdipose-derived stem cells and their potentialto differentiate into the epithelial lineagerdquo Stem Cells andDevelopment vol 20 no 10 pp 1805ndash1816 2011
[13] NQuirici D Soligo P Bossolasco F Servida C Lumini andGL Deliliers ldquoIsolation of bone marrow mesenchymal stem cellsby anti-nerve growth factor receptor antibodiesrdquo ExperimentalHematology vol 30 no 7 pp 783ndash791 2002
[14] E A Jones A English S E Kinsey et al ldquoOptimization of aflow cytometry-based protocol for detection and phenotypiccharacterization of multipotent mesenchymal stromal cells
from human bone marrowrdquo Cytometry B vol 70 no 6 pp 391ndash399 2006
[15] N Quirici C Scavullo L De Girolamo et al ldquoAnti-L-NGFRand -CD34 monoclonal antibodies identify multipotent mes-enchymal stem cells in human adipose tissuerdquo Stem Cells andDevelopment vol 19 no 6 pp 915ndash925 2010
[16] E Jones and D McGonagle ldquoHuman bone marrow mesenchy-mal stem cells in vivordquo Rheumatology vol 47 no 2 pp 126ndash1312008
[17] Z Kuci S Kuci S Zircher et al ldquoMesenchymal stromal cellsderived from CD271+ bone marrow mononuclear cells exertpotent allosuppressive propertiesrdquo Cytotherapy vol 13 no 10pp 1193ndash1204 2011
[18] N Yamamoto H Akamatsu S Hasegawa et al ldquoIsolation ofmultipotent stem cells from mouse adipose tissuerdquo Journal ofDermatological Science vol 48 no 1 pp 43ndash52 2007
[19] P A Zuk M Zhu H Mizuno et al ldquoMultilineage cells fromhuman adipose tissue implications for cell-based therapiesrdquoTissue Engineering vol 7 no 2 pp 211ndash228 2001
[20] M P Francis P C Sachs LW Elmore and S E Holt ldquoIsolatingadipose-derived mesenchymal stem cells from lipoaspirateblood and saline fractionrdquo Organogenesis vol 6 no 1 pp 11ndash14 2010
[21] The R Project for Statistical Computing httpwwwr-projectorg
[22] B M Strem K C Hicok M Zhu et al ldquoMultipotential differ-entiation of adipose tissue-derived stem cellsrdquo Keio Journal ofMedicine vol 54 no 3 pp 132ndash141 2005
[23] A V Padoin J Braga-Silva P Martins et al ldquoSources ofprocessed lipoaspirate cells influence of donor site on cellconcentrationrdquo Plastic and Reconstructive Surgery vol 122 no2 pp 614ndash618 2008
[24] M Dominici K Le Blanc I Mueller et al ldquoMinimal crite-ria for defining multipotent mesenchymal stromal cells TheInternational Society for Cellular Therapy position statementrdquoCytotherapy vol 8 no 4 pp 315ndash317 2006
[25] I Chambers D Colby M Robertson et al ldquoFunctional expres-sion cloning of Nanog a pluripotency sustaining factor inembryonic stem cellsrdquo Cell vol 113 no 5 pp 643ndash655 2003
[26] A Gagliardi N P Mullin Z Ying Tan et al ldquoA direct physicalinteraction between Nanog and Sox2 regulates embryonic stemcell self-renewalrdquo The EMBO Journal vol 32 no 16 pp 2231ndash2247 2013
[27] SMasui Y Nakatake Y Toyooka et al ldquoPluripotency governedby Sox2 via regulation of Oct34 expression in mouse embry-onic stem cellsrdquo Nature Cell Biology vol 9 no 6 pp 625ndash6352007
[28] V Karwacki-Neisius J Goke R Osorno et al ldquoReducedOct4 expression directs a robust pluripotent state with distinctsignaling activity and increased enhancer occupancy by Oct4and Nanogrdquo Cell Stem Cell vol 12 no 5 pp 531ndash545 2013
[29] S J Bray ldquoNotch signalling a simple pathway becomes com-plexrdquo Nature Reviews Molecular Cell Biology vol 7 no 9 pp678ndash689 2006
[30] M Y Son H Choi Y M Han et al ldquoUnveiling the criticalrole of REX1 in the regulation of human stem cell pluripotencyrdquoStem Cells 2013
[31] J Liu C Sato M Cerletti and A Wagers ldquoNotch signalingin the regulation of stem cell self-renewal and differentiationrdquoCurrent Topics in Developmental Biology vol 92 pp 367ndash4092010
Stem Cells International 9
[32] K Michalczyk and M Ziman ldquoNestin structure and predictedfunction in cellular cytoskeletal organisationrdquo Histology andHistopathology vol 20 no 2 pp 665ndash671 2005
[33] T Yamada H Akamatsu S Hasegawa et al ldquoAge-relatedchanges of p75Neurotrophin receptor-positive adipose-derivedstem cellsrdquo Journal of Dermatological Science vol 58 no 1 pp36ndash42 2010
[34] A Stolzing E Jones D McGonagle and A Scutt ldquoAge-relatedchanges in human bone marrow-derived mesenchymal stemcells consequences for cell therapiesrdquoMechanisms ofAgeing andDevelopment vol 129 no 3 pp 163ndash173 2008
[35] G Cox S A Boxall P V Giannoudis et al ldquoHigh abundance ofCD271+ multipotential stromal cells (MSCs) in intramedullarycavities of long bonesrdquo Bone vol 50 no 2 pp 510ndash517 2012
[36] M Alvarez-Viejo Y Menendez-Menendez M A Blanco-Gelazet al ldquoQuantifyingmesenchymal stem cells in themononuclearcell fraction of bone marrow samples obtained for cell therapyrdquoTransplantation Proceedings vol 45 no 1 pp 434ndash439 2013
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
Stem Cells International 9
[32] K Michalczyk and M Ziman ldquoNestin structure and predictedfunction in cellular cytoskeletal organisationrdquo Histology andHistopathology vol 20 no 2 pp 665ndash671 2005
[33] T Yamada H Akamatsu S Hasegawa et al ldquoAge-relatedchanges of p75Neurotrophin receptor-positive adipose-derivedstem cellsrdquo Journal of Dermatological Science vol 58 no 1 pp36ndash42 2010
[34] A Stolzing E Jones D McGonagle and A Scutt ldquoAge-relatedchanges in human bone marrow-derived mesenchymal stemcells consequences for cell therapiesrdquoMechanisms ofAgeing andDevelopment vol 129 no 3 pp 163ndash173 2008
[35] G Cox S A Boxall P V Giannoudis et al ldquoHigh abundance ofCD271+ multipotential stromal cells (MSCs) in intramedullarycavities of long bonesrdquo Bone vol 50 no 2 pp 510ndash517 2012
[36] M Alvarez-Viejo Y Menendez-Menendez M A Blanco-Gelazet al ldquoQuantifyingmesenchymal stem cells in themononuclearcell fraction of bone marrow samples obtained for cell therapyrdquoTransplantation Proceedings vol 45 no 1 pp 434ndash439 2013
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology
Submit your manuscripts athttpwwwhindawicom
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Anatomy Research International
PeptidesInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporation httpwwwhindawicom
International Journal of
Volume 2014
Zoology
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Molecular Biology International
GenomicsInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioinformaticsAdvances in
Marine BiologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Signal TransductionJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
Evolutionary BiologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Biochemistry Research International
ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Genetics Research International
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Advances in
Virolog y
Hindawi Publishing Corporationhttpwwwhindawicom
Nucleic AcidsJournal of
Volume 2014
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Enzyme Research
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
International Journal of
Microbiology