AFRICA SOCIETY FOR BLOOD TRANSFUSION · AFRICA SOCIETY FOR BLOOD TRANSFUSION NPC Registation number: 2011/008414/08 Private Bag X9043, Pinetown, 3600, ... Ansah Justina, Bates Imelda

AFRICA SOCIETY FOR BLOOD TRANSFUSION NPCRegistation number: 2011/008414/08 www.afsbt.org

Private Bag X9043, Pinetown, 3600,South AfricaEmail: [email protected]

September 2014Volume 17, no. 1

1 ISSN 1560-8646

CONTENTSSeptember 2014

EDITOR’S NOTEAdewuyi B ........................................................................ 1

SCIENTIFIC ARTICLESINFLUENCE OF PLASMODIUM FALCIPARUM MALARIA ONSICKLE CELL VASO-OCCLUSIVE CRISIS IN YAOUNDÉ,CAMEROON....................................................................... 3Mbanya DNS, Tayou Tagny C, Lyli O and Kaptué LN

COLD ANTIBODIES:AN UNCOMMON FACTOR IN TRANSFUSION SAFETY IN ATROPICAL COUNTRY, A REPORT OF TWO CASES.................. 6Mamman A, Suleiman AM, Ijei IP

PROJECT REPORTCOMPARISON OF BLOOD SERVICES AND CLINICALTRANSFUSION PRACTICES IN ZIMBABWE AND THENETHERLANDS: What are the key lessons?......................... 9Mapako T et al

Reprinted with permission fromTRANSFUSION, VOL 53, DECEMBER 2013INACTIVATION OF PLASMODIUM FALCIPARUM IN WHOLEBLOOD BY RIBOFLAVIN PLUS IRRADIATION ....................... 14Mira El et al

SA BLOOD TRANSFUSION CONGRESSCape Town 2013• ABSTRACTS FROM THE CONGRESS ..................... 22

GENERAL INFORMATION• Global Blood Fund...................................................... 30• AABB information....................................................... 31• Contribution guidelines – instructions to authors ....... 32• Application/renewal/updating forms

for Membership.......................................................... 35

TrueBluewww.helmerinc.com · [email protected]

Tranfusion Storage Solutions

Blood Bank & Laboratory EquipmentRefrigerators · FreezersPlatelet Storage · Plasma Thawing · Cell Washing

Now featuring the i.C³™ User Interface on i.Series™ Refrigerators and Freezers

1

September 2014, Volume 17, no. 1Africa Sanguine

B Adewuyi

In the scientific arena, advancement of knowledge usually demands the conduction of research, the findings of which are the basis for policy formulation and practice.

While research carried out in a particular setting may be universally applicable, in other settings, policy and practice have to be determined by evidence from research findings in the particular setting. One of the articles in the Mission statement of the AfSBT is to contribute to the advancement of the knowledge of blood transfusion on the African continent.1 For too long, many aspects of the practice of blood transfusion in Africa have been based on paradigms developed from research findings in the developed world. To achieve the AfSBT objective, our members need to work harder at research in the continent. Admittedly there are problems militating against meaningful scientific research beyond the gathering and crude analysis of scanty local clinical data. For one, research awareness and capacity are low within our national blood transfusion services. Another major problem is the lack of sophisticated equipment and funds for reagents.

However, there are ways to go round some of these problems. Research awareness is an attitudinal characteristic which our members must develop. Our younger members must also seek further training not only for bench proficiency to improve service performance, but also in the formal academic disciplines such as in postgraduate diploma, masters and doctorate studies, to improve research capacity. Unfortunately such courses are being offered in only one or two centres in Africa,2 while there are more centres abroad. Our senior members who are in the academia should please advocate for the introduction of such academic programmes in their universities. Another avenue that is open to us is in collaborative research, which may be in two forms.

Each Region of AfSBT should set up a regional network of participating researchers and institutions, in the Region, through which research will be harmonized and focused. An example of such network which has yielded good dividends in research output is the network of French researchers in the RAFTS Region of AfSBT.3 The other useful form of collaboration is between an institution in Africa and one in the developed world. Such collaboration may provide access to the sophisticated analytical systems, and also the help from highly experienced expert researchers available in the advanced institutions, in Europe and America. An example of such arrangement is the one between the transfusion medicine unit in the Komfo Anokye Teaching Hospital Kumasi Ghana, and the national blood service of Zimbabwe on the one hand, and the Liverpool School of Tropical medicine on the other hand under the T-REC programme.4,5 Finally, good research costs money.

EDITOR’s NOTEStatus of Blood Transfusion Research in Africa

Etat de la Recherche en Transfusion Sanguine en Afrique

Dans le domaine scientifique, les avancées dans la connaissance exigent généralement la conduite des activités de recherche, dont les résultats fondent la formulation de la politique et la pratique scientifique.

Bien que la recherche effectuée dans un contexte particulier puisse être universellement applicable, dans d’autres contextes, la politique et la pratique doivent être déterminés par des preuves issues de la recherche dans le contexte particulier. L’un des articles rapporté dans la déclaration des missions de la SATS est stipule la contribution à l’avancement de la connaissance de la transfusion sanguine sur le continent africain.1 Pendant trop longtemps, de nombreux aspects de la pratique de la transfusion sanguine en Afrique ont été basés sur des paradigmes développés à partir des résultats de la recherche dans le monde développé. Pour atteindre l’objectif de la SATS, nos membres doivent travailler davantage à la recherche scientifique sur le continent. Certes il y a des problèmes qui militent contre la recherche scientifique significative au-delà de la collecte et de l’analyse brute des maigres données cliniques locales. D’une part, la sensibilisation à la recherche et les capacités sont faibles au sein de nos services nationaux de transfusion sanguine. Un autre problème majeur est le manque d’équipements sophistiqués et des fonds pour les réactifs.

Cependant, il y a des façons de faire le tour de certains de ces problèmes. La prise de conscience de la nécessite de la recherche est une attitude que nos membres doivent développer. Nos jeunes membres doivent également chercher une formation non seulement pour acquérir de la compétence dans le but d’améliorer la performance du service, mais aussi dans les disciplines académiques formelles (diplôme d’études supérieures, maîtrise, études de doctorat) pour améliorer leur capacité de recherche. Malheureusement, ces cours sont offerts que dans un ou deux centres en Afrique, 2 alors qu’il y en a plus à l’étranger. Nos membres, cadres supérieurs, qui sont dans le milieu universitaire devraient se plaire à plaider pour la mise en place de ces programmes d’études dans leurs universités. Une autre opportunité qui s’offre à nous est la recherche collaborative, qui peut prendre deux formes :

Chaque région de la SATS devrait mettre en place un réseau régional de chercheurs et d’institutions à travers lequel la recherche sera harmonisée et ciblée. Un exemple d’un tel réseau, qui a donné de bons résultats est le réseau de chercheurs français dans la région de RAFTS AfSBT.3 L’autre forme utile de la collaboration est celle qui doit exister entre une institution en Afrique et une autre dans le monde développé. Une telle collaboration peut donner accès à des systèmes d’analyse sophistiqués, et aussi à la collaboration avec des chercheurs experts très expérimentés disponibles dans les établissements de pointe, en Europe et en Amérique.

2


In Africa, where blood services hardly ever vote funds for research, grants from donor agencies, particularly from abroad, are the main sources of funds. We urge our donor partners to please continue to give generous grants to our budding researchers. The research and ethics committee of AfSBT may wish to set up a mechanism to source for research funds and serve as the body through which such funds may be channelled and managed.

Un exemple d’un tel arrangement est celui entre l’unité de médecine transfusionnelle à l’Hôpital Komfo Anokye de Kumasi au Ghana, et le service national de transfusion sanguine du Zimbabwe d’une part, et la Liverpool School of Tropical Medicine de l’autre sous le programme T-REC.4,5 Enfin, une bonne recherche coûte de l’argent. En Afrique, où les services de sang n’allouent presque jamais des fonds à la recherche, les subventions des bailleurs de fonds, en particulier à l’étranger, sont les principales sources de financement. Nous exhortons nos partenaires donateurs à vouloir continuer à accorder des subventions généreuses à nos chercheurs en herbe. Le comité de recherche et d’éthique de la SATS peut souhaiter mettre en place un mécanisme pour collecter des fonds de recherche et de servir d’organe à travers lequel ces fonds peuvent être canalisées et gérées.

References1. AfSBT Memorandum of Incorporation (MOI) 2011 Section 5b. 2. Louw Vernon. Masters degree in transfusion medicine at the University of the Free State RSA Afr.Sang 2012; 15 – 1: 36.3. Tagny CT. The Francophone Africa blood transfusion research network; a five-year report Abstract 7th AfSBT Congress, Zimbabwe 2014.4. Dunn A, Armstrong D, Mvere D, Ansah Justina, Bates Imelda. T-REC: Strengthening capacity for blood transfusion research in Ghana and

Zimbabwe. Afr. Sang 2013; 16- 2 : 14 – 18.5. Bates Imelda. Strengthening transfusion research capacity in Africa. Lunchtime Symposium; 7th AfSBT Congress Zimbabwe 2014.

3


INFLUENCE OF PLASMODIUM FALCIPARUM MALARIA ON SICKLE CELL VASO-OCCLUSIVE CRISIS in Yaoundé, Cameroon

INFLUENCE DE PLASMODIUM FALCIPARUM PALUDISME FALCIFORME VASO-OCCLUSIVES crise en Yaoundé , Cameroun

Mbanya DNS, Tayou Tagny C, Lyli O and Kaptué LNFaculty of Medicine and Biomedical Science, University of Yaoundé I, Cameroon; Institut Supérieur des Sciences de la Santé, Université des Montagnes

CoRRESpondEnCEDr Claude Tayou TagnyPO BOX 5739 Yaoundé CameroonEmail: [email protected]

KEYwoRdSPlasmodium Falciparum, Malaria, Sickle Cell Disease

RESUMEConTExTE Infections de la drépanocytose et le paludisme sont fréquentes au Cameroun. Le paludisme est pensé pour influencer la fréquence et la gravité de la crise chez les patients drépanocytaires.

objECTif Pour étudier la relation entre l’infection du paludisme et de la crise vaso-occlusive chez les patients drépanocytaires.

MéThodES Afin d’étudier la sévérité clinique de douloureuse crise vaso-occlusive chez les patients de drépanocytose souffrant de paludisme, 60 SS patients homozygotes âgés de 2 à 35 ans (âge médian = 15 ans) à la crise douloureuse et 40 SS patients drépanocytaires homozygotes dans “état stable” âgés de 1 à 38 ans (médiane = 17 ans) ont été recrutés dans l’étude. La gravité clinique de la crise a été évalué à 0,1 et 2 sur la base d’une échelle arbitraire pour augmenter la douleur. Pour chaque participant frottis sanguins minces et épaisses sont fabriqués à partir de sang capillaire, colorées selon des méthodes standard et examinés pour les parasites du paludisme. Carrés et étudiant tests t Chi ont été utilisés pour l’analyse statistique.

AbSTRACTbACKgRoUndSickle cell disease and malaria infections are common in Cameroon. Malaria infection is thought to influence the occurrence and severity of crisis in sickle cell patients.

objECTivETo investigate the relationship between malaria infection and vaso-occlusive crisis in sickle cell disease patients.

METhodSIn order to investigate the clinical severity of painful vaso-occlusive crisis in sickle cell anaemia patients suffering from malaria infection, 60 SS Homozygous patients aged 2 – 35 years (median = 15 years) with painful crisis and 40 SS Homozygous sickle cell patients in ‘steady state’ aged 1 – 38 years (median = 17 years) were recruited into the study. The clinical severity of the crisis was graded as 0.1 and 2 based on an arbitrary scale for increasing pain. For each participant thin and thick blood films were made from capillary blood, stained according to standard methods and examined for malaria parasites. Chi square and student t tests were used for statistical analysis.

SCIENTIFIC ARTICLES

4


RéSUlTATS Sur les 60 patients en situation de crise, la douleur dans 46,7% a été classé comme une année, dans 46,7% de grade 2 et de 6,6% en année 0 Il y avait 66,6% d’entre eux avec des films épaisses positives pour les parasites du paludisme par rapport à 35,0% de la patients en “état stable” (p = 0,003). Tous les parasites ont été présentés sur le film mince pour être à Plasmodium falciparum. Plus de 50% des patients en crise films épaisses positives étaient de grade 2 de la classification clinique.

ConClUSion Ces résultats montrent que le paludisme à falciparum reste une cause majeure de morbidité et contribue de manière significative à la survenue et la gravité de la crise douloureuse vaso-occlusive chez les patients drépanocytaires.

RESUlTS Of the 60 patients in crisis, pain in 46.7% was classified as Grade 1, in 46.7% as Grade 2 and in 6.6% as Grade 0. There were 66.6% of them with positive thick films for malaria parasites compared to 35.0% of the patients in ‘steady state’ (p=0.003). All parasites were shown on thin film to be Plasmodium falciparum. More than 50% of the patients in crisis with positive thick films were in Grade 2 of the clinical grading.

ConClUSionThese findings show that falciparum malaria remains a major cause of morbidity and contributes significantly to the occurrence and severity of painful vaso-occlusive crisis in sickle cell disease patients.

inTRodUCTionSickle cell anaemia is a chronic non-communicable genetic disorder which results from the genetic mutation of the sixth amino acid of the beta chain of normal adult haemoglobin, from glutamic acid to valine. The resultant sickle haemoglobin (Haemoglobin S) tends to precipitate in the presence of low oxygen tension causing red cells to adopt the peculiar sickled form. This is responsible for the physiopathology of sickle cell anaemia within capillaries, and in the reticulo-endothelial system, evidenced by painful vaso-occlusive crisis, haemolysis and chronic anaemia. Several factors enhance this process including hypoxia, dehydration, hypothermia and infections. Although infections like malaria are said to be less frequent in sickle cell anaemia1,2,3 this infection has been frequently diagnosed in sickle cell sufferers (personal observations) and is believed to initiate and worsen sickle cell crisis. To investigate the relationship between sickle cell crisis and malaria infection, a group of homozygous sickle cell anaemia patients in painful crisis were screened for malaria parasites. For comparison, another group of homozygous sickle cell anaemia patients in ‘steady state’ were included as controls.

METhodSThis was a hospital-based cross-sectional study into which consenting homozygous sickle cell anaemic patients attending the Sickle Cell Centre in Yaoundé were recruited. For each patient a medical interview and a physical examination provided relevant information (age, sex, etc ). For those in painful crisis, the intensity of the pain was graded into:• Grade 0 = Mild pain, with normal mobility• Grade 1 = Moderate pain and much difficulty with mobility • Grade 2 = Severe pain with immobility A drop of capillary blood was obtained from a finger prick unto a microscope slide for a thin blood film. A second drop was obtained for a thick film. Thin films were air-dried and fixed for 1 minute in absolute methanol before colouring with May-Grunwald (3 minutes) and then Giemsa stains (15 minutes) after leaving for 1 minute in PBS. Thick films were dried for at least 2 hours and directly stained with 10% Giemsa in Phosphate-Buffered-saline for 10 minutes. Microscopic examination was carried out using the x100 objective of a light microscope. At least 100 fields were screened before a slide was considered negative. The parasite density was determined by counting the parasites in 100 fields and multiplying by 4 to obtain the number of parasites/µl.4 Each slide was examined by two different technicians and the mean of their parasite counts recorded.

The mean parasite density (MPD) for each slide was calculated, based on a modification of the following WHO formula.4

MPD (parasite/µL) = L x MP 100Where L = number of leucocytes (estimated at 6000/µL) MP = mean parasites/100 leucocytes

Chi square and student t tests were used for statistical analyses. P values <0.05 were considered significant.

RESUlTSThere were 60 homozygous sickle cell sufferers in painful crisis and 40 in ‘steady state’. The patients in painful crisis were aged 2 - 35 years (median = 15 years) while those in ‘steady state’ were aged 1 - 38 years (median = 17 years).Based on the intensity of pain, there were 4 of the 60 patients (6.6%) classified as Grade 0, 28 (46.7%) in Grade 1 and 28 (46.7%) in Grade 2. All the 40 patients in ‘steady state’ had no pain at all. There was a significant difference in the number of positive thick films for malaria parasites in the group of patients in painful crisis (66.6%) compared to those in ‘steady state’ (35%) ; p = 0.003. All parasites were confirmed on thin film to be Plasmodium falciparum.The median MPD was 40/ul (range 20 – 1440 parasites/ul) in the patient group in crisis compared to 20/ul (range 20 - 660 parasites/ul) in the ‘steady state’ group; with a P value= 0.13 as shown in Table 1.

Table 1: Comparison between Patients in crisis and patients in ‘steady state’

Group of patients

Age (years) Frequency of positive thick film

Mean Parasite density(/ul)

Median [range]

N(%) P value Median [range]

P value

Patients in crisis state n=60

15[2-35] 40 (66.6) 0.003 40[20-1440] 0.13

Patients in steady state n=40

17[1-38] 14(35.0) 20[20-660]

5


diSCUSSionMalaria parasites are preferentially transmitted to man by the female anopheles mosquito. Because of ecological conditions and socio-economic factors, West and Central Africa are most affected.5 There are five species of malaria parasites that transmit malaria to man (Plasmodium falciparum; Plasmodium malariae; Plasmodium ovale; Plasmodium vivax and Plasmodium knowlesi). Plasmodium falciparum is most frequent in the tropical regions and is responsible for more than 80% of malaria infection in Cameroon.6,7 Malaria caused by Plasmodium falciparum is the most severe, with potentially fatal complications.8,9 Sickle cell disease was shown in this study to contribute significantly to the occurrence and severity of painful vaso-occlusive crisis. Malaria is described as the initiating factor for vaso-occlusive crisis in many sickle cell sufferers.10 In their study Kotila & al11 diagnosed malaria in 34% of sickle cell sufferers with fever or pains. However, fever may result from other factors including bacterial infections, which are also frequent in sickle cell patients. Our study was conducted from September 2011 to August 2012 in the same site. This period covers the two major seasons (dry, raining) in Cameroon. Thus, prevalence of malaria, and average frequency of sickle cell crisis reported in this study took into account the customary climatic changes.Microscopy was the method employed to detect malaria parasitaemia in this study. Although there are other methods such as rapid diagnostic tests, (RTD) based on antigen detection and molecular studies, microscopy gives other important information such as species, and stages of parasite development and density. Microscopy is labour-intensive, time-consuming, and somewhat subjective, but in skilled hands, it can be quite sensitive for parasitaemia of ≤50/µL (0.001%) Microscopy remains the most widely used tool to detect malaria parasitaemia in Africa, both at the primary and secondary health levels. The findings in this study suggest that malaria was a precipitating factor to bone pain in sickle cell sufferers. The clinical manifestations of malaria range from fever through rigors, to more severe systemic manifestations. The occurrence and greater severity of pain in the study group compared to the control group may be explained by the vaso-occlusion induced by the malaria infection. Based on the intensity of pain as graded in the present study, the majority were in Grade 1 and 2 (93.4%) while no sufferer in the ‘steady state’ (control group) had pain. While parasitaemia remains an objective criterion for defining malaria severity, Binka & al12 defined dense parasitaemia as MPD ≥ 4000 parasites/µl. In this study, the median MPD was 40 (20 - 1440) parasites/µl in the test group, and 20 (20 - 660) parasites/µl in the control group. These findings would therefore not meet the criteria set by Binka & al.12 However, some patients tolerate high parasite densities clinically while others succumb even to low densities. This apparent discrepancy between symptoms and degree of parasitaemia may be explained by the differences in stages of development of parasite as suggested by Achidi & al.11 The severity of symptoms would be more associated with the number of parasites sequestrated rather than with the numbers in circulation. It is therefore not surprising that patients in our study group with relatively low parasitaemia presented with clinically severe crisis.

ConClUSionIt may be concluded from the findings of this study that malaria contributes significantly, not only in initiating sickle cell vaso-occlusive crisis, but in aggravating it. Therefore malaria prevention measures are essential in the care of sickle cell patients particularly in malaria endemic regions.

ACKnowlEdgMEnTSWe thank the Yaoundé University Teaching Hospital for the different lab analysis.

REfEREnCES1. Williams TN, Mwangi TW, Wambua S, Alexander ND, Kortok M,

Snow RW, Marsh K. Sickle cell trait and the risk of Plasmodium falciparum malaria and other childhood diseases. J Infect Dis. 2005;192(1):178-86.

2. De Paz FJ, Romero A, Diez D, Botella C, Torrus D, Moscardó C. Malaria and sickle cell disease. Haematologica. 2006;91(12 Suppl):EIM03.

3. Crompton PD, Traore B, Kayentao K, Doumbo S, Ongoiba A, Diakite SA, Krause MA, Doumtabe D, Kone Y, Weiss G, Huang CY, Doumbia S, Guindo A, Fairhurst RM, Miller LH, Pierce SK, Doumbo OK. Sickle Cell Trait Is Associated with a Delayed Onset of Malaria: Implications for Time-to-Event Analysis in Clinical Studies of Malaria. J Infect Dis. 2008;198(9):1265-1275.

4. Payne D. Use and limitations of light microscopy for diagnosing malaria at primary health care level Bull World Health Organ. 1988;66(5):621-6.

5. Lewison G, Srivastava D. Malaria research, 1980-2004, and the burden of disease. Acta Trop. 2008 ;106(2):96-103.

6. Quakyi IA, Leke RG, Befidi-Mengue R, Tsafack M, Bomba-Nkolo D, Manga L, Tchinda V, Njeungue E, Kouontchou S, Fogako J, Nyonglema P, Harun LT, Djokam R, Sama G, Eno A, Megnekou R, Metenou S, Ndountse L, Same-Ekobo A, Alake G, Meli J, Ngu J, Tietche F, Lohoue J, Mvondo JL, Wansi E, Leke R, Folefack A, Bigoga J, Bomba-Nkolo C, Titanji V, Walker-Abbey A, Hickey MA, Johnson AH, Taylor DW. The epidemiology of Plasmodium falciparum malaria in two Cameroonian villages: Simbok and Etoa. Am J Trop Med Hyg. 2000;63(5-6):222-30

7. Zhou A, Megnekou R, Leke R, Fogako J, Metenou S, Trock B, Taylor DW, Leke RF.Prevalence of Plasmodium falciparum infection in pregnant Cameroonian women. Am J Trop Med Hyg. 2002;67(6):566-70

8. Ikome LE, Ndamukong KJ, Kimbi H. Prevalence and case-control study of cerebral malaria in Limbe of the South-West Cameroon. Afr J Health Sci. 2002;9(1-2):61-7

9. Chiabi A, Tchokoteu PF, Toupouri A, Mbeng TB, Wefuan J.The clinical spectrum of severe malaria in children in the east provincial hospital of Bertoua, Cameroon. Bull Soc Pathol Exot. 2004 ;97(4):239-43

10. Kotila TR. Management of acute painful crises in sickle cell disease. Clin Lab Haematol. 2005;27(4):221-3.

11. Achidi EA, Apinjoh TO, Mbunwe E, Besingi R, Yafi C, Wenjighe Awah N, Ajua A, Anchang JK.Febrile status, malarial parasitaemia and gastro-intestinal helminthiases in schoolchildren resident at different altitudes, in south-western Cameroon. Ann Trop Med Parasitol. 2008 Mar;102(2):103-18.

12. Binka FN, Morris SS, Ross DA. Patterns of malaria morbidity in children in northern Ghana. Trans Roys Soc trop Med Hyg 1994; 88: 381 – 385.

6


COLD ANTIBODIES: an uncommon factor in transfusion safety in a tropical country: a report of two cases

ANTICORPS FROID : un facteur rare dans sécurité transfusionnelle dans un pays tropical : un rapport de deux cas

Mamman Aisha, Suleiman AM, Ijei IPAhmadu Bello University Teaching Hospital Zaria, Nigeria.

CoRRESpondEnCEAisha MammanDepartment of HaematologyAhmadu Bello University Teaching HospitalZaria, NigeriaEmail: [email protected]

KEYwoRdSCold antibodies, Tropical Nigeria, Transfusion safety

RESUMEConTExTE L’apparition des anticorps réagissant à froid à un optimum thermique de 0°C est un événement rare, et les manifestations cliniques associées sont rarement observés dans les climats chauds des pays tropicaux d’Afrique sub-saharienne.

objECTif L’objectif de ce travail de recherche est de rapporter deux cas dans lesquels des anticorps froids ont été détectés, et à attirer l’attention sur le défi posé par cet évènement à la pratique de la transfusion sanguine dans un pays tropical en développement.

MéThodE Deux cas ont été identifiés lors de la recherche d’anticorps réagissant à froid au cours des épreuves de compatibilité croisée. L’un était une patiente enceinte de 30 ans souffrant d’anémie falciforme, qui a été suivie pendant 9 ans. L’autre était un patient âgé de 76 ans souffrant d’un cancer du côlon, qui a été géré avec succès et suivi pendant 3 ans.

RéSUlTATS La patiente souffrant d’anémie falciforme a été transfusée avec succès avec du sang réchauffé, mais a présenté neuf ans plus tard une acrocyanose et des ulcères des mains et des pieds. Le patient souffrant de cancer du côlon a également été transfusé avec succès, et a reçu une chimiothérapie après la chirurgie. La rémission de la tumeur maligne a été obtenue et par la suite, les anticorps froids ont disparu sur une période de trois ans de suivi.

AbSTRACTbACKgRoUndCold reacting antibodies with a thermal optimum at 0°C are an uncommon occurrence, and the clinical manifestations are rarely observed in the warm climate of the tropical countries of sub-Saharan Africa.

objECTivEThe objective of this presentation is to report two cases in which cold-reacting antibodies were detected, and to draw attention to the challenge posed to blood transfusion practice by this occurrence in a tropical developing country.

METhodTwo cases are presented of the detection of cold-reacting antibodies at crossmatch. One was a 30 year old pregnant patient with sickle cell anaemia, who was followed up for nine years. The other was a 76 year old patient with colonic carcinoma, who was successfully managed and followed up for three years.

RESUlTSThe sickle cell anaemia patient was successfully transfused with warmed blood, but represented nine years later with acrocyanosis and ulcers on the hands and feet. The colonic carcinoma patient was also successfully transfused, and received chemotherapy following surgery. Remission of the malignancy was achieved and thereafter, the cold antibodies disappeared over a follow-up period of three years.

7


ConClUSionMeticulous crossmatching by standard techniques, of blood for transfusion, and a high index of suspicion and resourcefulness are required to detect and manage anomalous factors in blood transfusion practice in resource-constrained developing countries.

ConClUSion Un cross-match minutieux du sang destiné à la transfusion à l’aide de techniques standards, un indice de suspicion élevé et de l’ingéniosité sont nécessaires pour détecter et gérer les facteurs anormaux dans la pratique de la transfusion sanguine dans les pays en développement à ressources limitées.

inTRodUCTionCold-reacting antibodies, or cold agglutinins, are mainly IgM antibodies with thermal optimum at 0°C, which, if they bind to erythrocytes at sub-normal temperature in-vivo, can cause red cell haemolysis.1,2 Cold antibodies are usually harmless as they do not react beyond 30°C. The exact cause of cold antibodies is not known, but most of them are thought to be auto-antibodies directed against the I, i H and Pr blood group antigens.3 The auto- antibodies, which are monoclonal, produce a chronic autoimmune haemolytic anaemia, (AIHA), and manifest as a clinical syndrome called chronic haemagglutinin disease (CHAD or CAD). Other cold antibodies are associated with some infections, such as mycoplasma, or with some lympho-proliferative disorders. These latter types of cold antibodies are polyclonal, and usually transient.1 When cold agglutinin activity occurs in parts of the body exposed to cold weather, not only intravascular agglutination and/or lysis, but also vasoconstriction of peripheral blood vessels may occur. The resultant acrocyanosis and pain, particularly in the extremities, constitute what is called the Raynaud’s phenomenon.4 Recurrent Raynaud’s episodes may cause ulceration and digital deformity.4 Cold agglutinin-induced intravascular haemolysis may produce haemoglobinaemia and haemoglobinuria, with potential for renal failure. Detection of most cold agglutinins is best at low temperature as agglutination is lost when the test is incubated at temperatures above 30°C. The presence of a cold antibody is therefore to be suspected when, during a routine crossmatch, agglutination is observed only in the tube incubated at room temperature of 25°C or below, and not in the tubes incubated at 37°C. This observation can sometimes initially constitute a diagnostic puzzle. Agglutination due to cold-reacting antibodies is also lost when the serum is treated with mercaptoethanol (IgM antibodies), or neuraminidase (Pr antibodies).1,5 Individuals with cold antibodies, who require blood transfusion, may be transfused safely with blood above the thermal threshold for agglutination. This usually involves pre-warming banked blood before transfusion, and, or, nursing the patient in a surrounding of forced air surface warming.6

METhodSBlood was requested for two patients and a routine crossmatch was set up for each one. At our centre, routine crossmatch involves the reaction of one volume of patient’s serum with one volume of 2% donor red cell suspension in saline. Crossmatch is done by four techniques, namely, incubation in saline at room temperature (usually 20 - 25°C), incubation in saline at 37°C, incubation in saline with albumin enhancement at 37°C, and the indirect antiglobulin technique with initial incubation for one hour at 37°C.

CASE pRESEnTATion

Case 1 CN a 30 year old health worker, and a known sickle cell anaemia patient, presented in the 31st week of her third pregnancy with sickle cell crisis and severe anaemia. Her routine management had been with anti-malarial prophylaxis, folic acid and analgesics and antibiotics when required. Blood was requested to carry out a partial exchange transfusion, in order to reduce the concentration of circulating haemoglobin-S- containing erythrocytes. At routine crossmatch, with group identical donor red cells, agglutination was observed in the room temperature tube, but not in the tubes incubated at 37°C. The room temperature test was repeated with incubation at blood bank refrigerator temperature of 4°C, and lysis was observed. In the absence of facilities to identify and further characterise the antibody, it was concluded that the patient had cold-reacting antibodies in her blood. The crossmatched units of blood were warmed in a 38°C incubator for 45 minutes, and later transfused uneventfully. The patient’s serum was retested periodically by incubation with group identical red cells, and the cold antibodies were persistently present. Subsequent occasional transfusions were given in the same way. Then nine years after the initial presentation, during a particularly cold harmattan season, when average ambient temperature was about 16°C, the patient was referred to the haematology clinic with maroon coloured, pruritic, macular lesions over the dorsa of both feet and hands, and the extensor surfaces of the arms. The intensive itching and scratching had resulted in ulcers on the hands. Antifungal and anti-scabies treatment had been given at the general clinic without any relief. Tests for LE cells and anti-nuclear antibodies were negative, but the cold antibody test was persistently positive. Management consisted of warm dressings, antibiotics and antihistamines along with her routine sickle cell anaemia therapy. There was marked improvement in the clinical condition.

Case 2AA was a 76 year old community leader on whom a provisional diagnosis of colonic carcinoma had been made, and blood was requested to correct anaemia from rectal haemorrhage, and to prepare for surgery. At routine crossmatch with group-identical donor red cells, lysis was observed in the room temperature tube but not in the tubes incubated at 37°C. Incubation at 4°C also produced lysis. It was concluded that these reactions indicated the presence of a cold-reacting antibody. Blood for transfusion was immersed in warm water (37°C) for 30 minutes, and transfusion proceeded without adverse reaction. Jaundice was not observed, and serial haemoglobin concentration determinations, post-surgery, did not reveal significant fall. Thereafter chemotherapy was commenced, with follow-up tests for the cold antibodies. Upon achievement of clinical remission of the primary malignancy, the cold antibody test gradually became less strongly positive, and disappeared over a 3-year follow-up period.

8


diSCUSSionSickle cell anaemia is the most common haemoglobin disorder in Nigeria, affecting some 2% of the adult population7. The periodic haemolytic crisis and vaso-occlusive events make the sickle cell anaemia patient a potential recipient of repeated red cell transfusions with an annual transfusion demand estimated at 0.5 units per patient per annum in the least complicated cases8. Repeated transfusions, especially from diverse donors, make the patient susceptible to development of allo-antibodies. Kuliya Gwarzo et al, reported an allo-antibody prevalence of 8.8% among multi-transfused patients with sickle cell anaemia9. The antibodies identified by Gwarzo included anti-D, anti-E, anti-Kpa, anti-Js, anti-Wra, anti-Mg, anti-Vw, and anti-Goa in various combinations9.Besides allo-antibody formation, chronic slow-healing ulcers of the lower extremities are common in sickle cell anaemia patients.7 The exact pathogenesis of the ulcers is not clear, but vascular insufficiency, peripheral nerve damage, immune deficiency and some mineral deficiencies have been variously implicated10.The first case, a sickle cell anaemia patient, was found to have cold antibodies, which could be auto-immune in origin, or due to allo-immunisation from previous red cell transfusions. The persistence of the antibodies with clinical presentation 9 years after first detection in the absence of overt malignancy makes an infectious cause unlikely. On the other hand, presentation during an unusually cold harmattan season, with ambient temperature of about 16°C suggests that the acrocyanosis and ulcers on the hands and feet may be due to Raynaud’s phenomenon, and not just the ulcers of sickle cell anaemia. Synergy between the two phenomena of agglutinin-induced, and sickle cell, ulceration can however not be ruled out.The second case was a patient with colonic carcinoma whose cold antibodies were first detected at crossmatch for peri-operative blood transfusion. The disappearance of the antibodies with remission of the primary malignancy suggests that the antibodies were associated with the malignancy. If the histological diagnosis of colonic carcinoma was correct, this association is unusual, since lymphoproliferative malignancies are more commonly implicated.1

ConClUSionThe paucity of reports of development of cold antibodies in the course of sickle cell anaemia, and failure to find other cases in a 9 year follow-up at our centre, confirm the rarity of the condition. The detection of cold antibodies in our two cases during routine crossmatch, underscores the need for meticulous crossmatching of blood for transfusion by multiple standard techniques.The inability to identify or characterise the antibodies further, and the non-standard method of warming blood, are challenges for blood transfusion practice in developing countries.

REfEREnCES1. Mollison PL, Engelfriet CP, Contreras M. Red cell antibodies

against self antigens; bound antigens and induced antigens in: Blood Transfusion in Clinical Medicine. Blackwell Scientific Publications, Oxford 1987: 410-452

2. Glanluca Lodi, Daniela Resca, Roberto Rivaberi. Fatal cold agglutinin-induced haemolytic anaemia: a case report. Journal of medical case reports 2010, 4: 252

3. Mollison PL, Engelfiet CP, Contreras M. ABO, Lewis. Ii, and P Groups in :Blood Transfusion in Clinical Medicine Blackwell Scientific Publications, Oxford 1987 : 267

4. Saigal R, Kansai A, Mittal M, Singh Y, Ram H. Raynaud’s Phenomenon Journal of the Association of Physicians of India; 2010, 58 : 309-313.

5. Judd WJ How I manage cold agglutinins. Transfusion 2006; 46 : 324-26

6. Beebe DS, Bergen I, Palahniuk RJ Anesthetic management of a patient with severe cold agglutinin haemolytic anaemia utilizing hot air warming. Anesth Analg 1993; 76: 1144-46

7. Fleming AF (ed) in : Sickle Cell Disease : A hand book for the general Physician. Churchill Livingstone, Edinburgh 1982

8. Luzzatto I. Haemoglobinopathies and Thalassaemias in : Clinics in Haematology, Luzzatto I (ed) 1981 ;10 (3) :757-784

9. Kuliya-Gwarzo A, Akanmu AS, Dutse AI. Prevalence of red cell alloantibodies in multi-transfused patients with sickle cell anaemia in northern Nigeria. Afr Sang 2005 :8(1): 1-4

10. Akinyanju O, Akinsete I. Leg ulceration in sickle cell disease in Nigeria. Tropical and Goegraphical Medicine 1979; 31 :87-91

9


Mapako T1,2, Janssen MP3, Van Den Burg P4, Smid M4, Mvere DA2, Emmanuel JC2, Postma MJ1, Rusakaniko S5, Groningen HB6, Van Hulst M1,6

1. Unit of PharmacoEpidemiology & PharmacoEconomics (PE2), Department of Pharmacy, University of Groningen, Groningen, The Netherlands2. National Blood Service Zimbabwe, Harare, Zimbabwe3. Julius Center for Health Sciences and Primary Care, MTA Department, University Medical Centre Utrecht, Utrecht, The Netherlands4. Sanquin Blood Supply, Amsterdam, The Netherlands5. Department of Community Medicine, College of Health Sciences, University of Zimbabwe, Zimbabwe 6. Martini Hospital, Groningen, The Netherlands

PROJECT REPORT

AbSTRACTinTRodUCTionTracking blood safety status of member states by World Health Organisation is now a routine activity through Global Database for Blood Safety. To understand further the differences between high income and low-income countries a detailed review may be warranted. In this review, the blood services of Netherlands and Zimbabwe were compared.

METhodologYA study visit to Netherlands was undertaken and the key findings from this visit were compared with equivalent data from Zimbabwe. Key thematic points were summarised from the review of the reports as well as the outcomes from key observations and informant discussions. Lessons learnt and recommendations were drawn for each thematic area considered.

KEY findingSThe difference in geographical land sizes (Zimbabwe 10 times larger) and population demographics (Zimbabwe predominately youths) poses different challenges to Netherlands and Zimbabwe. The organisation and management structures of the Services are similar and both rely on 100% voluntary non-remunerated blood donors. Despite the high transfusion transmission infections (TTI) rates in the general population in Zimbabwe the testing technology is low as compared to Netherlands. However, Zimbabwe through other strategies has managed to maintain low TTI prevalence in donated blood. There are comparable efforts in blood process, testing and distribution activities. The support services such as haemovigilance, research and development activities are greatly comparable though the outputs magnitude will differ depending of the level of investment.

ConClUSionOur findings seems to suggest that despite the differing income status of countries, given the proper strategies blood services in low resources settings can make comparable achievements

COMPARISON OF BLOOD SERVICES AND CLINICAL TRANSFUSION PRACTICES IN ZIMBABWE AND THE NETHERLANDS: what are the Key lessons?

10


inTRodUCTionWorld Health Organisation (WHO) regularly provides universal guidelines to member states on the need for blood safety and availability and how this can be achieved nationally.1 These recommendations are considered and implemented by countries; however, the level of implementation depends not only on commitment but available resources needed to optimise blood safety. There are published blood safety status reports by WHO through Global Database on Blood Safety (GDBS) for categories of low/medium/high (LMH) income status of countries.2

To further comprehend countries blood safety status between LMH income countries a detailed analysis is warranted to enable better appreciation of the underlying contributing factors. In this study the aim was to assess the blood safety strategies of a low human development (LHD) index, Zimbabwe, which is ranked 172 out of 187 and a very high human development (HHD) index, Netherlands, which is ranked 4 in the world.3 The focus is to understand the blood safety strategies and determine the driving forces pushing or threatening sustainability of these Services in their settings. This study recognises that the socio-economical environment of these Services differs substantially and hence restricts the analysis of the strategic options available for optimising blood services, which may be not be applicable to both settings.

METhodSA study visit was undertaken to Sanquin Blood Supply in The Netherlands in February and March 2014. A transfusion clinical internship was conducted at Martini Ziekenhuis / Hospital, Groningen, Netherlands. The findings from this study visit were compared with equivalent data from National Blood Service Zimbabwe (NBSZ). The data used was obtained through key informant discussions with executives and senior staff at Sanquin and review of the annual performance data as reported in Sanquin annual reports, which are publicly available.4 Similarly, data from NBSZ is publicly available from annual reports5 and author’s experience and knowledge of working and interaction with NBSZ. Data was collected using Excel spread sheet and then analysed. Key thematic points were summarised from the review of the reports as well as the outcomes from key informant discussions. Lessons learnt and recommendations were drawn for each thematic area considered.

KEY findingS Description of settingsSanquin Blood Supply Foundation is a not-for-profit organisation responsible for blood supply in The Netherlands, which has an area size of 41,526 km². The same is true for NBSZ, which has a national mandate to provide all blood requirements in Zimbabwe and which area size is 9.4 times more (390,580 km²) than that of The Netherlands. The country size difference, communication and infrastructure present differing challenges for blood donor access to donation sites and hospitals blood accessibility from respective distribution sites. The population of Netherlands is 16.7 million, the majority of who are adults, which is 27% higher than Zimbabwe population at 13.1 million, who are predominately youth. These population structure differences also pose different challenges in blood safety programmes.

Management and OrganisationBoth Services are similarly structured with Boards in place (Supervisory Board for Sanquin) and Executive Management Committee (Executive Board for Sanquin). The Boards have the overall responsibility for monitoring the organisation’s operations. There are Board sub-committees in both settings. Sanquin has

five divisions; Blood Bank; Plasma Products; Diagnostic Services; Reagents and Research. In comparison to NBSZ, which has departments of Medical Services; Laboratory Services; Finance; Human Resources and Administration; Public Affairs; Quality, Safety, Health and Environment; Planning, Information and Research. It was noted that the functions comprising finance, human resources, administration, planning and Information Technology Communications are placed under corporate staff/services at Sanquin and they provide support to the divisions and advice the Executive Board. With the exception of plasma products and diagnostic services the organisation and management functions are comparable. How these functions are divided is guided by the strategic thrust for the period and the turnover (for Sanquin) hence these fluid structures allow the Services to respond to varying needs and adjust operations accordingly. Currently Sanquin is undergoing centralisation and this may demand further merging/demerge of divisions. NBSZ, on the other hand is seeking possible options for regional Plasma Contract Fractionation of its blood products, which may raise the question of a separate collection facility and donor panel for collection of high quality and adequate plasma volumes suitable to meet international standards required by Regulators for acceptance by an approved fractionation facility. The idea of corporate staff/services for the over-arching staff is one that may be worth considering for NBSZ so that the departments are streamlined into key business units for the main business focuses. There is a shared need to engage and constantly inform stakeholders, as demonstrated by existence of the informative, interactive and educative websites of both Sanquin and NBSZ. This is a good practice that needs to be maintained. On both websites annual reports4,5

of the Services are available, which allows interested stakeholders easy access to relevant donor and blood safety information. The media is strongly engaged in both settings, which helps to promote the Service’s brands. This high level of transparency is crucial to the sustainability of these services, which depend on voluntary non-remunerated donors and public perceptions.The emphasis on blood safety for both the donors and patients is at the heart of the organisations as indicated in their mission statements, vision and core values.4,5 There is recognition in both settings that cost-effectiveness should be at the core of operational considerations. Sanquin is aiming to cut cost by 6% by 2015 (11.6 million Euro) through centralisation and operations realignment (staff rationalisation) due to the declining trend in blood usage. NBSZ is pursuing similar cost cutting measures though the performance of the cost containment committee needs to be strengthened as this same trend is taking place in Zimbabwe, where demand is declining. Though the declining trend in the demand and clinical use of blood is similar, the underlying factors may be different. In Zimbabwe it is mainly due to availability and affordability and the financially constrained healthcare system; whereas in The Netherlands, this is attributable to continuing education of clinicians on appropriate clinical use of blood and effective haemovigilance. This area of clinician’s education and training is important and NBSZ is in the process of rolling out education and training, within the current financial limitations. It was noted that in The Netherlands, although there is decline in the demand and use of red blood cells, there is an increase in the demand and use of plasma derived medicinal products (PDMPs). This change in patterns of use requires a review of structures and functions in a more cost-effective organisational and management model. One model could be to consider collection of sufficient quality plasma to meet national needs through plasmapheresis of source plasma.

11


Donor mobilizations and blood collectionNBSZ and Sanquin rely on 100% voluntary non-remunerated blood donation as recommended by WHO1 to meet National requirements of labile blood products. Meeting the National requirements for PDMP from recovered plasma used for fractionation, that is plasma recovered from whole blood donations and used to produce PDMPs, has reportedly fallen short in nearly every country in the developed world and may presently not be feasible in low income countries. Annually, Sanquin, collects blood from approximately 400 000 donors, compared to approximately 50 000 active blood donors in Zimbabwe, as reflected in the data collected between 2009 and 2012. Over the same period, the annual whole blood (WB) donations in Netherlands averages 540 000 from this donor base, compared to 60 000 units from the donor base in Zimbabwe. This results in 24 donations per 1 000 inhabitants in The Netherlands and 4 donations per 1 000 population in Zimbabwe. WHO’s estimate for national blood adequacy is 10 donors per 1 000 inhabitants. If Zimbabwe were to adopt the guideline recommendations set by WHO, this would result in unacceptable expiry of blood and a drain on limited financial resources. NBSZ is currently developing strategies to ensure a sustainable national blood service, which can provide a safe, accessible, adequate and affordable unit of blood and at the same time address the goal of working towards developing a model for sourcing plasma using plasmapheresis in order to meet international standards of safety and sufficient volumes for contract fractionation. A blood donor in Netherland donates at least 1.6 units of WB annually versus 1.8 units in Zimbabwe. This frequency is interesting, as it provides an impression that donor retention in Zimbabwe is higher than (or at least comparable) to Netherlands. However when one looks at other retention measures then the apparent differences become clearer. If the percentage of repeat donors per year is examined more closely, it becomes apparent that in the Netherlands this is approximately 90% versus 56% in Zimbabwe. On average, 53% of donors in Zimbabwe provide at least two usable units and the corresponding figure from Netherlands was not readily available from the Annual Reports (but presumed to be greater than 80%). Further, in Zimbabwe the year-to-year donor retention is on average 34% and the corresponding data is not readily available for Netherlands (but presumed to be greater than 80%) Donor retention is a critical indicator of donor management and each Blood Service should attempt to use a standard definition. This assessment indicates that to use only average donations as an indicator of donor retention may be inappropriate especially when there is need to compare different settings. It may be worthwhile for Sanquin to consider to expand their donor retention measures and report on these as explained above.In Zimbabwe donations are either WB or apheresis for platelets (about 150 annually). In Netherlands there are WB, apheresis (plasma and platelets) donations (about 325 000 annually). Due to lack of plasma market in Zimbabwe the majority (75%) of this is discarded and this is despite the fact that there is severe shortage of plasma derivative products in Zimbabwe. Concerted efforts are need in Zimbabwe to ensure that plasma is used for plasma derivative production to help the need patients in Zimbabwe and we note that NBSZ alone has no capacity to address this problem as it needs to meet the good manufacturing practice (GMP) requirements for the plasma supply. This would require the involvement of Government of Zimbabwe and all international partners. There is an opportunity for NBSZ to expand apheresis services further for patient management as observed at Sanquin. This will be additional possible source of revenue and also helps to maintain the staff skills.

On average 10% of donors are new donors in Netherlands compared to 44% in Zimbabwe. This large disparity is due to the fact that in Zimbabwe, about 70% of collections come from donors aged 16-20 years old. These are highly mobile donors hence the loss rate is high. This also affects donor retention as discussed earlier. The donors in Netherlands starts donating at 18 years and are mainly composed of adult donors who are stable hence easier to retain. NBSZ need to pursue its strategy to re-align the donor base to a more sustainable structure balanced on youth and adult base. In both settings there are incentive schemes that assist in the retention of donors and these need to be maintained. The desire for Netherlands to increase youth donors may benefit from the NBSZ pioneered successful youth projects that consist of the peer promoters and the Pledge 25 Club that has since been copied all over the world.6,7

The blood safety measures for the new donors are comparable. In Netherlands all new donors undergo medical examination first and a sample is provided for transfusion transmissible infections (TTI) testing and blood typing. If a donor is cleared from this initial assessment, then they are called within two weeks to provide their first-time donation. In Zimbabwe, new donors are risk profiled historically based mainly on age at donation. New donors aged 16-20 and those above 45 years provide usable blood. For those donors aged 21-44 years old, an unusable blood is collected (a blood pack without anti-coagulant).8 In both settings these are all measures to safeguard blood supplies and informed by risk considerations and settings practicalities. In Zimbabwe where 80% of donors are at mobile clinics and the mobile drives might be about 300km, the Netherlands blood safety management model may be difficult to implement. These variations based on the need to optimise blood safety have the inevitability of resulting in different definitions of new donor or first-time donor. One may argue that the first-time donation in Netherlands is not really ‘first’ as logically this is a ‘second’ interaction with the donor. The statistical challenges that arose from this scenario are obvious. It will become critical then that further definitions to capture these variations are developed and reported on so that there will be consistence and comparability of data definitions in different settings.

Blood processing and testingIn both settings there is production of components that includes at minimum RBC, FFP, Cryoprecipitate and platelets. The production systems are comparable, but in Netherlands the product lines are quite varied compared to Zimbabwe. This gives patients more choice of available products. There is testing of the four TTI markers (HIV, HBV, HCV and Syphilis) universally recommended by WHO.9,10 NAT is used in Netherlands and in Zimbabwe 4th generation serological testing technology is in use. Additional test are done in Netherlands including HTLV, which since 2013 is only being tested in new donors as a cost-containment measures which is also informed by the fact that the production process reduces the infection level substantially. This is important as the available best evidence guides operations. ABO and Rhesus typing are done but there is more extensive typing in Netherlands. The donor blood group distributions are comparable with Sanquin having 48%, 39%, 9% and 3% (NBSZ, 52%, 25%, 20%, 5%) for O, A, B and AB blood groups respectively. There is more typing (forward and back typing) of new donors (sample have different cap colour, also multiple sample sources are used) in Netherlands and this substantially reduces blood group discrepancies for the donor current and future donations.

12


Zimbabwe may need to consider this Netherlands approach to reduce the current high number of blood group discrepancies that has been observed. In both settings, testing is centralised at one facility and this ensures similar testing quality standards nationally. The prevalence of four universal TTI markers in donated blood averages (2005-2012) per 100 000 for new (n) and repeat (r) donors as follows in Netherlands for Syphilis (n=31.9, r=2.8; Zimbabwe, n=411.1, r=194.4); HCV (n=17.1, r=0.2; Zimbabwe, n=190.1, r=84); HBV (n=52.1, r=1.6; Zimbabwe, n=1645.4, r=366.7); HIV (n=3.8, r=0.5; Zimbabwe, n=681.2, r=229). It is important to note the serological testing algorithms are similar, however in Netherlands there is use of NAT and there is confirmatory testing using western blotting and PCR. In Zimbabwe, the confirmation is done using an alternative but comparable (sensitivity) testing assay. Despite the general population epidemiological differences of these TTIs in both settings, the donations testing results may also need to be cautiously interpreted taking these testing variations into considerations. It was noted that the issue of indeterminant results is prevalent in both settings. Consecutively (three times) indeterminant donations from the donor would result in permanent donor deferral in Zimbabwe and in Netherlands an indeterminant results from a new sample collection would lead to the permanent donor deferral. The challenges of communicating the indeterminant results and deferral decision to donors are similar but keeping them on donor list would waste resources as indeterminants will still ‘pop-up’ and products are unusable. NBSZ current efforts to do further research on indeteminants may draw lessons from Sanquin experience which do the confirmation and still the donor results remains indeterminant. Under those circumstances, the logical decision for NBSZ is pursue and maintain its permanent deferral policy. In both setting, post-donation counselling services are provided. In Sanquin, medical doctors and state registered nurses do this and counselling partners are used in Zimbabwe.In the Netherlands, the non-serological discard rate is 0.2% and 0.4% (2012) for the serological waste. This is in contrast to Zimbabwe where the non-serological discard can be as high as 8% and serological wastage is around 1.7% (2012). There are opportunities to further reduce the discards in Zimbabwe especially on the non-serological discards to the below 2% threshold recommended by WHO as blood expiries constitute the bulk of the non-serological discards. The high serological discards in Zimbabwe might be a reflection of equally high TTI prevalence in the general population especially for HIV and HBV despite all the stringent pre-donation selection interviews. It is important to note that in Zimbabwe the discard rate for HBV is twice that of HIV, which may be a reflection of either a high general population HBV prevalence (not well studied) or that the current risk factor exclusion is not very effective for HBV or perhaps its the testing HBV dynamics. This demands further understanding of whether this can be reduced further.

Distribution of blood and blood productsIn both settings there is inventory management system in place. There is opportunity to use distribution data to inform blood collections on shorter periods in Zimbabwe and this will help to moderate supplies to avert wastages and intermittent shortages. Having a dedicated logistics inventory management appointment might be useful in Zimbabwe to strengthen this area as observed in Netherlands. The Sanquin Blood Supply cold chain consists of simple to use but effective cold chain equipment consisting of cooler boxes, cooling trays and packs. Such simple low-cost may be considered in Zimbabwe settings.

Sanquin delivers blood to hospitals in contrast to Zimbabwe where hospitals are responsible for their own blood collections. It has been argued that the Netherlands supply system may not be cost effective as indications are that hospitals may not be strategically ordering blood to minimise delivery trips as Sanquin bears this once off cost. Mechanism to enforce hospital to make structured cost-effective ordering schedules may be required in the Netherlands.In both setting the cost of blood and blood products is an issue that attracts political, media and public scrutiny. The principled position that has been taken by the Services, which are commensurate with the expected level of blood safety, needs to be maintained. Blood safety should be the main considerations first and how this can be financed will be a matter of all partners’ engagements.

Quality AssuranceIn both settings quality assurance is at the forefront of operations. Formal quality recognition is being pursued or maintained at these Services. It was noted that Sanquin ceased its formal recognition of ISO 9001 on quality management systems partly because of cost considerations and the need to be guided by EU directives, which are continuously monitored by government. It remains a point of discussion on whether formal quality management systems being pursued in Zimbabwe need to be maintained or focus should be directed to meet applicable GMP requirements for blood establishments that has the potential of opening plasma market opportunities in Zimbabwe.There is strong emphasis in both settings that quality management system should be embraced and owned by all staff. We noted the organisational management differences with respect to quality management systems that might need to be considered further.

Research, Education and TrainingThe quest for evidence based decision-making process in both settings is noted through their vibrant research programmes. Sanquin research program is more mature and has outputs at high levels with 12 PhD theses and 175 peer-reviewed publications just in 2012. The current transfusion research capacity (T-REC) building project in which NBSZ is a partner is increasingly building a strong base for scientific research and these needs to be maintained. It was noted that NBSZ need to promote its research outputs more through say highlighting these on its website and systematically evaluate how past research efforts have been used to strengthen blood safety policies in Zimbabwe.Sanquin has various training programmes in place both internally and collaboratively. There is need to maintain contact on training opportunities in both settings especially on the masters programme that is being developed for donor health management. Continual sharing of resources and experience will also assist both Services to appreciate the emerging trends in blood safety.

Information/Data Management SystemsBoth settings use commercial information management systems to manage blood banking data (eProgressa in Netherlands and eDelphyn in Zimbabwe), which is available on wide area network. There are other complementary databases in use in Netherlands for Hemovigilance, laboratory testing and quality management systems that are linked through servers for data sharing and repositories. There is opportunity for NBSZ to consider such other complementary databases, which may assist mainly in hemovigilance and quality management systems (strive towards paperless).Given the huge amount of data the Services generate, it was a discussion point on whether the data management/use can also be enhance through a data management function that would assist all departments in Sanquin as is the current position in Zimbabwe.

13


Clinical transfusion medicineIn both settings clinical blood transfusion is guided by the blood transfusion guidelines. It was noted that in Netherlands all key stakeholders jointly author and publish these guidelines and this enhances ownership and compliance to the standards. The Martini hospitals have its own transfusion management system that handles internal blood orders and for blood stock management. This hospital system is not yet linked with Sanquin blood information management system and orders are made through fax and phone as necessary. For this hospital, it manages its own blood deliveries from Sanquin and there was evidence of continual engagement of the hospital and Sanquin. NBSZ is pursuing options of linking hospitals to its e-Delphyn blood bank management system and engagement with hospitals are continually being strengthened. Martin hospital for 2013 had 5 189 red blood cells transfusion, 276 platelets and 395 fresh frozen plasma almost equivalent to the capacity of referral hospitals like Parirenyatwa Hospital in Zimbabwe. The hospital information management system allows analysis of blood usage data as needed and this is currently a challenge in Zimbabwe as most hospitals do not have such shared systems in place. The introduction of electronic temperature management tags allowed about 29 red blood cells to be saved in 2013 after non-usage from the ward based on 30-minute rule. The existing surgery list that suggests how many blood units are to be reserved for each planned operation. This greatly helps in stock management.The hospital has a hospital transfusion committee in place with participation of Sanquin blood supply staff. All transfusion reactions are reported to TRIP through the established forms. The mature HTCs programme in Netherlands can be useful as a learning point for Zimbabwe to strengthen blood bank and clinical transfusion interface. It was noted that blood service having service level agreement with hospital is critical to ensure interaction and cooperation of the parties.

ConClUSion And RECoMMEndATionS Despite the differences in income status between Zimbabwe and Netherlands there are several common areas of operations. There exists also further opportunities to share the experiences of two settings as a means of continual blood safety strengthening. It is not the intention to replicate any one Service with another but all decision should be evaluated based on the applicable contextual environment of operations. It can be concluded that the two Blood Services are doing all in their capacity to improve blood safety. In Europe, Sanquin Blood Supply is at the forefront of blood safety programmes and in sub-Saharan Africa, the blood safety record of National Blood Service Zimbabwe is well positioned. These blood safety leadership roles need to be maintained and complemented with Governments and partner’s support. Both Services may benefit from maintaining corporate engagements processes in areas of mutual interest.

Based on the findings the key recommendations for each setting are provided:Key areas for NBSZ to consider consolidating:• Diversity revenue stream, the private business entity needs

strengthen. The budget of blood banking and the private sustainability initiatives may need to be separated.

• Expand apheresis services for clinical management.• Establish research laboratory, with equipment to support

research and allow resource sharing with partners.• Strength NBSZ consultancy services especially in sub-Saharan

Africa. These services will also need to be marketed.

• Enhance education and training and follow-up on the outputs from these initiatives.

• Intensify cost-recovery measures for the blood banking operations. Initiatives like the EU / UNICEF coupon systems that adds directly to the procurement of the blood products is further recommended to be vigorously pursued. This is important in view of the cash-constrained public sector.

• In line with its innovation aspirations, this needs to be strengthened further so that there is documented evidence of innovation products.

• NBSZ to pursue avenues for Plasma Fractionation at various levels (region & WHO).

• NBSZ to intensify its support engagement and place strongly the patient at the forefront in order to strengthen its GMP call for support. As NBSZ it is primarily there for the need patients hence this should form the basis of all strategic engagements.

• Strengthen Hemovigilance system with hospitals and ensure that that there are service level contracts.

Key areas for Sanquin to consider consolidating:• Broaden the definitions of donor retention calculation and

report these.• Maintain a strong collaborative focus with other blood services

and organisations internationally. This will allow further developments in blood safety programmes.

• Pursue and provide strategic leadership internationally on how plasma derivatives may be made available affordably to resource-constrained settings.

• Introduce a data management function at corporate level to coordinate all data repositories and ensure this feeds into the monitoring and evaluation systems of Sanquin.

• Review cost-effectiveness of blood delivery system to hospitals

REfEREnCES1. WHO | World Health Assembly and Executive Board

resolutions on blood safety and availability. at <http://www.who.int/bloodsafety/resolutions/en/>

2. WHO. WHO | Global database on blood safety at <http://www.who.int/bloodsafety/global_database/en/>3. UNDP. | Human Development Reports. at <http://hdr.undp.org/en/countries>4. Sanquin Blood Supply. Annual reports, scientific reports and

financial statements | Sanquin Blood Supply. at <http://www.sanquin.nl/en/about/about-sanquin/annual-

reports/>5. National Blood Service Zimbabwe. Annual Reports and

Publications. at <http://www.nbsz.co.zw/index.php/media-centre/annual-reports-and-publications>

6. WHO. WHO | Voluntary non-remunerated blood donation. WHO at <http://www.who.int/bloodsafety/voluntary_donation/en/>

7. WHO | 14 June: World Blood Donor Day to honour voluntary, unpaid blood donors all over the globe. WHO at <http://www.who.int/mediacentre/news/releases/2004/pr39/en/>

8. Mapako, T. et al. Human immunodeficiency virus prevalence, incidence, and residual transmission risk in first-time and repeat blood donations in Zimbabwe: implications on blood safety. Transfusion (Paris) 53, 2413–2421 (2013).

9. Information, N. C. for B., Pike, U. S. N. L. of M. 8600 R., MD, B. & Usa, 20894. Screening for transfusion-transmissible infections. (2009). at <http://www.ncbi.nlm.nih.gov/books/NBK142989/>

10. TOC.pdf. at <http://www.ncbi.nlm.nih.gov/books/NBK142990/pdf/TOC.pdf>

14


INACTIVATION OF PLASMODIUM FALCIPARUM in whole body by riboflavin plus irradiation

(Reprinted with permission from ‘Transfusion’, Vol 53(12), December2013)

Mira El Chaar, Sharan Atwal, Graham L. Freimanis, Bismarck Dinko, Colin J. Sutherland, and Jean-Pierre Allain Department of Haematology, University of Cambridge, Cambridge, United Kingdom;Department of Immunology & Infection, Faculty of Infectious & Tropical Diseases and the HPA Malaria Reference Laboratory, London School of Hygiene & Tropical Medicine, London, United Kingdom;Faculty of Health Sciences, University of Balamand, Beirut, Lebanon.

CoRRESpondAnCEAddress reprint requests to: Jean-Pierre Allain, Cambridge Blood Centre, Long Road, Cambridge CB2 2PT, UK; e-mail: [email protected] work was supported by a grant from TerumoBCT to CS and JPA.Received for publication December 9, 2012; revision received February 1, 2013, and accepted February 4, 2013.doi: 10.1111/trf.12235 TRANSFUSION 2013;53:3174-3183.

AbbREviATionS qPCR = real-time polymerase chain reaction.

AbSTRACTbACKgRoUndMalaria parasites are frequently transmitted by unscreened blood transfusions in Africa. Pathogen reduction methods in whole blood would thus greatly improve blood safety. We aimed to determinethe efficacy of riboflavin plus irradiation for treatment of whole blood infected with Plasmodium falciparum.

STUdY dESign And METhodSBlood was inoculated with 104 or 105 parasites/mL and riboflavin treated with or without ultraviolet (UV) irradiation (40-160 J/mL red blood cells [mLRBCs]). Parasite genome integrity was assessed by quantitative amplification inhibition assays, and P. falciparum viability was monitored in vitro.

RESUlTSRiboflavin alone did not affect parasite genome integrity or parasite viability. Application of UV after riboflavin treatment disrupted parasite genome integrity, reducing polymerase-dependent amplification by up to 2 logs (99%). At 80 J/mLRBCs, riboflavin plus irradiation prevented recovery of viable parasites in vitro for 2 weeks, whereas untreated controls typically recovered to approximately 2% parasitemia after 4 days of in vitro culture. Exposure of blood to 160 J/mLRBCs was not associated with significant hemolysis.

ConClUSionSRiboflavin plus irradiation treatment of whole blood damages parasite genomes and drastically reduces P. falciparum viability in vitro. In the absence of suitable malaria screening assays, parasite inactivation should be investigated for prevention of transfusion- transmitted malaria in highly endemic areas.

Malaria is a major disease accounting for a high number of deaths annually in tropical regions of sub-Saharan Africa, Asia, and Latin America.1-3 In Africa, most severe malaria and deaths occur in children younger than 5 years and in pregnant women.4,5 Malaria cases also occur in nonendemic areas as a result of travel from malaria endemic countries. Six species in the genus Plasmodium are identified as human malaria parasites: P. falciparum, P. vivax, P. ovale curtisi, P. ovale wallikeri, P. malariae, and P. knowlesi.

Infections with P. falciparum can be much more severe than those caused by other species, with complications including cerebral malaria, severe anemia, respiratory distress, and renal failure. Malaria is transmitted by mosquitoes of the genus Anopheles, but may also be transmitted person to person through direct inoculation of infected blood due to needle sharing among drug users, organ transplantation, and blood transfusion.6,7

15


Although recommended by the World Health Organization (WHO), blood testing for malaria parasites is rarely implemented in developing countries because microscopy has low sensitivity and takes too long to be useful for high-throughput screening.8 Other assays detecting parasite antigens or nucleic acids either lack sensitivity or are too expensive, given the constraints of an already short blood supply.8 Inactivation of Plasmodium in whole blood units, before transfusion, would be much more suitable in endemic countries provided that it was effective and affordable. The riboflavin plus irradiation pathogen reduction system uses a combination of riboflavin, a non- toxic substance (vitamin B2), and ultraviolet (UV) irradiation to induce damage in nucleic acid-containing infectious agents.9 The system is known to inactivate bacteria, viruses, and the protozoan Babesia in platelets (PLTs) and plasma,10-12 but has not been proven as a pathogen inactivation strategy in whole blood. In this study, whole blood units spiked with P. falciparum were treated with the riboflavin plus irradiation system. Parasite inactivation was quantified by measuring amplification inhibition of P. falciparum genomic sequences and by assessing P. falciparum viability in culture.

MATERiAlS And METhodSParasite culture and enrichmentAsexual blood stage parasites of P. falciparum Clone 3D7 were cultured in human A+ blood and complete medium according to established protocols,13,14 except that human serum was replaced by bovine serum albumin (Albumax II, Sigma, Gillingham, UK) to a final concentration of 50%. Cultures were incubated at 37°C under a gas phase of 3% CO2/1% O2/96% N2 with daily media changes. Ring- enriched culture at 7% hematocrit (Hct) with parasitemia between 5 and 9% were prepared for initial experiments. To obtain higher levels of parasitemia, magnet-activated cell sorting (MACS, Miltenyi BioTec, Bergisch Gladbach, Germany) was used to enrich and synchronize mixed stage asexual parasites through a 21-gauge flow resistor as previously described.13,15 Late-stage parasites retained in the column were collected into a 50-mL tube, pelleted by centrifugation as above, and returned to culture with fresh blood and medium. These late stages were incubated with shaking overnight, so that ring-stage trophozoites were present next day, typically with a parasitemia of 10% to 14%. All parasite preparations were sent at room temperature to the Department of Haematology, University of Cambridge, by courier.

Treatment with the riboflavin plus irradiation systemBlood units (blood group A+) were obtained from the German Red Cross blood service in Frankfurt, Germany, by courtesy of Dr M. Schmidt. Before treatment, the blood units were equilibrated at 37°C and transferred into the illumination bag using a tubing welder ( TerumoBCT, Denver, CO). Infected red blood cells (RBCs) resuspended in RPMI, brought by courier from London, were pelleted by centrifugation (600 ¥ g for 5 min). The pellet was resuspended in 20 mL of whole blood withdrawn from the initial blood unit. After being mixed, the infected blood was spiked into the respective blood units at a final concentration of 104 or 105 P. falciparum parasites/mL. A quantity of 35 mL of riboflavin was added to the illumination bag, which was irradiated using the riboflavin plus irradiation UV system at 40, 80, 120, and 160 J/mLRBCs. Samples were collected at four different time points, (summarized in Fig.1). Ten-milliliter samples were sent by courier to the London School of Hygiene and Tropical Medicine at room temperature for approximately 2 hours for viability testing.

Subculturing and monitoring of treated parasites Aliquots of riboflavin plus irradiation-treated parasite-infected blood units, and uninfected control units were handled simultaneously and transported from Cambridge to the Category 3 laboratory at London School of Hygiene and Tropical Medicine by courier, typically in volumes of 10 to 20 mL per treatment, and were returned to in vitro culture. After two pilot experiments in which evidence of growth retardation in riboflavin plus irradiation-treated samples was observed, the following procedure was adopted. Treated material was centrifuged to remove residual white blood cells ( WBCs) and washed once in RPMI, and then 2 mL of RBCs was removed into 25 mL of fresh complete culture medium in a flat-bottomed vent-capped flask and supplemented with 0.5 mL of uninfected RBCs freshly washed in RPMI without serum. These “recovery” cultures were monitored for parasite growth at 48-hour intervals by blood slide microscopy for at least 14 days, and up to 24 days in some experiments, or until parasitemia reached 2%. In five of the six experiments, the volume of fresh medium added every 48 hours was increased in 2-mL increments; RBCs were also added to maintain Hct if needed.

FIGURE 1. Experimental design. One unit of whole blood was inoculated with P. falciparum. A control sample was collected before and after adding riboflavin, before UV exposure. Four additional samples were collected after illumination at 40, 80, 120 and J/mLRBCs, respectively. All collected samples were tested for inhibition by qPCR, and an aliquot was returned to in vitro culture for viability testing.

16


P. falciparum genomic amplification inhibitionFor the preamplification inhibition and real-time polymerase chain reaction (qPCR) assay, DNA was extracted from 500 mL of whole blood using the a viral nucleic acid kit (High Pure, Roche Diagnostics, Burgess Hill, UK) in accordance with the manufacturer’s instructions. The principles of the assays have been previously reported.16

In brief, riboflavin plus UV irradiation randomly damages the nucleic acids by forming adducts or breakage at intervals depending on concentration of riboflavin and intensity of irradiation. It is hypothesized that these damages would affect amplification by PCR proportionally to the length of amplicons targeted: the longer the higher likelihood of amplification inhibition. Quantitative estimation of genomic replication inhibition by riboflavin plus irradiation treatment was derived as previously described for treatment of virus-infected blood products.16 Suitable targets for the assay were identified in the 18S rRNA genes and the mitochondrial genome of P. falciparum. For 18S rRNA target, four nested genomic amplicons were amplified: 1654, 1092, 676, and 317 bp (Fig. 2). A 50-mL PCR mixture was prepared containing 1¥ NH4 buffer, 4 mmol/L MgCl2, 0.8 mmol/L dNTPs, 0.4 mmol/L of each primer, and 5 U of DNA polymerase (BIOTAQ, Bioline, London, UK). Five microliters of template DNA, estimated to comprise 104 to 105 copies/mL, was used for each reaction. Primer sequences and PCR conditions for the initial template preamplification step are given in Table 1. The 1654-bp PCR procedure, after an initial incubation for 5 minutes at 94°C, 10 cycles of touchdown PCR of 30 seconds at 94°C, 45 seconds at 65 to 55°C, and 3 minutes at 72°C were followed by nine cycles of 30 seconds at 94°C, 45 seconds at 55°C, and 3 minutes at 72°C. For PCR generating a 1092-bp amplicon, 20 cycles of 30 seconds at 94°C, 45 seconds at 55°C, and 2.5 minutes at 72°C, and for those generating 676- and 317-bp amplicons, 17 cycles of 30 seconds at 94°C, 45 seconds at 55°C, and 2 minutes at 72°C were performed. All PCR procedures were followed by an incubation for 7 minutes at 72°C.

For the mitochondrial genes, primers were designed to five nested regions including portions of the cox1 and cytb genes, generating amplicons of 2316, 1308, 934, 577, 240, and 134 bp in length. Specific primers and a single probe were designed to quantify each amplicon from the two genes (Fig. 2). For the 2316-bp PCR procedure, after an initial incubation for 5 minutes at 94°C, 20 cycles of touchdown PCR of 30 seconds at 94°C, 45 seconds at 60 to 50°C, and 2 minutes at 68°C were performed. For PCR generating 1308-bp amplicon, 12 cycles of touchdown of 30 seconds at 94°C, 45 seconds at 60 to 50°C, and 1 minute at 68°C, and for PCR generating a 934-bp amplicon, 11 cycles of touchdown of 30 seconds at 94°C, 45 seconds at 60 to 50°C, and 1 minute at 68°C were performed. For those generating 577- and 240-bp amplicons, 10 cycles of 30 seconds at 94°C, 45 seconds at 50°C, and 30 seconds at 68°C were performed. All PCR procedures were followed by an incubation for 7 minutes at 68°C.

Quantification of preamplified productsPreamplified products were quantified by qPCR using a multiplex qPCR system (MX3000, Stratagene, La Jolla, CA). Primers and probes (5′ labeled with Cy5 and 3′ labeled with BHQ2) for qPCR of both 18S rRNA and mitochondrial gene, and amplification cycling conditions, are given in Table 1. Amplification was performed in duplicate using a PCR kit (Brilliant III Ultra-Fast Q, Stratagene) according to the manufacturer’s instruction. The small nonpreamplified qPCR was used as reference and log amplification inhibition of preamplified amplicon was determined as previously described.16

Statistical analysisCorrelation between continuous variables was evaluated by calculating Spearman’s rho and associated significance. Associations between binary categorical variables were explored by estimation of odds ratios (ORs), and significance was tested using the chi-squared distribution. All statistical analysis was performed in a software package (STATA, Version 10, StataCorp, College Station, TX).

RESUlTSOptimization of the Plasmodium amplification inhibition assayThe number of preamplification cycles of each amplicon was optimized against the P. falciparum nucleic acid test standard17 to generate similar amount of final PCR product followed by qPCR measurement using the reference short qPCR amplicon (169 bp for the 18S rRNA and 134 bp for the mitochondrial gene) irrespective of preamplified amplicon length. The qPCR standard curve for each amplicon length for the same gene reproducibly overlapped, hence demonstrating accurate normalization of the preamplification conditions (Fig. 3). A 4-log range of preamplification for 18S rRNA gene and 3 log for the mitochondrial gene compared with the baseline control (serially diluted sample quantified samples without a preamplification step) was obtained.

FIGURE 2. Primers and probes design for the preamplification of P. falciparum genome. Two conserved regions of Plasmodium genome were used to design primers and probes; the 18S rRNA gene and the mitochondrial gene. Four overlapping regions of 18S rRNA were amplified (1654, 1092, 676, and 317 bp) and quantified by qPCR of a region common to all segments (169 bp). For the mitochondrial gene, five overlapping regions were amplified. Each primary amplicon was then quantified by qPCR using common primers and probe (134 bp).

17


P. falciparum amplification inhibition with riboflavin plus irradiation treatment of whole bloodFor the measurement of PCR inhibition by riboflavin plus irradiation, 25 paired blood units spiked with P. falciparum asexual parasites were treated or not treated and relative genome inhibition was measured by the qPCR method described above. The log inhibition after treatment was estimated by comparing the Ct of four log dilutions before and after treatment (Fig. 3) in all amplicons. There was no detectable amplification inhibition when riboflavin was added without UV treatment. We explored two dose-response relationships in these data. First, as shown in Fig. 4A, log inhibition increased with increasing amplicon size when both riboflavin and UV illumination were present. With the smaller amplicons (577, 317, and 240 bp), inhibition was less than 0.7 log. The observed level of inhibition was greater with longer amplicons, but this relationship reached a plateau at 676 and 935 bp for 18S and mitochondrial targets, respectively, when treated with 80 J/mLRBCs (1-log inhibition). Inhibition continued to increase with longer amplicons when infected blood was treated at 160 J/mLRBCs reaching 2-log inhibition with both targeted regions (Figs. 4A and 4B). Second, inhibition of genome amplification was also positively associated with increased illumination energy. Amplification of parasite genomic targets was

inhibited by approximately 1 log at 80 J/mLRBCs and by 2 logs at 120 J/mLRBCs, reaching a plateau above that level (Fig. 4C). When results with the two genes were compared, no significant difference in the estimates of genome amplification inhibition was observed. These results confirm that the combination of riboflavin and irradiation generate measurable DNA damage to malaria parasites in whole blood.

In vitro viability testingTo test whether P. falciparum viability was impaired by the observed genome damage inflicted by riboflavin and irradiation we performed studies of posttreatment parasite viability in in vitro culture. Two pilot experiments were performed to establish appropriate starting parasitemia and growth monitoring procedures. Using starting parasitemia in whole blood of 8.9 ¥ 104 and 1.2 ¥ 105 parasites/ mL, respectively, parasites in untreated blood were detected by Day 4 in both experiments and recovered to 2% parasitemia by Days 11 and 7, respectively. In contrast, addition of riboflavin and irradiation for 80 J/mLRBCs delayed full parasite recovery to Days 13 and 15, respectively, whereas riboflavin with 160 J/mLRBCs of irradiation delayed parasite recovery to Day 17 in the first experiment and prevented parasite recovery in the second.

TABLE 1. Primers and probes for quantification of P. falciparum 18S rRNA gene and mitochondrial genome amplicons

Name Sequence 5′-3′ Amplicon size (bp)18S rRNA gene amplicons Plasmo 1 (F) GTTAAGGGAGTGAAGACGATCAGA 169 Plasmo 2 (R) AACCCAAAGACTTTGATTTCTCATAA Malprobe (Cy5) ACCGTCGTAATCTTAACCATAAACTATACCGACTAG (BHQ2)Mitochondrial genome amplicons cyt 135 (F) CCATTTATTGGATTATGTATTGTATTTATAC 135 cyt 240 (R) CCTTTAACATCAAGACTTAATAGATTTGGA Probe cyt 1 (Cy5) TACATTTACATGGTAGCACAAATCCTTTAGGGTATGA (BHQ2)

FIGURE 3. Quantification of log inhibition of P. falciparum genome amplification. Example of log inhibition quantification comparing before and after riboflavin plus irradiation treatment. A whole blood unit was treated with riboflavin and UV and results were compared to an untreated control unit. Three samples of parasite-infected whole blood were tested for amplification of the 2.3-kb mitochondrial genome target: the first received no treatment ( ), the second riboflavin only ( ), and the third was treated with riboflavin and UV (80 J/mL; ). All samples were preamplified and quantified by qPCR. The sample treated with riboflavin and UV showed 1-log inhibition when compared with both non–UV-treated samples.

18


To measure the effect of treatment and investigate whether there was a dose–response relationship between irradiation dose and parasite growth inhibition, a series of six experiments was performed, each in duplicate. Table 2 sets out the different treatments tested and notes minor variations among experiments. In one duplicate each from Experiments 1, 3, and 4, control cultures, which were not treated with riboflavin and received no irradiation, failed to recover to 2% parasitemia. One of these odd cases was due to an error of culture dispatch and the other two to bacterial contamination overgrowing the parasite; all data from these experiments were excluded from the analysis. Results from all cultures left a total of nine replicate experiments, each of which included two control cultures. Irradiation treatments of 80 and 160 J/mLRBCs were also included in each of these nine experiments, which altogether provided a total of 46 evaluable cultures. There was no significant correlation between spiking parasitemia and day of recovery to 2% parasitemia in either the 80 or the 160 J/mLRBCs irradiation groups (n = 9 in both cases; Spearman rho = 0.017, p = 0.965; and rho = -0.567, p = 0.112, respectively). We therefore pooled identical treatments across experiments for the remaining analyses.

To easily compare the rate of parasite recovery among the 46 cultures, four categories were generated from the data. The first category represents the fastest growing quartile of culture growth (recovery to 2% parasitemia by Day 8 or sooner), the second category represented the interquartile group (recovery between Day 9 and Day 18), the third category the slowest quartile (recovery between Day 19 and Day 24), and Category 4 those cultures in which no growth was observed. Figure 5 shows the proportion of cultures in each of these recovery categories, grouped by irradiation exposure. A clear dose-response relationship is observed, with all 22 cultures receiving riboflavin plus at least 80 J/mLRBCs of irradiation showing either substantially delayed parasite growth recovery or no growth at all. Indeed, for these 22 cultures there was a very strong likelihood of complete inhibition of parasite growth compared to the other 24 cultures (OR, 27.6; 95% confidence interval, 3.07-1230; p = 0.0002). The occasional discrepancy between level of spiking and inactivation of parasite was related to the relatively small difference in parasitemia after spiking that was not different. In vivo, when examined microscopically, the range of parasite density is approximately 5 logs starting at five parasites/mL of blood.

diSCUSSionPhotochemical pathogen reduction for parasites in human blood and blood products has been examined using several compounds such as Inactine, amotosalen, and riboflavin and successfully demonstrated for Leishmania donovani, Trypanosoma cruzi, and Plasmodium.18-21 However, except for T. cruzi19 and Babesia microti,20 these experiments have been conducted in PLT concentrates or fresh frozen plasma, rather than whole blood, as poor UV light absorption considerably limits the potential for photochemical inactivation of pathogens in the presence of RBCs.19,21,22 Previous studies of Plasmodium have measured efficacy of photochemical inactivation in either animals such as hamsters18 or in fractionated blood products spiked with cultured P. falciparum.19

This study has significantly extended this approach by deployment of both a quantitative molecular assay of genome damage and parasite viability testing after photochemical treatment of whole human blood infected with P. falciparum.

FIGURE 4. Log inhibition of amplification of different lengths of mitochondrial DNA and rRNA with riboflavin plus irradiation at 80 ( ) and 160 ( ) J/cmRBCs. (A and B) Impact of riboflavin and UV treatment on plasmodium genes: 18S rRNA and mitochondrial genes, respectively. Inhibition was measured using four amplicons for the 18S rRNA and five amplicons for the mitochondrial gene, at two different exposure levels: 80 ( ) and 160 ( ) J/mLRBCs. (C) Summary of the effect of UV exposure on two P. falciparum genes, using the longest target amplicons for each, at increasing level of UV exposure: 40, 80, 120, and 160 J/mLRBCs. ( ) Mitochondrial gene; ( ) 18S rRNA

19


It is difficult to compare the molecular and functional methods used in this work to determine the potential efficacy of riboflavin plus illumination inactivation process. The two are more complementary than comparable. The amplification inhibition approach clearly provides a molecular explanation for the functional culture results. The 1- to 2-log inhibition reflects the extent of the damage inflicted to the parasite genome but the complete blockade of parasite growth in vitro with 160 J/cm2 suggests 4- to 5-log functional inhibition. The apparent correlation between the two methods suggests a relation between them but extrapolating a direct relationship would require a considerable amount of experimental repetitions.

The results presented here suggest that a higher level of energy is required to inactivate malaria parasites in whole blood than the 80 J/mLRBCs shown to effectively inactivate mononuclear cells and bacteria. Irradiation of 120 J/mLRBCs would provide maximum P. falciparum inactivation according to the data presented here. However, such higher energy might increase the risk of damage to RBCs and be detrimental to their functionality after transfusion. Crude measurement of hemoglobin levels in plasma before and after riboflavin plus irradiation treatment did not show significantly different levels of RBC lysis,26 but further investigation of the viability of RBCs after treatment is warranted. P. falciparum in whole blood treated with riboflavin but without exposure to UV light grew normally and showed no evidence of genome damage, suggesting that although riboflavin may attach to the DNA it does not form adducts at high frequency without exposure to UV light.

TABLE 2. Summary of P. falciparum viability testing experiments*

Parasitemia treated Riboflavin (J/mLRBCs)Experiment (¥105 parasites/mL-1) No treatment Alone 40 80 120 160

1 (C) 1.71 X† X‡ X X2 (D) 1.25; 1.87 X X X X3 (E) 2.19 X§ X X X X X4 (F) 1.75 X X X|| X X|| X||5 (G) 2.80; 3.75 X X X X X6 (J¶) 2.50; 2.50 X X X X X X

* Deviations from the standard protocol are indicated in the footnotes. All experiments were performed in duplicate unless indicated.† X = treatment was included in this experiment.‡ Only a single culture treated with riboflavin without irradiation was tested.§ Only a single untreated control culture was received for testing.|| One replicate failed due to bacterial contamination.¶ Lower culture volumes used in this experiment only.

We deployed a specifically designed quantitative molecular assay based on the rationale that damage inflicted upon the parasite genome through adducts or breakage should be reflected by an inhibition of amplification which increased with the length of the amplicons targeted.16 As expected, it was found that the odds of a given strand of P. falciparum DNA being damaged increased with its length (Fig. 2) and the nested set of amplicons of different length provided good sensitivity for detection of genome damage under various conditions. We provide strong evidence of parasite genome amplification inhibition and showed dose–response relationships between the degree of genome damage and both amplicon length and total illumination energy. These data are compatible with the previous estimation that riboflavin plus irradiation treatment causes a DNA adduct insertion event every 245 to 1850 bp in human WBCs.23 Similarly, in Jurkat lymphocytes or bacteria, the percentage of DNA strands with damage increases with illumination energy, such that 90% of strands are damaged at 20 J/cm2 for bacteria.24 In the data presented here, Plasmodium proliferation was reduced but not completely ablated except at the highest levels of energy used (120 and 160 J/cm2) while for WBCs, complete inactivation was achieved at these energy levels.22,25 This difference might be related to the smaller size of the Plasmodium genome compared to lymphocytes and its lower degree of biologic complexity. Incomplete inactivation of Plasmodium in PLT preparations has previously been reported for another photochemical inactivation system (amotosalen).23

FIGURE 5. Relationship between duration of UV irradiation and time taken for recovery to 2% parasitemia in riboflavin plus irradiation–treated cultures of P. falciparum. Forty-six different parasite cultures contribute to the data presented. Recovery categories were derived as described in the text. Y-axis depicts the proportion of the total number of cultures in each test category. Nine of the cultures receiving 0 minutes irradiation did not have riboflavin added to the treated blood; the other nine cultures were supplemented with riboflavin.

20


One weakness in our study design is that, due to the large number of parallel parasite cultures being generated, we did not also test the effect on parasite viability of irradiation alone, without riboflavin addition. This should be explored in future work. The amplification inhibition methods developed here, particularly assays of the longest amplicons from the 16S RNA gene, would provide a sensitive and rapid efficacy endpoint for future clinical trials of photochemical inactivation in blood donations in malaria endemic settings.

Blood in endemic countries is usually not tested for malaria before transfusion3 and many of the diagnostic tests available, including microscopy and rapid antigen detection tests, are not sensitive enough to detect low levels of parasites that will still present a threat to blood recipients.7,27 In addition, should a more sensitive PCR assay be used for screening, a high prevalence of sub-patent parasitemia is likely to be detected in endemic countries. This would cause deferral of a substantial percentage of units, which would threaten maintenance of a lifesaving supply of blood, which is already in shortage in most African countries.6,27 Whole blood is the most frequently indicated and utilized blood product in Africa for treatment of massive bleeding in obstetrics and surgery.28

In such emergency circumstances, lack of transfusion is a clear cause of mortality29 that depends not only on the immediate availability of blood but also on its freshness and on the retention of essential clotting factors. The second most frequent indication for transfusion is acute malaria, particularly in children.30 Although WHO still indicates whole blood as adequate therapy in such circumstances, clinicians are likely prescribing concentrated RBCs to limit circulatory overload.31 Preliminary data indicate that safe RBCs can be prepared following photo-chemical treatment of whole blood to inactivate viruses,9 bacteria,10 T. cruzi,19 Leishmania,32 and WBCs.9,10 The data presented in this study show that Plasmodium inactivation can be added to this list, offering a possible solution to transfusion-transmitted malaria, an often neglected transfusion side effect.3

However, one weakness of our study was that an irradiation alone control was not tested here. Alternative strategies previously deployed in the past include presumptive addition of antimalarial drugs to whole blood units, although current combination drugs, which are effective against chloroquine-resistant parasites, such as artemether-lumefantrine and artesunate-amodiaquine would require administration directly into blood units of the active metabolite of each component, rather than the parent drugs, rendering this option expensive. It would be useful to compare the respective costs of pathogen reduction and antimalarial blood treatment. Systematic antimalarial prophylaxis, particularly in young children has been widely used in Africa as long as chloroquine was effective because of its low cost. Reducing the transfusion transmission of malaria in this way with combination antimalarials is widely considered economically unmanageable except in children below age 3 or 5 where the largest benefit is seen.21,30,31

In summary, we have shown using a quantitative molecular assay that photochemical treatment of P. falciparum–infected whole blood using the riboflavin plus irradiation system induced parasite genome damage and that inactivation of genome replication was more marked with longer target amplicons and with higher total irradiation energies. This dose response was reflected in viability testing in vitro, with the highest irradiation energies being significantly more effective at preventing parasite growth. This approach could be developed as a means to render whole blood donations safer in malaria endemic countries.

ACKnowlEdgMEnTSThe authors acknowledge the support of Drs Ray Goodrich and Shawn Keil for providing the riboflavin plus irradiation illuminator for whole blood and the training to use the instrument.

ConfliCT of inTERESTNone of the authors have any conflict of interest regarding this work.

REfEREnCES1. Alexandre MA, Ferreira CO, Siqueira AM, Magalhães BL, Mourão

MP, Lacerda MV, Alecrim M. Severe Plasmodium vivax malaria, Brazilian Amazon. Emerg Infect Dis 2010; 16:1611-4.

2. Rijken MJ, McGready R, Boel ME, Poespoprodjo R, Singh N, Syafruddin D, Rogerson S, Nosten F. Malaria in pregnancy in the Asia-Pacific region. Lancet Infect Dis 2012; 12:75-88.

3. Owusu-Ofori AK, Parry C, Bates I. Transfusion-transmitted malaria in countries where malaria is endemic: a review of the literature from sub-Saharan Africa. Clin Infect Dis 2010; 51:1192-8.

4. Bardaji A, Sigauque B, Sanz S, Maixenchs M, Ordi J, Aponte JJ, Mabunda S, Alonso PL, Menéndez C. Impact of malaria at the end of pregnancy on infant mortality and morbidity. J Infect Dis 2011; 203:691-9.

5. Nnaji GA, Ikechebelu JI, Okafor CI. A comparison of the prevalence of malaria parasitaemia in pregnant and non pregnant women. Niger J Med 2009; 18:47-51.

6. Allain JP. Malaria and transfusion: a neglected subject coming back to the forefront. Clin Infect Dis 2010; 51:1199-200.

7. Hassanpour G, Mohebali M, Raeisi A, Abolghasemi H, Zeraati H, Alipour M, Azizi E, Keshavarz H. Detection of malaria infection in blood transfusion: a comparative study among real-time PCR, rapid diagnostic test and microscopy: sensitivity of malaria detection methods in blood transfusion. Parasitol Res 2011; 108:1519-23.

8. Kitchen AD, Chiodini PL. Malaria and blood transfusion. Vox Sang 2006; 90:77-84.9. Marschner S, Goodrich R. Pathogen reduction technology

treatment of platelets, plasma and whole blood using riboflavin and UV light. Transfus Med Hemother 2011; 38:8-18.

10. Goodrich RP, Doane S, Reddy HL. Design and development of a method for the reduction of infectious pathogen load and inactivation of white blood cells in whole blood products. Biologicals 2010; 38:20-30.

11. Tonnetti L, Proctor MC, Reddy HL, Goodrich RP, Leiby DA. Evaluation of the Mirasol pathogen [corrected] reduction technology system against Babesia microti in apheresis platelets and plasma. Transfusion 2012; 50:1019-27.

12. Vanlandingham DL, Keil SD, Horne KM, Pyles R, Goodrich RP, Higgs S. Photochemical inactivation of chikungunya virus in plasma and platelets using the Mirasol pathogen reduction technology system. Transfusion 2012; 53:284-90.

13. Miltenyi S, Muller W, Weichel W, Radbruch A. High gradient magnetic cell separation with MACS. Cytometry 1990; 11:231-8.

14. Saeed M, Roeffen W, Alexander N, Drakeley CJ, Targett GA, Sutherland CJ. Plasmodium falciparum antigens on the surface of the gametocyte-infected erythrocyte. Plos ONE 2008; 3:e2280.

15. Staalsoe T, Giha HA, Dodoo D, Theander TG, Hviid L. Detection of antibodies to variant antigens on Plasmodium falciparum-infected erythrocytes by flow cytometry. Cytometry 1999; 35:329-36.

16. Allain JP, Hsu J, Pranmeth M, Hanson D, Stassinopoulos A, Fischetti L, Corash L, Lin L. Quantification of viral inactivation by photochemical treatment with amotosalen and UV A light, using a novel polymerase chain reaction inhibition method with preamplification. J Infect Dis 2006;194:1737- 44.

21


17. Padley DJ, Heath AB, Sutherland C, Chiodini PL, Baylis SA. Establishment of the 1st World Health Organization International

Standard for Plasmodium falciparum DNA for nucleic acid amplification technique (NAT)-based assays. Malar J 2008; 7:139.

18. Zavizion B, Pereira M, de Melo Jorge M, Serebryanik D, Mather TN, Chapman J, Miller NJ, Alford B, Bzik DJ, Purmal A. Inactivation of protozoan parasites in red blood cells using INACTINE PEN110 chemistry. Transfusion 2004; 44:731-8.

19. Tonnetti L, Thorp AM, Reddy HL, Keil SD, Goodrich RP, Leiby DA. Evaluating pathogen reduction of Trypanosoma cruzi with riboflavin and ultraviolet light for whole blood. Transfusion 2012;52:409-16.

20. Tonnetti L, Thorp AM, Reddy HL, Keil SD, Goodrich RP, Leiby DA. Riboflavin and ultraviolet light reduce the infectivity of Babesia microti in whole blood. Transfusion 2013; 53:860-7.

21. Grellier P, Benach J, Labaied M, Charneau S, Gil H, Mon- salve G, Alfonso R, Sawyer L, Lin L, Steiert M, Dupuis K. Photochemical inactivation with amotosalen and long- wavelength ultraviolet light of Plasmodium and Babesia in platelet and plasma components. Transfusion 2008; 48:1676-84.

22. Cardo LJ, Salata J, Mendez J, Reddy H, Goodrich R. Pathogen inactivation of Trypanosoma cruzi in plasma and platelet concentrates using riboflavin and ultraviolet light. Transfus Apher Sci 2007; 37:131-7.

23. Marschner S, Fast LD, Baldwin WM 3rd, Slichter SJ, Goodrich RP. White blood cell inactivation after treatment with riboflavin and ultraviolet light. Transfusion 2010; 50:2489-98.

24. Kumar V, Lockerbie O, Keil SD, Ruane PH, Platz MS, Martin CB, Ravanat JL, Cadet J, Goodrich RP. Riboflavin and UV-light based pathogen reduction: extent and consequence of DNA damage at the molecular level. Photochem Photobiol 2004; 80:15-21.

25. Fast LD, Nevola M, Tavares J, Reddy HL, Goodrich RP, Marchner S. Treatment of whole blood with riboflavin plus ultraviolet light, an alternative to gamma irradiation in the prevention of transfusion-associated graft-versus-host disease? Transfusion 2012; 53:373-81.

26. Cancelas JA, Rugg N, Fletcher D, Pratt PG, Worsham DN, Dunn SK, Marschner S, Reddy HL, Goodrich RP. In vivo viability of stored red blood cells derived from riboflavin plus ultraviolet light-treated whole blood. Transfusion 2011; 51:1460-8.

27. Freimanis G, Sedegah M, Owusu-Ofori S, Kumar S, Allain JP. Investigating the prevalence of transfusion transmission of Plasmodium within a hyperendemic blood donation system. Transfusion 2013; 53:1429-41.

28. Natukunda B, Schonewille H, Smit Sibinga CT. Assessment of the clinical transfusion practice at a regional referral hospital in Uganda. Transfus Med 2010;20:134-9.

29. Bates I, Chapotera GK, McKew S, van den Broek N. Maternal mortality in sub-Saharan Africa: the contribution of ineffective blood transfusion services. BJOG 2008;115:1331-9.

30. Lackritz EM, Hightower AW, Zucker JR, Ruebush TK 2nd, Onudi CO, Steketee RW, Were JB, Patrick E, Campbell CC. Longitudinal evaluation of severely anemic children in Kenya: the effect of transfusion on mortality and hematologic recovery. AIDS 1997;11:1487-94.

31. Maitland K, Pamba A, English M, Peshu N, Levin M, Marsh K, Newton CR. Pre-transfusion management of children with severe malarial anaemia: a randomised controlled trial of intravascular volume expansion. Br J Haematol 2005;128:393-400.

32. Jimenez-Marco T, Riera C, Fisa R, Fisa R, Girona-Llobera E, Sedeño M, Goodrich RP, Pujol A, Guillen C, Muncunill J. The utility of pathogen inactivation technology: a real-life example of Leishmania infantum inactivation in platelets from a donor with an asymptomatic infection. Blood Transfus 2012;10:536-41.

22


USING KNOWLEDGE OF BLOOD PRODUCTS TRANSFUSED to determine blood requirements for hospitals in rural and urban settings

SABT CONGRESS ABSTRACTSCAPE TOwN 2013

Mr. M Mutenherwa, Mr. T Mapako, D MvereNational Blood Services Zimbabwe

inTRodUCTionKnowledge of blood products transfused is vital in determining blood requirements for hospitals. The National Blood Service Zimbabwe (NBSZ) is a non-profit making company mandated by the Ministry of Health and Child welfare to provide safe blood and blood products. To date NBSZ doesn`t have an agreed method of determining an accurate estimate of blood needs in Zimbabwe. Hospitals also have no standard formula for determining their blood requirements to inform blood ordering patterns. A preliminary study was conducted to address this gap. The study aimed to investigate blood transfused and use the knowledge in determining blood requirements for two hospitals.

METhodSA retrospective study on the use of knowledge of blood products transfused to estimate the blood needs of one rural hospital and one urban hospital in Zimbabwe was carried out from 1st January 2013 to 30th April 2013. The data was collected from patient medical records and the blood bank register. A data collection tool was designed with the following details: hospital number, ward, age or date of birth, sex, haemoglobin concentration, clinical diagnosis, date of transfusion, blood component type, donor group, patient group, amount of blood transfused, transfusion not done because the blood was not available for transfusion at the hospital. The data collected was then transferred from hard copies by capturing it into excel spread sheet and analysed using Stata version 10.0 statistical package. Analysis was done on the blood supplies to the hospitals, clinical conditions transfused; blood group and component types transfused the haemoglobin concentration, ward, age and sex of the transfused patients. The Pan American Health Organization (PAHO) model formula was used to determine the actual, estimated future, projected future and the yearly blood requirement.

RESUlTSThe rural hospital transfused 45 units of red cell packed cells (PCs) during the period of the study. Neither fresh frozen plasma (FFP) nor platelets were transfused at the rural hospital during the study period. The urban hospital transfused 537 units of PCs, four platelets, and nine FFP during the first four months of 2013. The estimated 2013 blood requirement for the urban hospital was 1,764 PCs, 31 FFPs, and 19 platelets. The estimated 2013 blood requirement for the rural hospital was 149 PCs, no FFPs, and no platelets.

diSCUSSion And ConClUSionThe blood supply was 62 and 599 PCs to the rural and urban hospital respectively. Medical, surgical, obstetrics and gynaecological mainly anaemic patients aged eight months to 96 years were transfused ABO compatible blood with females being transfused more blood than males. The NBSZ can expand this research to gather further evidence for accurately estimating blood needs of Zimbabwe. The shortage of specialist doctors at the hospitals was a challenge in implementing the PAHO model and the classification of diseases wasn’t done according to the international classification of disease codes. Although complex it’s possible to estimate blood needs for Zimbabwe.

23


THE TRANSFUSION PRACTICES OF CLINICIANSin a regional hospital in durban in KwaZulu-natal

Dr. S NgcoboSouth African National Blood Service

inTRodUCTion And bACKgRoUndRed cell concentrates (RCC) transfusion is required to increase the oxygen carrying capacity of blood by raisinghaemoglobin (Hb) concentration in patients with acute or chronic anaemia. However there is a wide variability in the use of red cell concentrates that appears to reflect the clinicians individual practice rather than the patients clinical status. Even though there are guidelines on the use of blood and blood products, there is no consensus on the precise indications for their use.

objECTivES• To determine the extent to which the doctors at Prince Mshiyeni

Memorial Hospital (PMMH), a regional hospital do not adhere to the Clinical Guidelines for the Use of Blood Products in South Africa by assessing the prevalence of inappropriate RCC transfusion and the level of wastage.

• To evaluate the factors that influence the transfusion practices of clinicians at PMMH by assessing the knowledge and attitude with regards to blood transfusion.

METhodSThis was a two phase study.1. A retrospective cross sectional study was conducted from 01

August to 30 September 2012. A total of 308 consecutive patients case files from PMMH were reviewed. Data was collected using a data collection tool on age, gender, medical discipline, rank of the prescribing clinician, pretransfusion Haemoglobin (Hb). Descriptive statistics namely mean, standard deviation, median, mode and proportions were used to summarize results. Inappropriateness of RCC transfusion was assessed by using the Clinical Guidelines for the Use of Blood Products in South Africa 4th Edition 2008. Cross-matched: transfusion ratio (C: T ratio) was used to assess the level of wastage.

2. Phase 2 was a survey among 228 PMMH doctors to assess their knowledge and attitude regarding the prescribing of red cell concentrates transfusion. A pretested questionnaire was distributed to all 228 blood prescribing PMMH clinicians and 144 responded giving a response rate of 63.16%. The aggregate scores of knowledge and attitude were calculated from the responses. Kruskal-Wallis test was used to test if there was any relationship between rank of clinician and knowledge. The same test was also used to test for relationship between rank of the clinician and attitude.

RESUlTSAt this regional hospital the proportion of inappropriate use of RCC was 13.64%. The level of wastage was 14 units of RCC for every 100 units ordered (C: T was 1.17). Guidelines were not used by 60% of the doctors. Twenty five per cent of doctors had low level of knowledge on transfusion.

ConClUSionThe non-adherence by clinicians to National Clinical Guidelines, the inappropriate use of RCC, the 14% level of wastage and the 25% low level of knowledge by the clinicians at this regional hospital remain our concerns and would need to be addressed with extensive, orchestrated education

24


BLOOD TRANSFUSION AND INFORMED CONSENT at a Tertiary hospital in the Eastern Cape

Ms. K van den Berg1, E Murphy2,L Pretorius3, V Louw2

1. South African National Blood Service;2. UCSF; BSRI;3. UFS

bACKgRoUndThe concept of informed consent for medical treatment was introduced in South African law in section 12(2) of the Constitution, subsection 6(1)(c) of the National Health Act of 2003 as well as through case law. It is further underpinned by the Code of Ethics of the Health Professions Council of South Africa. Informed consent should address, inter alia, benefits and costs of the proposed intervention as well as risks, complications and potential alternatives. Blood transfusion if used appropriately, may be a life-saving procedure, reducing mortality and morbidity and improving quality of life, but is not without potentially serious, if not life-threatening risks, and as such requires documented informed consent from the proposed recipient. We evaluated the current practices regarding documenting informed consent for blood transfusion at a tertiary hospital in the Eastern Cape.

METhodSFor a study of blood transfusion and HIV, we conducted a retrospective audit and analysis of the hospital records of all patients admitted during a 3-month period at a tertiary hospital in the Eastern Cape. Patients receiving blood transfusions were identified from electronic reports generated by the local blood bank. The admission records (patients’ paper based hospital folders) were traced following the discharge of the patients. These records were manually reviewed and data were gathered on whether written informed consent was taken for blood transfusion and if so, whether the consent document was completed correctly. Where patients received more than one blood transfusion during a particular admission, we only assessed the data related to the first transfusion episode.

RESUlTS We assessed 212 first transfusion episodes. Patient admission records (patient folders) were untraceable for 10 (4.7%) transfusion episodes. Of the remaining 202 patient admission records, only 138 (65.1%) contained consent forms and of these, 38 (27.5%) were not completed correctly. Types of errors and omissions included failure to record the name of the clinician taking the consent, the name of the patient as well as failing to have the document correctly witnessed. In total 102 (48.1%) of patients either did not have consent forms in their records or the forms were completed incorrectly.

ConClUSionOver one third of patients assessed following the administration of a blood transfusion did not have properly documented informed consent in their hospital records. This would suggest a lack of understanding on the importance of documented informed consent on the part of both the prescribing clinicians as well as the nursing staff responsible for administering the blood transfusions. Several court cases in South Africa following the transmission of a transfusion transmissible infection such as HIV, centered on the alleged lack of informed consent having been obtained from the recipient. It is our recommendation that healthcare workers be sensitized to the need.

25


MOTIVATORS AND DETERRENTS TO BLOOD DONATION AMONG BLACK SOUTH AFRICANS:A Qualitative Analysis of Focus Group Data

Mr. R Reddy1 , M Omsted2, Dr. T Muthivhi3, M Sha2, Mr. T Mokoena1, V Raju2, K Mathavha4, B Russell4, Dr. E Bloch5, R Crookes3,E Murphy6

1. South African National Blood Service2. Research Triangle International3. South African National Blood Service4. Social Surveys Africa5 - Blood Systems Research Institute6 - University of California, San Francisco

bACKgRoUndThe South African National Blood Service (SANBS) collects 805,000 donations per annum from voluntary nonremunerated donors in South Africa, but maintaining an adequate inventory is challenging because majority Black donors give only a minority of donations. SANBS is therefore confronted with the challenge of establishing a sustainable and ethnically diverse donor pool with a key focus on recruitment and retention of Black donors. We performed a qualitative study to measure motivators and deterrents to blood donation among Black South Africans, and compare these findings to other international data.

METhodSProfessional moderators conducted 13 focus groups including a total of 97 Black South Africans (58 donors and 39 non-donors); participants were further stratified by age group and geographical location in the greater Johannesburg area. Professional focus group moderators explored key motivators and deterrents to blood donation. Video recordings and transcripts of the focus groups were classified with a coding scheme based upon the Bednall and Bove taxonomy of motivators and deterrents (Transfus Med Rev, 2011), with minor modification. Using NVivo 9 software (QSR International, Burlington, MA), mentions of each motivator or deterrent were counted and classified according to the coding scheme to allow a quantitative summary of the results, both for all subjects and stratified by donors and non-donor status.

RESUlTSAlthough most motivators and deterrents in this South African study have been described in the literature, the distribution of specific motivators differed from those in other countries. There were 463 unique mentions of motivators (362 by donors and 101 by non-donors), in descending order of frequency: promotional communications or marketing (28% of all mentions), incentives (20%) and prosocial motivation (16%, mainly altruism). Surprisingly, there were differences between donors and non-donors in mentions of prosocial motivation (14% vs. 25%, respectively) and incentives (18% vs 28%). Only 8% of donors and 1% of non-donors regarded convenience of collection site as a motivator. There were 376 mentions of deterrents (231 by donors and 145 by non-donors), in descending order of frequency: fear (41%), negative attitudes (14%) and lack of knowledge (10%). Fears were related to needles (11%), viral infection (5%), discovered illness (5%) and fainting (5%). Fear and negative attitudes were more commonly reported by non-donors compared to donors. Among negative attitudes, scepticism and cynicism were often related to perceived racial and economic discrimination in blood collection and allocation. Finally, 13% of the non-donor group perceived lack of donation eligibility for health reasons including both valid (low body weight, iron deficiency) and invalid (poor diet, medications) reasons.

ConClUSionIn contrast to Bednall and Boves findings, promotional communication was a more frequent motivator than incentives or prosocial motivation (altruism), and convenience ranked even lower. As reported by many authors, fear and lack of awareness were strong deterrents, but scepticism and cynicism engendered by perceived racial discrimination in blood collection were unique to the South African environment. These findings will be useful in designing and testing targeted donor marketing campaigns aimed at the Black South African population.

26


MONITORING HIV RESIDUAL RISK ANDBLOOD SAFETY IN SOUTH AFRICA – results from the analysis of SANBS data over a 6 year period

Charlotte Ingram, Karin van den Berg, Marion Vermeulen, Ronel SwanevelderSouth African National Blood Service

bACKgRoUndRecognising that the donor profile at the time was not sustainable, SANBS implemented nucleic amplification testing (NAT) in 2005. A strategy was adopted to increase the pool of younger & black donors. The strategy has been successful in changing the donor population profile to be more representative and sustainable. However, it should be noted that this also increased the HIV Residual risk. Prevalence rates in the donor population mirrors the background HIV prevalence in the antenatal and general populations where the younger and black populations have higher prevalence rates.

AiMSANBS continuously monitors several parameters to ensure the safest possible blood for the country. It is important for the risk to be communicated to clinicians & health care workers to ensure their patients are suitably informed of the risks. This analysis looked at current Residual Risk and the trend from 2006/7 to 2012/13.

METhodS The analysis in this study is based on the data extracted from the SANBS BI Database. SANBS uses the most sensitive testing strategy available for blood screening (IDNAT). The Ultrio Plus assay has a window period of 4-5 days for HIV, 21days for HBV and 3 days for HCV. The donor prevalence of HIV, HBV & HCV is continually monitored and policies governing blood safety reviewed annually. We use the Weusten model to calculate HIV residual risk on a quarterly basis & monitor trends.

RESUlTSIn 12/13 Year, SANBS collected 797623 units (of which 75% were from repeat donors), equating to 2200 units being tested daily. The theoretical risk of HIV transmission, based on Repeat donations (Weusten model (Ref)) is 1 in 85736 transfusions (assumption: 1 virion is the minimum infectious dose). In 2005 the risk aimed for was <1:100 000. With an assumed minimum infectious dose of 316 virions (thought to be more realistic), the estimated risk is 1 in 2.5million. The attached table shows the calculated risk remained less than 1 in 100000 until 2010 and increased from thereon onwards. The donor profile changed to include more black donors from 10.6% in 2006/7 to 32.3% in 2012/3. The HIV prevalence in the donor population increased from 0.11 to 0.21% but appears to have stabilised. Detailed demographics of the donor profile will be presented.

ConClUSion & RECoMMEndATionLatest available laboratory tests do not close the window period. The increasing trend noted in the HIV Residual risk is of concern but is continuously monitored. The safety of the blood supply is ultimately determined by multiple interventions i.e. the donor selection strategies, laboratory testing strategies, hierarchical blood issuing & releasing policy and appropriate use of blood. Continuous surveillance & adaptation of strategies to mitigate the risk such as focusing on retaining existing donors to reduce the overall prevalence are high priority in maintaining a safe blood supply.

27


A CASE STUDY: discordant results between nAT and serology indicating contamination of sample and its subsequent resolution

Mr. R Cable, Mrs. C PistoriusWestern Province Blood Transfusion Service (WPBTS)

bACKgRoUndNucleic Acid Testing (NAT) plays an important role in screening donated blood for specific infectious markers because it is a very sensitive method of testing. However due its sensitivity, contamination remains a major concern when handling samples for testing.

METhodIndex donation was tested on Tigris analyser (NAT) and Prism analyser (serology) for routine markers. . The index donation sample (IDs) was found initially reactive (IR) on Tigris and as per WPBTS NAT algorithm the donation was retested in duplicate and three Discriminatory Assays were performed.

RESUlTSThe IDs was negative for all routine markers on Prism but was Ultrio Plus repeat reactive and discriminatory positive for Hepatitis B (HBV). The IDs was sent to an external Reference Laboratory, and the following results were obtained:• HBV viral load of 157 copies/mL• Liver Function Tests (LFT), within normal ranges except for

slightly lower values for S-Albumin and S-Alkaline Phosphatase.• Negative HBV antibody results.While this discordancy does not occur often, it was not unusual. Donor appeared to be in the HBV serological window period.As per WPBTS testing algorithm, whenever discordant results are obtained between NAT and serology, the plasma bag is retested. The plasma bag was negative for NAT and serology, including all HBV antibody tests. At the clinic where the donation occurred, 14 of the donors, who were O+ and were bled at approximately the same time, were found negative for the routine screens.

The Paternity Laboratory at WPBTS tested 15 DNA markers that showed conclusively that blood from the IDs and the plasma bag, came from the same donor. DNA testing has subsequently shown that the sample from the donors latest donation genetically matched the sample from the index donation.

Index donation was bled on 11 January 2013. Previous donation was on 9 November 2012 and it was negative. Samples were taken from the donor thrice after the index donation (25th January, 1st February and 3rd May 2013) and all results were negative. LFTs on two of the follow-up donations were within normal ranges except for slightly raised levels for S-Globulin.

diSCUSSionDNA markers ruled out concerns about a possible donor mismatch between IDs and paperwork. This appeared to be a case of contamination. This was the only positive sample in the entire run and it was situated in the middle of the run, away from Calibrators and controls.

The most obvious explanation is that somehow the sample was contaminated.

What this case has proven however is the importance of testing the plasma bag whenever discordant results between serology and NAT are observed. WPBTS has also introduced retesting the other 2 samples taken at donation (used for Blood Grouping and on the Prism) whenever discordant results are observed.Donor has since been reinstated.

28


TRANSFUSION-TRANSMITTED MALARIA in the western Cape

Mrs. C Sims, Mrs. T Paarman, Dr. J MakanWestern Province Blood Transfusion Service (WPBTS)

bACKgRoUndWestern Province Blood Transfusion Service is situated in the non-endemic malaria province of the Western Cape. Transfusion Transmitted Malaria (TTM) is uncommon in the Western Cape with only two cases of transfusion transmitted Plasmodium falciparum malaria having been reported between 2001 and 2010. In 2010 Plasmodium falciparum malaria was transmitted via a platelet transfusion donated by a donor from Democratic Republic of Congo. The donor had resided in South Africa for three years and was asymptomatic at the time of donation but had a low level parisitaemia detected on malaria PCR and thin smear.

METhodThis case prompted a review of malaria deferral policies in the transfusion services in South Africa. In June 2012 a new malaria policy was introduced which defers donors who have grown up in a malaria area for a three year period after leaving the malaria area. These donors will then be deferred for a further three years after each visit to any malaria endemic area.

RESUlTSIn December 2012, despite the new deferral criteria, it was reported that an 81 year old female patient with unexplained febrile illness had tested positive for Plasmodium malariae on PCR testing. The patient had received two red cell concentrates in October 2012 during surgery for insertion of arterial shunts. The donors of the red cell concentrates were identified from transfusion records, counselled and tested for malaria using PCR technique, malaria antigen testing and malaria smears.

One donor tested positive on malaria PCR testing and Plasmodium malariae was identified. He had left Nigeria, his country of origin, in 2007 at the age of 18. The donor had not travelled to any malaria endemic areas since 2007, he gave no history of malaria and was asymptomatic at the time of the index donation. He was asymptomatic at the time of interview.

ConClUSionWith an increase in travel into malaria endemic areas and greater population movement from malaria endemic countries, it is important to regularly review deferral strategies and ensure that policies are consistent and accurately applied. Any deferral strategy should aim to minimise the risk of TTM without the unnecessary exclusion of donors.

Is it time to consider laboratory screening of donors for malaria in the Western Cape? As current malaria testing is not sufficiently sensitive for blood donation screening this could have a negative impact on the donor base. Whatever strategy is adopted there remains a small risk of TTM as people infected with Plasmodium malariae and Plasmodium falciparum may remain asymptomatic carriers longer than the three year deferral period. Malaria must always be considered in any patient with unexplained febrile illnesses post transfusion.

29


FOLLOW UP OF HIV POSITIVE DONORS WHO COME FOR COUNSELLING - did we miss any risk factors

Dr. S Ngcobo, Dr. C Ingram, Dr. T MuthivhiSouth African National Blood Service

bACKgRoUndSouth African National Blood Service (SANBS) collects approximately 800 000 donations annually. Selection of voluntary donors who are at low risk of transfusion transmitted viral infection (TTVI) is central in maintaining the safety of the blood supply. SANBS has many safeguards from donor recruitment, collection, testing, processing and hierarchical/quarantine issuing to ensure a national safe blood supply. The pre - donation evaluation consists of a self administered written questionnaire, followed by a confidential interview with a nurse counselor. Evaluation of the effectiveness of the selection process has not been done in South Africa. Such investigation of the process may offer opportunities to further improve transfusion safety.

AiMThe aim of the analysis is to assess the prevalence of HIV risk factors among the HIV positive donors who came for counselling at SANBS.

METhodologYThis analysis is based on the retrospective review of 308 donor records from donors that tested HIV positive after donating blood and availed themselves for HIV counseling at SANBS.

RESUlTSBetween 1 January and 30 June 2012, 657 donors were found to be HIV positive and 308 (47%) were counselled at SANBS. Of these, 127 (48%) had identifiable risky behavior that were missed by the donor questionnaire, as compared to 158 (51.3%) with no identifiable risk behavior. The rates of disclosure of risk factors by donors with TTVIs differ by gender, race, and by province. Having more than one sex partner was identified as the most common risk factor.

ConClUSionDespite both donor education and clear implemented selection criteria, more than half of positive donors subsequently disclosed risk factors that would have resulted in deferral if reported in pre-donation screening.

30


GENERAL INFORMATION AfRiCA SoCiETY foR blood TRAnSfUSion

AngolaiseLuzia Dias

nEw MEMbER joining AfSbT

Editor-in-Chief Adewuyi Banji (Nigeria) French Editor Tagny Tayou Claude (Cameroon) Production Editor Raman Leesha (South Africa)

Editors and Reviewers:Anani Ludovic (Benin) Ansah Justina (Ghana) Boukef Kamel (Tunisia) Chama David (Zambia)

globAl blood fUnd

Global blood Fund (GBF) is a US-based charity that promotes and supports voluntary, non-remunerated blood donation and aims to make sure that blood collectors around the world have the resources they need to ensure safe, sufficient blood for patients.

GBF recognized that blood centres in North America and Europe routinely dispose of usable equipment. These items, which are in good condition, can however be used to advantage by blood services in Africa. GBF recognises that the donors of equipment may not know which African blood services could benefit from this equipment. Also, potential recipients do not know what equipment is available. To facilitate the communication between donors and recipients of equipment GBF has created EqXchange.

EqXchange is a free-to-use, online portal that makes it possible for:• Donors to register equipment or services they would like to donate to in-need blood services. • Registered users to view what is available and request that the equipment be donated to their blood transfusion service.• Blood collectors in Africa to post their needs for review by better-resourced services. This can be equipment, but requests for technical

expertise can also be made. It is a way for developing blood services to get support from blood banking experts across all disciplines.

The link takes you through to the EqXchange portal where there is further information and the opportunity to register. If you do have any queries, please contact [email protected]

EdiToRiAl boARd of ThE AfRiCA SAngUinE

Eggington John (United Kingdom) Garraud Olivier (France)Kajja Isaac (Uganda) Knight Robin (United Kingdom)

Lefrere Jean Jacques (France) Needs Malcolm (United Kingdom) Tapko Jean-Baptiste (Cameroon) Thurgood Tracy (United Kingdom) Williams Mark (United Kingdom)

31



AAbb infoRMATion ExTRACTEd fRoM AAbb wEbSiTE

AABB MembershipAny individual interested in or actively involved in transfusion medicine and cellular therapies is eligible for individual membership. To view the benefits of AABB membership http://www.aabb.org/about/join/Pages/individual.aspx

AABB Programmes• Information on data collection and analysis activities, including biovigilance and blood utilization; • Cellular therapies, which details the association’s services for facilities involved with hematopoietic progenitor cells and other cell therapy

products; • Consulting services, a division of AABB that provides managerial and technical assistance to facilities worldwide; • Disaster response, which provides background on activities and resources intended to help facilities be better prepared in the event of a

disaster or pandemic affecting the blood supply;• National Blood Exchange, a resource-sharing program; • National Blood Foundation, which raises funds to support research and education.

AABB publicationshttp://www.aabb.org/Pages/Marketplace.aspx

AABB SmartBrief link (free sign up) http://www.aabb.org/resources/publications/Pages/smartbrief.aspx

ACKnowlEdgEMEnTSAfSBT acknowledges with gratitude the support of the National Bioproducts Institute in covering the cost of production of the journal, Africa Sanguine.

diSClAiMERThe AfSBT and Editors cannot be held responsible for errors or any consequences arising from the use of information contained in this journal; the view and opinions expressed do not necessarily reflect those of the AfSBT and Editors, neither does the publication of advertisements constitute any endorsement by the AfSBT and Editors of the products advertised.

32


Submissions for consideration may include original scientific articles (which will be peer reviewed), short reports, letters to the Editor, reviews, congress proceedings, and reprints of published articles (with permission).

oRiginAl SCiEnTifiC woRK MUST MEET ThE following REqUiREMEnTS:

1. Be a report of original study by the Author(s)

2. Be written in English or French

3. Not have been published elsewhere or submitted to another Journal for publication. If submission had been presented as a Conference Abstract or paper, which must be acknowledged. It must not have been published as full article in the Proceedings

4. The Title page must show the names of all Authors, followed by Institutional affiliations in lower font, with superscript Arab numerals to identify Authors. The main or corresponding Author must be indicated, and contact details including e-mail, and telephone number provided where applicable. A short running Title, and 3-5 Keywords should be provided on the Title page.

5. A structured ABSTRACT of not more than 250 words must be provided under the following subheadings:a. Background/Introductionb. Aims and Objectivesc. Study design / Materials and Methodsd. Resultse. Conclusion.

Letters to the Editor and Brief Reports do not require Abstracts, and will be published at the discretion of the Editor.

6. The Manuscript should not exceed 10,000 words, including Tables and Figures. The formatting requirements of the text are: Font Arial, size 10. Abbreviations in the text must be preceded by full expression of the term(s) the first time of appearance, followed by the abbreviation in parenthesis. Standard abbreviations and units of measurement must be used wherever applicable. Tables and Figures must be kept simple, with Titles above and Legends below. The same data should be represented by either a Table or a Figure as preferred by the Author, not both.

7. References must be checked for accuracy by the author(s), and be fully indexed. References, which must be in the Vancouver style, must be represented by super-script Arab numerals in the text, and be listed in the order of appearance, after the Conclusion. Where there are many Authors in the Reference, at least the first three must be listed fully, before the use of the words ‘et al’. Commas should be used to separate Authors’ names, without full stops between or after initials, except at the end.

Examples of References:a. Egah DZ, Banwat EB, Audu ES, Iya D, Mandong BM, Anele AA, et

al. Hepatitis B surface antigen, hepatitis C and HIV antibodies in a low-risk blood donor group in Nigeria. East Mediterr Health J. 2007;13:961-6

b. Ferrera C, Monet D. Clinical Use of Blood. 2e ed. Paris: Lockt Blackwell, 1997.

c. Beide ET Indications for Fresh Frozen Plasma, In: Fererra C, Monet D. Clinical Use of Blood 2e ed, Paris: Lockt Blackwell, 1997: p 1-15

d. Telly G Blood donor in Africa In: ISBT, State of the Art Lectures XXIIIrd Congress of the ISBT, Basel, Karger, 1994, p25-6.

8. Report of research on human subjects must comply with the principles of the Declaration of Helsinki (1964), and must include evidence of ethical approval by the Authorities of the Institution or Country. Evidence or statement must also be shown of informed consent of the Subjects. The Editors reserve the right to reject any submission with questionable ethical justification. Views expressed in a published article belong to the Authors, and the Journal will not be held responsible.

9. Evidence must be provided of the consent of all Authors to publish submissions in Africa Sanguine.

10. Production of ManuscriptsManuscripts should be produced in Microsoft Word format. Basic text should be used, and complex formatting avoided, especially in Tables and Figures. Manuscripts should be easy to update/change to comply with the formatting of the Journal. Authors must provide the entire manuscript in a single submission.

11. Manuscripts should be submitted to the Editor-in-Chief, and/or the Production Editor as an attachment to email.


CONTRIBUTION GUIDELINES: instructions to Authors

33


GUIDE POUR CONTRIBUTION instructions aux Auteurs

Les soumissions de manuscrits pour publication peuvent être des travaux scientifiques originaux (qui seront relu par les pairs), des courtes notes, des lettres à l’éditeur, des revues, des présentations de congrès, des rééditions d’articles publiés (avec permission).

lES TRAvAUx SCiEnTifiqUES oRiginAUx doivEnT REMpliR lES CondiTionS SUivAnTES :

1. Etre un rapport d’un travail original par l(es) Auteur(s)

2. Etre écrit en français ou en anglais

3. N’avoir pas été publié dans un journal ou soumis dans un autre pour publication. Si la soumission avait été présentée comme un abstract ou un papier au cours d’une conférence, elle ne doit pas avoir été publiée comme un article entier

4. La page Titre doit montrer le nom de tous les Auteurs, suivie par les affiliations institutionnelles en petits caractères, avec des chiffres arabes en exposant pour identifier les Auteurs. L’Auteur principal ou correspondant doit être indiqué, et les détails de son contact dont l’email, le numéro de téléphone fournis lorsque disponibles. Un court Titre et 3-5 Mots clés devraient figurer sur la page Titre.

5. Un ABSTRACT structuré de moins de 250 mots doit être fourni et comporter les sous-titres suivants :a. Contexte/Introductionb. But et objectifsc. Type d’étude, matériels et méthodesd. Résultatse. Conclusions. Les lettres à l’éditeur et des courtes notes ne requièrent pas

d’abstracts, et seront publiées à la discrétion de l’éditeur.

6. Le manuscrit ne doit pas dépasser 10.000 mots y compris les tables et figures. Les exigences de formatage du texte sont : Arial, taille 10. Les abréviations dans le texte doivent être précédées par une expression complète des termes lors de leur première apparition, suivie par l’abréviation entre parenthèses. Les abréviations standards et les unités de mesure doivent être utilisées quand c’est nécessaire. Les tables et figures doivent être simples, avec les titres au dessus et les légendes en dessous. Les mêmes données devront être représentées soit dans la table, soit dans la figure selon la préférence de l’Auteur mais pas dans les deux.

7. Les références doivent être vérifiées correctement par les Auteurs et être entièrement indexées. Les références, qui doivent être dans le style Vancouver, doivent être représentées dans le texte par un chiffre arabe en exposant, et être listées dans leur ordre d’apparition, après la conclusion. Lorsqu’il ya plusieurs Auteurs dans la référence, au moins les 3 premiers doivent être listés entièrement avant l’utilisation des mots “et al”. Les virgules devront être utilisées pour séparer les noms des Auteurs, sans les points entre et après les initiales, sauf à la fin. Exemples de Références:a. Egah DZ, Banwat EB, Audu ES, Iya D, Mandong BM, Anele

AA, et al. Hepatitis B surface antigen, hepatitis C and HIV antibodies in a low-risk blood donor group in Nigeria. East Mediterr Health J. 2007;13:961-6

b. Ferrera C, Monet D. Clinical Use of Blood. 2e ed. Paris: Lockt Blackwell, 1997.

c. Beide ET Indications for Fresh Frozen Plasma, In: Fererra C, Monet D. Clinical Use of Blood 2e ed, Paris: Lockt Blackwell, 1997: p 1-15

d. Telly G Blood donor in Africa In: ISBT, State of the Art Lectures XXIIIrd Congress of the ISBT, Basel, Karger, 1994, p25-6.

Contact details for all Submissions and Correspondence

For more details visit website: www.afsbt.org

Prof Banji ADEwUYI, Editor-in-Chief, (Nigeria)Email: [email protected] +2348037135170

Mrs leesha RAMAn, Production Editor (South Africa)C/O National Bioproducts InstitutePrivate Bag X9043 Pinetown 3600Republic of South Africa.Email: [email protected]

dr Claude Tayou TAgnY, French Editor (Cameroon)Faculty of Medicine and Biomedical Sciences, University of YaoundeP.O. Box 4806 Yaounde CAMEROONEmail: [email protected]

http://www.afsbt.org

34


8. Le rapport de la recherche sur les humains doit correspondre aux principes de la Déclaration d’Helsinki (1964), et doit inclure une évidence d’approbation éthique par les autorités de l’institution ou du pays. Une évidence ou une déclaration doit également être apportée sur le consentement éclairé des Sujets. Les éditeurs se réservent le droit de rejeter toute soumission avec justification éthique douteuse. Les opinions exprimées dans un article publié appartiennent aux Auteurs, et le journal ne sera pas tenu pour responsable.

9. La preuve doit être fournie sur le consentement de tous les Auteurs pour les contributions à publier dans Africa Sanguine

10. la production de Manuscrits Les manuscrits doivent être produits au format Microsoft

Word. Le texte de base doit être utilisé, et la mise en forme complexe doit être évitée, en particulier dans les tableaux et figures. Les manuscrits doivent être faciles à mettre à jour, à modifier pour se conformer à la mise en forme de la Revue. Les Auteurs doivent fournir l’ensemble du manuscrit en un seul envoi.

11. Les manuscrits doivent être adressés aux éditeurs, et / ou le directeur de la production dont les adresses se trouvent ci-dessous.

détails de contact pour toute soumission ou correspondance

Pour plus de détails, visiter le site web: www.afsbt.org

Prof Banji ADEwUYI, Editeur en Chef (Nigeria)Email: [email protected]: +2348037135170

Mrs Leesha RAMAN, Editeur chargée de la production (République d’Afrique du Sud)C/O National Bioproducts InstitutePrivate bag X9043, Pinetown, 3600République d’Afrique du [email protected]

Dr Claude Tayou TAGNY, Editeur de langue française (Cameroun)Faculty of Medicine and Biomedical Sciences, Université de Yaoundé [email protected]

http://www.afsbt.org

mailto:[email protected]



Documents

AFRICA SOCIETY FOR BLOOD TRANSFUSION · AFRICA SOCIETY FOR BLOOD TRANSFUSION NPC Registation number: 2011/008414/08 Private Bag X9043, Pinetown, 3600, ... Ansah Justina, Bates Imelda