Upload
cielo-shabatura
View
228
Download
4
Embed Size (px)
DESCRIPTION
This journal is a peer reviewed scientific forum for the latest advancements in bacteriology research on a wide range of topics including food safety, food microbiology, gut microbiology, biofuels, bioremediation, environmental microbiology, fermentation, probiotics, and veterinary microbiology.
Citation preview
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 79
Sooyoun Ahn University of Florida, USA
Walid Q. AlaliUniversity of Georgia, USA
Kenneth M. Bischoff NCAUR, USDA-ARS, USA
Claudia S. Dunkley University of Georgia, USA
Lawrence GoodridgeColorado State University, USA
Leluo GuanUniversity of Alberta, Canada
Joshua GurtlerERRC, USDA-ARS, USA
Yong D. HangCornell University, USA
Divya JaroniOklahoma State University, USA
Weihong Jiang Shanghai Institute for Biol. Sciences, P.R. China
Michael JohnsonUniversity of Arkansas, USA
Timothy KellyEast Carolina University, USA
William R. KenealyMascoma Corporation, USA
Hae-Yeong Kim Kyung Hee University, South Korea
W.K. KimUniversity of Manitoba, Canada
M.B. KirkhamKansas State University, USA
Todd KostmanUniversity of Wisconsin, Oshkosh, USA
Y.M. Kwon University of Arkansas, USA
Maria Luz Sanz MuriasInstituto de Quimica Organic General, Spain
Melanie R. MormileMissouri University of Science and Tech., USA
Rama NannapaneniMississippi State University, USA
Jack A. Neal, Jr.University of Houston, USA
Benedict OkekeAuburn University at Montgomery, USA
John PattersonPurdue University, USA
Toni Poole FFSRU, USDA-ARS, USA
Marcos RostagnoLBRU, USDA-ARS, USA
Roni ShapiraHebrew University of Jerusalem, Israel
Kalidas ShettyUniversity of Massachusetts, USA
EDITORIAL BOARD
80 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
EDITOR-IN-CHIEFSteven C. RickeUniversity of Arkansas, USA
EDITORSTodd R. CallawayFFSRU, USADA-ARS, USA
Cesar CompadreUniversity of Arkansas for Medical Sciences, USA
Philip G. CrandallUniversity of Arkansas, USA
MANAGING EDITOR
Dave EdmarkFayetteville, AR
LAYOUT EDITOREllen J. Van LooGhent, Belgium
TECHNICAL EDITORJessica C. ShabaturaEureka Springs Arkansas, USA
ONLINE EDITION EDITORC.S. ShabaturaEureka Springs Arkansas, USA
ABOUT THIS PUBLICATION
Agriculture, Food & Analytical Bacteriology (ISSN
2159-8967) is published quarterly, beginning with
this inaugural issue.
Instructions for Authors may be obtained at the
back of this issue, or online via our website at
www.afabjournal.com
Manuscripts: All correspondence regarding pend-
ing manuscripts should be addressed Ellen Van Loo,
Managing Editor, Agriculture, Food & Analytical
Bacteriology: [email protected]
Information for Potential Editors: If you are interested
in becoming a part of our editorial board, please con-
tact Editor-in-chef, Steven Ricke, Agriculture, Food &
Analytical Bacteriology: [email protected]
Advertising: If you are interested in advertising with
our journal, please contact us at advertising@afab-
journal.com for a media kit and current rates.
Reprint Permission: Correspondence regarding re-
prints should be addressed Ellen Van Loo, Managing
Editor, Agriculture, Food & Analytical Bacteriology
Ordering Print Copies: print editions of this journal
may be purchased and shipped internationally from
our website order form at www.afabjournal.com
Subscription Rates: Subscriptions are not available
at this time. To be advised when subscriptions plans
are made available, please join our newsletter at
www.afabjournal.com
Mailing Address: 2138 Revere Place . Fayetteville, AR . 72701 Website: www.AFABjournal.com
EDITORIAL STAFF
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 81
TABLE OF CONTENTS
Influence on Growth Conditions and Sugar Substrate on Sugar Phosphorylation Activity in Acetogenic BacteriaW. Jiang, R.S. Pinder, and J.A. Patterson
94
A Membrane Filtration Method for Determining Minimum Inhibitory Concentrations of Essential OilsS. J. Pendleton, R. Story, C. A. O’Bryan, P. G. Crandall, S. C. Ricke, and L. Goodridge
88
Effect of Fertilization on Phytase and Acid Phosphatase Activities in Wheat and Barley Cultivated in Bulgaria
V. I. Chalova, I. Manolov, M. Nikolova, and L. Koleva
103
Transfer of Tylosin Resistance Between Enterococcus spp. During Continuous-Flow Culture of Feral or Domestic Porcine Gut Microbes N. Ramlachan, R.C. Anderson, K. Andrews, R.B. Harvey, and D.J. Nisbet
111
Sugar Recovery from the Pretreatment/Enzymatic Hydrolysis of High and Low Specific Gravity Poplar ClonesA. C. Djioleu, A. Arora, E. M. Martin, J. A. Smith, M. H. Pelkki, and D. J. Carrier
121
Culture dependent molecular analysis of bacterial community of Hazaribagh tannery exposed area in BangladeshA. A. Maruf, M. M. Moosa, S. M. M. Rashid, H. Khan, and S. Yeasmin
132
ARTICLES
Evaluation of an Experimental Sodium Chlorate Product, With and WithoutNitroethane, on Salmonella in Cull Dairy CattleN. A. Krueger, T. S. Edrington, R. L. Farrow, R. Hagevoort, R. C. Anderson, G. H. Loneragan,
T. R. Callaway, and D. J. Nisbet
82
BRIEF COMMUNICATIONS
Instructions for Authors149
Introduction to Authors
The publishers do not warrant the accuracy of the articles in this journal, nor any views or opinions by their authors.
Impact of By-product Feedstuffs on Escherichia coli O157:H7 and Salmonella Typhimurium in Pure and Mixed Ruminal and Fecal Culture in VitroT. R. Callaway, S. Block, K. J. Genovese, R. C. Anderson, R. B. Harvey, and D. J. Nisbet
139
82 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
www.afabjournal.comCopyright © 2012
Agriculture, Food and Analytical Bacteriology
ABSTRACT
Ruminant animals are natural reservoirs for Salmonella. These bacteria can reduce nitrate to nitrite
through the membrane bound enzyme nitrate reductase which also has the ability to reduce chlorate to
the cytotoxic end-product chlorite. An experimental product containing sodium chlorate (ECP) has been
investigated in recent years as a pre-harvest food safety strategy to reduce Salmonella. The addition of ni-
troethane has been shown to enhance the effectiveness of ECP. The objective of this research was to deter-
mine if feeding ECP, with and without nitroethane, is effective in reducing naturally occurring populations
of Salmonella in cull dairy cattle on a commercial dairy prior to slaughter. Twelve cull dairy cows, dosed
for two consecutive days with either 140 mg of ECP containing 30% sodium chlorate /kg BW/d or with 70
mg of the ECP plus 160 mg nitroethane /kg BW/d, were sampled 48 h post initial dose at 12 h intervals for
Salmonella via fecal samples. Upon completion of the 48 h sampling animals were necropsied and gastro
intestinal tissue and luminal content samples taken for bacterial enumeration. The data presented herein
support the use of chlorate as a pre-harvest intervention strategy for reducing Salmonella in cull dairy cows
prior to entering the food chain can serve as an effective means of reducing these bacteria.
Keywords: Sodium Chlorate product, Salmonella, nitroethane, cull dairy cattle
InTRoduCTIon
According to the Centers for Disease Control and
Correspondence:Thomas S. [email protected]: +1 979-260-3757 Fax: +1 979-260-9332
Prevention, approximately 48 million people get sick
each year from foodborne diseases in the United
States (CDC 2010). The bovine gastrointestinal tract
is a well recognized reservoir for bacterial patho-
gens like Escherichia coli O157:H7, Salmonella and
Campylobacter. In the United States these bacterial
BRIEF COMMUNICATIONS
Evaluation of an Experimental Sodium Chlorate Product, With and Without Nitroethane, on Salmonella in Cull Dairy Cattle †
N. A. Krueger1, T. S. Edrington1, R. L. Farrow1, R. Hagevoort2, R. C. Anderson1, G. H. Loneragan3, T. R. Callaway1 and D. J. Nisbet1
1 United States Department of Agriculture, Agriculture Research Service, Southern Plains Agriculture Research Center, Food and Feed Safety Research Unit, 2881 F&B Road, College Station, TX 77845 USA.
2 Agriculture Experiment Station, New Mexico State University, Clovis, NM 88101-9998 USA.3Department of Animal and Food Sciences, Texas Tech University, PO Box 42141, Lubbock, Texas 79409-2141 USA.
† Mention of trade name, proprietary product, or specific equipment does not constitute a guarantee or warrenty by the USDA and does not imply its approval to the exclusion of other products that may be suitable.
Agric. Food Anal. Bacteriol. 2:82-87, 2012
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 83
pathogens are responsible for more than 3.5 million
human infections annually at an estimated annual
cost of more than $3.5 billion a year (ERS/USDA,
2009). According to Wells and others (Wells et al.,
2001), as many as 66% of the cull dairy cows have
detectable amounts of Salmonella shedding, and
these cull cows contribute substantially to the beef
supply, especially ground beef. Thus, pre-harvest
intervention strategies that reduce the shedding of
food-borne pathogens in cull dairy cattle are essen-
tial to reducing the amount of pathogenic bacteria
entering slaughter facilities and contributing to con-
tamination of food products and potentially human
infections.
Certain bacteria, such as Salmonella have the abil-
ity to reduce nitrate to nitrite through the intracel-
lular enzymes nitrate reductases (NarA and NarZ)
(Alaboudi 1982; Moreno-Vivia et al., 1999). It has
been suggested that the NarA enzyme, which is
expressed under anaerobic conditions, is primary a
contributor to the reduction of nitrate to nitrite (An-
derson et al., 2006a). However, the NarZ enzyme can
account for approximately 10% the nitrate reduc-
tase activity (Anderson et al., 2006a). Furthermore,
these reductase enzymes have the ability to also re-
duce chlorate to the cytotoxic end-product chlorite
(Stewart 1988, Fox et al., 2005 and Moreno-Vivia et
al., 1999). In recent years, chlorate supplementation
has been investigated as a pre-harvest food safety
strategy to reduce Salmonella and E. coli O157:H7
in vitro and in food producing animals (Anderson et
al., 2000). Research also has demonstrated effects
against Salmonella in swine and poultry (Anderson
et al., 2001; Anderson et al., 2004; Burkey et al., 2004)
but to date the effect on Salmonella in cattle has not
been evaluated. Research has shown that the addi-
tion of short chained nitro compounds like nitroeth-
ane can enhance the ability of sodium chlorate to
reduce Salmonella as much as ten-fold in vitro and in
vivo (Anderson et al., 2006a & 2006b). The objectives
of the current research was to determine if feeding
an experimental sodium chlorate product, with and
without nitroethane, is effective in reducing popula-
tions of Salmonella, in cull dairy cattle on a commer-
cial dairy prior to slaughter.
MATeRIAlS And MeThodS
All cattle were obtained from a conventional com-
mercial dairy in the Southern High Plains of the Unit-
ed States and were cared for according to guidelines
pre-approved for by the Southern Plains Agriculture
Research Center’s Animal Care and Use Committee
(ACUC no. 2010005). Dairy cows that were sent to
the hospital pen per the dairy’s standard operating
procedures were prescreened for Salmonella. The
dairy’s hospital pens are used to house animals that
were truly “sick” animals as well as animals that were
needing to be separated from the rest of the herd,
due to significant loss in milk production, laminitis,
mobility issues, etc., which classified them as poten-
tial candidates to be culled from the herd per the
discretion of the herd manager and standard operat-
ing procedures. Cows were restrained in self-locking
head stalls and approximately 30 g of fecal mate-
rial was obtained via rectal palpation. Fecal samples
were shipped on ice to the Food and Feed Safety
Research Unit in College Station, TX, USA (FFSRU)
for culture of Salmonella the following day. Five days
post-pre screen sampling, animals confirmed as Sal-
monella positive were enrolled. Twelve lactating Hol-
stein dairy cows (average BW 545 kg) testing positive
for Salmonella were purchased from the dairy and six
animals were randomly assigned to each treatment
(chlorate or chlorate + nitroethane). All experimental
animals remained on the dairy and were housed in
a pen separate from the rest of the herd; otherwise
all feeding and management schemes were as nor-
mal for the dairy. As all experimental animals were
housed together in the same pen, cross contamina-
tion among animals was a possibility. However, in
the production setting, culled animals are exposed
to other potential carriers throughout their time up
to slaughter. Therefore we felt that co-mingling in a
pen would give a more “real-world” test of the ex-
perimental treatment.
Salmonella positive animals received either 140
mg of an experimental sodium chlorate product
(ECP)/kg BW/d or 70mg ECP plus 160 mg nitroeth-
ane/kg BW/d. Based on previous research (Anderson
et al., 2006a), a sub optimal dose of ECP with added
84 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
nitroethane enhanced the bactericidal effects of the
ECP against Salmonella. The ECP was a proprietary
product provided by EKA Chemicals Inc. (Marrietta,
GA) and contained 30% sodium chlorate by weight.
Nitroethane was administered in the form of nitro-
ethane salt (Majak et al., 1986). Treatments were ad-
ministered 4 times at 12 h intervals via stomach tube.
Animals were restrained in headstalls in the A.M. ac-
cording to the dairy’s standard operation, and for the
P.M. dose animals were moved to a chute for proper
head restraint. Treatments were mixed with approxi-
mately 100 mL of water just prior to dosing to allow
for adequate volume and fluidity for passage through
the stomach tube. Each treatment was then followed
with approximately 100 mL of water, prior to removal
of the stomach tube, to remove any treatment that
might have adhered to the stomach tube during dos-
ing. Fecal grab samples were collected immediately
prior to first dosing and subsequently every 12 h for
the next 48 h post initial dosing. Following the last
fecal collection animals were euthanized accord-
ing to the American Veterinary Medical Association
guidelines on euthanasia. Luminal contents and tis-
sues from the rumen, small intestine, cecum, spiral
colon and rectum were aseptically collected upon
necropsy. All samples were shipped daily on ice to
the FFSRU for quantitative and qualitative bacterial
culture.
Fecal and luminal contents were processed upon
arrival for qualitative and quantitative analysis of Sal-
monella (Edrington et al., 2009). Serogrouping of Sal-
monella-positive samples was conducted using slide
agglutination with Salmonella antiserum (Becton,
Dickinson, Sparks, ND). Sample Salmonella popu-
lations were quantified by direct plating of the TSB
phosphate ⁄ sample mixture (10 g sample + 90 mL
TSB; prior to enrichment) onto XLD agar (Oxoid, LTD,
Basingstoke, Hampshire, England) using a commer-
cially available spiral plater (Spiral Biotech Autoplate
4000; Advanced Instruments, Inc., Norwood, MA),
with a limit of detection of 1.99X102 CFU/g. Plates
were incubated overnight at 37°C. Colonies were
counted and concentrations calculated. Morphologi-
cally typical (black) colonies were confirmed as Sal-
Table 1. Effect of ECP on Salmonella presence in enriched and direct plated feces over time and tissues at necropsy. A number represents the results of the direct plating (quantitative culture) expressed as cfu (log10/g feces), whereas a positive or negative symbol indicates a negative result from spiral plating and either a positive or negative result following enrichment and culture of the sample (qualitative culture).
Animal ID
10310 11875 11271 4705 4630 5773
pre-screen, d -5 + + + + 4.96 6.20
Time, (h)0 + + + + + +12 + + + - + +24 - - - - - +36 - - - + - +48 - + - - + +
Tissue site
Cecum - - - - - +Spiral colon - - - - - +Small intestine + - - - 4.88 -Rumen - - - - - -Rectum - - - - - +
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 85
monella as described above and counted.
ReSulTS And dISCuSSIon
The scope of this experiment was to evaluate the
effects of ECP with and without nitroethane on fe-
cal shedding of Salmonella in cull dairy cows. The
experiment was performed on the farm to ensure
that daily farm practices and feeding regimes were
employed in an effort to accurately simulate on-
farm application of the ECP and ECP + nitroethane
products. Two animals in the ECP treatment group
were shedding Salmonella at high concentrations at
the time of pre-screening (Table 1). Figure 1 dem-
onstrates the ability of ECP to effectively reduce (5
log10 cfu/g feces) Salmonella fecal shedding concen-
tration in animals colonized with high concentrations
of Salmonella. The remaining animals were positive
for Salmonella following enrichment at pre-screen-
ing (Tables 1 and 2). Forty-eight hours post initial
treatment with ECP all animals were negative for
Salmonella via spiral plating and only 50% of the ani-
mals had any detectable amount of Salmonella from
enriched samples (Table 1). The ECP + nitroethane
treatment resulted in all animals testing negative
for Salmonella via spiral plating and only 33% of the
animals had any detectable amount of Salmonella
from enriched samples (Table 2). Luminal contents
yielded no detectable Salmonella via direct plating
for all animals regardless of treatment except animal
4630, which had 4.88 log10 CFU’s present in the small
intestine. All other sites for this animal were nega-
tive via spiral plating. One colony from each positive
sample was serogrouped, of which 32, 25, 18, 17, 5,
and 3 % were K, E1, C1, poly A-I, C2, and I respectively.
We recognize that there are potential criticisms
associated with the current research. The lack of
control animals in this study can beg the question as
to whether there was an effect due to the ECP or a
natural response in cattle that have been shedding
for several days. As with any experimental research
product, federal approval must be obtained before
animals can enter the food chain or rendering pro-
cess, and since ECP is still awaiting federal approval
all animals were required to be purchased from the
dairy. Upon termination of the study, animals were
composted on the dairy to prevent entrance to the
food or rendering chain. Additionally, due to the as-
sociated cost and welfare issues we did not utilize
control animals. The authors recognize this is a weak-
ness of the study but did not have funding required
to euthanize six perfectly healthy animals that could
otherwise be sold by the dairy. By selecting animals
that were persistently and consistently shedding Sal-
monella for five days prior to initial dosing with the
0
1
2
3
4
5
6
0 12 24 36 48
Log
10
CF
U g
-1
Time, h
Cow 4630
Cow 5773
Figure 1. Effect of ECP supplementation on Salmonella concentrations in feces over time through direct plating.
86 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
experimental treatments, there was a high likelihood
that the response seen once experimental treat-
ments were imposed would be due to the effects of
the experimental treatments. Granted, in hindsight it
would have been beneficial to have control animals
that provided fecal samples even if they were not
necropsied. However, extensive research by the au-
thors has repeatedly demonstrated the sporadic na-
ture of fecal shedding of Salmonella in dairy cattle.
Therefore we felt that luminal populations through-
out the digestive tract would be a better indication
of the actual “Salmonella status” of the animal and
be a better determinant of the effectiveness of the
treatments examined in this research. While we rec-
ognize that further experimentation is needed, the
data presented herein while not conclusive does
support the idea of using chlorate as a pre-harvest
intervention in cull dairy cattle.
ConCluSIonS
Administration of ECP on farm immediately fol-
lowing the decision to cull and prior to shipping
should allow adequate time for the chlorate to exert
its lethal effect on Salmonella prior to the animal en-
tering the abattoir. While the ECP did not kill 100%
of the cultured Salmonella, it did appear to reduce
populations in the high shedders to levels that are
effectively controlled by modern processing inter-
vention strategies. It is unknown why the nitroethane
did not enhance the bactericidal effect of chlorate
in this research as has been observed previously.
Further investigation is needed and research should
examine the effectiveness of on-farm ECP adminis-
tration by following cull animals through the harvest
process.
ACknowledgeMenTS
This project was funded in part, by beef and veal
producers and importers through their $1-per-head
checkoff and was produced for the Cattlemen’s Beef
Board and state beef councils by the National Cat-
tlemen’s Beef Association.
RefeRenCeS
Alaboudi, A. R. 1982. Microbiological studies of ni-
trate and nitrite reduction in the ovine rumen.
Ph.D. dissertation. University of Saskatchewan, SK,
Canada.
Table 2. Effect of ECP with added nitroethane on Salmonella presence in feces over time and for luminal tissues at necropsy following enrichment and culture (qualitative culture).
Animal ID16487 86 7986 4907 6415 5538
pre-screen, d -5 + + + + + +Time, (h)
0 + - + + + +12 - - - + - -24 - + - - - -36 + - + - + +48 - - + - - +
Tissue site
Cecum - - - - - -Spiral colon - - - - - -Small intestine - - + - - -Rumen + - - + + +
Rectum + - + + - -
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 87
Anderson, R. C., S. A. Buckley, L. F. Kubena, L. H.
Stanker, R. B. Harvey, and D. J. Nisbet. 2000. Bacte-
ricidal effect of sodium chlorate on Escherichia coli
O157:H7 and Salmonella typhimurium DT104 in ru-
men contents in vitro. J. Food Prot. 63:1038-1042.
Anderson, R. C., S. A. Buckley, T. R. Callaway, K. J.
Genovese, L. F. Kubena, R. B. Harvey, and D. J. Nis-
bet. 2001. Effect of sodium chlorate on Salmonella
Typhimurium concentrations in the weaned pig
gut. J. Food Prot. 64:255-258.
Anderson, R. C., M. E. Hume, K. J. Genovese, T. R.
Callaway, Y. S. Jung, T. S. Edrington, T. L. Poole, R. B.
Harvey, K. M. Bishoff, and D. J. Nisbet. 2004. Effect
of drinking-water administration of experimental
chlorate ion preparations on Salmonella enterica
serovar Typhimurium colonization in weaned and
finished pigs. Vet. Res. Comm. 28:179-189.
Anderson, R. C., Y. S. Jung, K. J. Genovese, J. L.
McReynolds, T. R. Callaway, T. S. Edrington, R. B.
Harvey, and D. J. Nisbet. 2006a. Low level nitrate
or nitroethane preconditioning enhances the bac-
tericidal effect of suboptimal experimental chlo-
rate treatment against Escherichia coli and Sal-
monella Typhimurium but not Campylobacter in
swine. Foodborne Path. Dis. 3:461-465.
Anderson, R. C., Y. S. Jung, C. E. Oliver, S. M. Hor-
rocks, K. J. Genovese, R. B. Harvey, T. R. Callaway,
T. S. Edrington, and D. J. Nisbet. 2006b. Effects of
nitrate or nitro supplementation on Salmonella en-
teric serovar Typhimurium and Escherichia coli in
swine feces. J. Food Prot. 70:308-315.
Burkey, T. E., S. S. Dritz, J. C. Nietfeld, B. J. John-
son, J. E. Minton. 2004. Effect of dietary mannano-
ligosaccharide and sodium chlorate on the growth
performance, acute-phase response, and bacterial
shedding of weaned pigs challenged with Salmo-
nella enterica serotype Typhimurium. J. Anim. Sci.
82:397-404.
Center for Disease Control and Prevention. 2010.
CDC Reports 1 in 6 Get Sick from Foodborne Ill-
nesses Each Year. http://cdc.gov/media/press-
rel/2010/r101215.html, accessed October 4, 2011.
Edrington, T. S., B. H. Carter, T. H. Friend, G. R. Ha-
gevoort, T. L. Poole, T. R. Callaway, R. C. Anderson,
D. J. Nisbet. 2009. Influence of sprinklers, used to
alleviate heat stress, on faecal shedding of E. coli
O157:H7 and Salmonella and antimicrobial suscep-
tibility of Salmonella and Enterococcus in lactating
dairy cattle. Lett Appl Microbiol. 48:738–743.
ERS/USDA data foodborne illness cost calculator.
Available at: http://www.ers.usda.gov/data/food-
borneillness. Accessed 23 June 2009.
Fox, J. T., R. C. Anderson, G. E. Carstens, R. K. Miller,
Y. S. Jung, J. L. McReynolds, T. R. Callaway, T. S.
Edrington, and D. J. Nisbet. 2005. Effect of nitrate
adaption on the bactericidal activity of an experi-
mental chlorate product against Escherichia coli in
cattle. Int. J. Appl. Res.Vet. Med. 3:76-80.
Majak, W., K.-J. Cheng, J. W. Hall. 1986. Enhanced
degradation of 3-nitropropanol by ruminal micro-
organisms. J. Anim. Sci. 62:1072-1080.
Moreno-Vivia´n C., P. Cabello, M. Martı´nez-Luque, R.
Blasco, F. Castillo. 1999. Prokaryoticnitrate reduc-
tion: molecular properties and functional distinc-
tion among bacterial nitrate reductases. J. Bacte-
riol. 181:6573–84.
Stewart, V. 1988. Nitrate respiration in relation to fac-
ultative metabolism in enterobacteria. Microbiol.
Rev. 52:190-232.
Wells, S. J., P. J. Fedorka-Cray, D. A. Dargatz, K. Fer-
ris, A. Green. 2001. Fecal shedding of Salmonella
spp. by dairy cows on farm and cull cow markets. J.
Food. Prot. 64:3-11.
88 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
www.afabjournal.comCopyright © 2012
Agriculture, Food and Analytical Bacteriology
ABSTRACT
Minimum inhibitory concentrations (MICs) of essential oils are commonly determined via broth dilution
method. These methods very rarely include a neutralization step, due to the complex nature of essential
oils and thus difficulties in finding an adequate neutralizer, which leads to the potential for continued action
of the oil on the bacteria during growth analysis. This study was devised to evaluate filtration as a means
to remove an essential oil, cold pressed terpeneless Valencia orange oil, from several species of bacteria,
and thus prevent further antibacterial action by the oil. A ninety-six well microtiter plate method was used,
followed by transfer of well contents to a ninety-six well filter plate. The contents of the filter plate were
washed twice to separate the oil from the bacteria. The bacteria were resuspended in a medium contain-
ing a growth indicator and transferred to a sterile 96 well microtiter plate to determine MICs. Escherichia
coli O157:H7 was inhibited at a concentration of 0.5±0.0%, Listeria monocytogenes at 0.5±0.0%, Staphy-
lococcus aureus at 0.31±0.13%, Salmonella Typhimurium at 0.31±0.13%, Shigella sonnei at 0.75±0.29%,
Yersinia enterocolitica at 0.31±0.13%, Enterococcus faecalis at 0.63±0.25%, Bacillus cereus at 0.44±0.13%,
and Pseudomonas aeruginosa exhibited complete resistance to the oil.
Keywords: Escherichia coli, Salmonella, Shigella, Yersinia, Enterococcus, Bacillus, Pseudomonas,
minimal inhibitory concentration, essential oil, membrane filtration
InTRoduCTIon
The main methods for determining minimum in-
hibitory concentrations (MICs) and minimum bacte-
ricidal concentrations (MBCs) of essential oils and
Correspondence: P. G. Crandall, [email protected] Tel: +1-479-575-7686
essential oil components are broth dilution, agar
diffusion, and disc diffusion (Fernandez-Lopez et al.,
2005; Friedly et al., 2009; Kim et al., 1995a,b; Kubo
et al., 2004; Nannapaneni et al., 2008; Tassou et al.,
2000). These methods for determining MICs or MBCs
do not commonly employ a neutralization step.
However, if no neutralization step is used when con-
ducting antimicrobial studies on surfaces or in food
BRIEF COMMUNICATIONA Membrane Filtration Method for Determining
Minimum Inhibitory Concentrations of Essential Oils
S. J. Pendleton1,3, R. Story1, C. A. O’Bryan1, P. G. Crandall1, S. C. Ricke1, L. Goodridge2
1 Center for Food Safety-IFSE and Food Science Department, 2650 Young Ave., University of Arkansas, Fayetteville, AR 72704
2Department of Animal Sciences, Colorado State University, Fort Collins, CO 80523-11713Current address: Food Science and Technology, University of Tennessee, Knoxville, Tennessee 37996
Agric. Food Anal. Bacteriol. 2:88-93, 2012
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 89
matrices, the compounds being tested are still act-
ing on the bacteria when initial dilutions are made. In
order to determine the real effect of an antimicrobial
on a bacterium, neutralizers are frequently used to
inactivate the antimicrobial compound (Atwal et al.,
2010; Dey and Engley, 1983; Meers and Churcher,
1974). Essential oils are complex mixtures of differ-
ent compounds (Burt et al., 2005; Kubo et al., 2004;
O’Bryan et al., 2008), and currently used neutralizing
broths may not be suitable for use with these essen-
tial oils.
Meers and Churcher (1974) and Prince et al. (1975),
investigated the use of membrane filters to remove
antimicrobial compounds. Meers and Churcher
(1974) used a membrane to filter volumes of treated
cells in order to separate out the cells from antimicro-
bial drug treatments. The filters were washed, then
placed on agar, and incubated for 24 hours. Plates
were then counted to determine viable cells. Prince
et al. (1975) used a different approach. Cells were
first placed on the membrane and then exposed
to a disinfectant treatment for two and half or eight
minutes. The disinfectant was then filtered away and
the membrane was washed. The membrane was
then transferred to agar and incubated for 24 to 48
hours, after which counts were made to determine
antibacterial activity. Both techniques found that the
antimicrobial compounds were able to be effectively
removed from the cells via membrane filtration.
Membrane filtration offers the ability to remove
antibacterial compounds without the need for neu-
tralizers, especially when an adequate neutralizer is
not available (1). This aspect of membrane filtration
indicates its promise for the use of studying essential
oil antimicrobial activity. Therefore, the aim of this
study was to evaluate the efficacy of membrane fil-
tration in the determination of minimum inhibitory
concentrations for cold pressed terpeneless Valen-
cia orange oil against several species of bacteria.
MATeRIAlS And MeThodS
Essential oil
Commercially available cold pressed terpeneless
Valencia orange oil was obtained from Firmenich
(Lakeland, FL). Composition of this oil can be found
in Nannapaneni et al. (2009). The initial oil suspen-
sion was made by adding 0.2 mL of cold pressed ter-
peneless Valencia orange oil to 10 ml of tryptic soy
broth with 0.5% yeast extract (TSBYE) and 50 µL of
Tween 20 (Griffin et al., 2000; Kim et al., 1995a,b; Lin
et al., 2010) in a 10 ml centrifuge tube, giving 2% oil
and 0.5% (v/v) Tween 20 concentration.
Bacterial strains and growth
Nine bacterial strains from the culture collection
of the University of Arkansas Center for Food Safety
were used for this study: Escherichia coli O157:H7
(ATCC 43888), Listeria monocytogenes (USFDA),
Staphylococcus aureus (ATCC 25923), Salmonella
Typhimurium (ATCC 14028), Shigella sonnei (ATCC
25931), Yersinia enterocolitica (ATCC 23715), Entero-
coccus faecalis (ATCC 29212), Bacillus cereus (ATCC
11778), and Pseudomonas aeruginosa (ATCC 27853).
Cultures were grown in 10 mL of TSBYE in a 15 ml
centrifuge tube and incubated (GCA/Precision Scien-
tific, model 6M) at 37°C without shaking for 24 hours.
The cultures were then centrifuged (Damon,IEC Di-
vision, Needham, MA) at Relative Centrifugal Force
(RCF) = 4700 to 8500 x g for 10 min. The supernatant
was poured off and the pellet was resuspended in 10
ml of 20 mM PBS. A second wash was performed and
the final pellet was resuspended in TSBYE + 0.5%
Tween 20 and diluted to give resulting bacterial con-
centrations of approximately 106 CFU/mL.
Minimal inhibitory concentration
Two hundred µL of the oil suspension was added
into the first wells (column 1) of a sterile, 96 well tis-
sue culture plate. In the following wells (columns 2
through 6) 100 µL of TSBYE and 0.5% Tween 20 was
added to each well. With a multichannel pipette,
100 µL of oil in the first wells was transferred into the
second wells for a 1:2 dilution and followed by addi-
tional 1:2 dilutions. The final oil concentrations were
1%, 0.5, 0.25, 0.13, 0.063, and 0.03 (v/v). For nega-
90 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
tive controls, 100 µL of TSBYE and 0.5% Tween 20
was added to row G, to bring final volumes up to
200 µL. In triplicate, 100 µL of each 106 culture was
added to the various concentrations of oil (Figure
1.). An adhesive plate film (PlateMax: Axyseal Seal-
ing Film, pre-sterilized cat# PCR-SP) was placed over
the wells, and pressed down by hand. The plate was
incubated (New Brunswick Scientific, model # G-25)
for 24 hrs at 37°C with shaking at 200 rpm.
Filtration method
After incubation, 25 µL from each well was trans-
ferred into a matching sterile, 96 well filter plate
(0.2 um PVDF membrane, Corning, prod.# 3504). To
each well in the filter plate, 100 µL of TSBYE + 0.5%
Tween 20 was added. A sterile 96 well plate lid was
placed on the filter plate. The filter plate was then
placed on the collection plate (Corning, 0.5 ml, prod.
#3956) and centrifuged (Beckman TJ-6 centrifuge) at
RCF = 739 x g for 10 min. After centrifugation, 100
µL of TSBYE + 0.5% Tween 20 was added to each
well of the filter plate and then centrifuged again.
After centrifugation, 200 µL of TSBYE + 1% triphenyl
tetrazolium chloride (TTC) were added to each well
of the filter plate. With a multichannel pipette, the
contents of each well were gently mixed and trans-
ferred to a matching sterile 96 well plate. The plate
was statically incubated at 37°C for 48 hrs. The wells
were then visually checked for growth via develop-
ment of red pigment. Wells with the lowest oil con-
centration having no red pigment were considered
the MIC. The experiment was repeated four times.
ReSulTS And dISCuSSIon
The results of the minimum inhibitory concentra-
tion determinations can be found in Table 1. Cold
pressed terpeneless Valencia orange oil exacted
MICs of 0.5%, 0.5%, 0.31%, and 0.31% against E.
coli O157:H7, L. monocytogenes, S. aureus, and
S.Typhimurium, respectively. MICs of 0.75%, 0.31%,
0.63%, and 0.44% were exacted against S. sonnei,
Y. enterocolitica, E. faecalis, and B. cereus, respec-
tively. P. aeruginosa exhibited complete resistance
to the highest concentration of the oil.
Prior studies have evaluated the effects of cold
Figure 1. 96-well microtiter plate design for MICs with cold pressed terpeneless Valencia orange oil concentrations in percentages.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 91
pressed terpeneless Valencia orange oil against dif-
ferent bacteria using non-membrane filtration tech-
niques (Friedly et al., 2009; Nannapeneni et al., 2008;
O’Bryan et al., 2008). Friedly et al. (2009) examined
the effect of the essential oil on strains of L. mono-
cytogenes and Listeria innocua. It was determined
that the oil exhibited a MIC of 0.55% against both
L. monocytogenes and L. innocua after 18 hours of
incubation at 37°C. This result is very similar to the
result found in the current study, indicating that the
antibacterial inhibition of L. monocytogenes by the
oil does not continue after 18 hours of incubation at
37°C. O’Bryan et al. (2008) determined the antibac-
terial effect of the oil against strains of Salmonella,
including a strain of S. Typhimurium (Copenhagen).
Cold pressed terpeneless Valencia orange oil ex-
hibited little effect on the strain of S. Typhimurium
tested. The zone of inhibition determined by disc
diffusion was only 7.3±1.2 mm, which included the
6 mm paper disc. The results of the current study
do not agree with this lack of antibacterial activity
against S. Typhimurium. This could possibly be due
to differences between strains of Typhimurium, al-
though further research is needed to confirm this
hypothesis. Nannapaneni et al. (2008) examined the
ability of cold pressed terpeneless Valencia orange
oil to inhibit the growth of E. coli O157:H7 strains.
The oil, tested by disc diffusion, produced a zone of
inhibition against E. coli O157:H7 (ATCC 43888) of
11.5±0.7 mm. It is not stated in the study if the in-
hibition zone includes the paper disc, but even if it
does, the oil exhibited a much higher inhibition of E.
coli O157:H7 (ATCC 43888) than S. Typhimurium (Co-
penhagen). This result is contradicted by the current
study, in which both E. coli O157:H7 (ATCC 43888)
and S. Typhimurium were found to be inhibited at
the same concentration. The contrast in results could
be due to the difference in methods used to deter-
mine antibacterial susceptibility, as well as a differ-
ence in strains of S. Typhimurium. The current study
used a micro-broth dilution method, while the other
studies used disc diffusion methods. The activity of
cold pressed terpeneless Valencia orange oil possi-
bly could be increased in a broth medium, although
further study is needed to elicit an answer.
The responses of the other bacteria to cold
pressed terpeneless Valencia orange oil have not
been previously determined. Therefore, it is not pos-
sible to compare the results of this study to others. It
can be said that the current method was able to elicit
Table 1. Minimum inhibitory concentrations of cold pressed Valencia orange oil for 9 bacterial strains at 37°C.
Bacterial Strain MIC (%)
E. coli O157:H7 0.5
L. monocytogenes 0.5
S. aureus 0.31
S. Typhimurium 0.31
S. sonnei 0.75
Y. enterocolitica 0.31
E. faecalis 0.63
B. cereus 0.44
P. aeruginosa >10
92 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
MICs for all other bacteria tested, except P. aerugi-
nosa. The inability to determine an MIC for P. aeru-
ginosa is most likely due to its inherent resistance to
essential oil components (Cox and Markham, 2007).
Cox and Markham (2007), found that P. aeruginosa
NCTC 9027 and 6749 were tolerant of 6 of 8 essential
oil components. Only cinnamaldehyde and carvacrol
showed any inhibition of the bacteria. It was deter-
mined that these bacteria contained an active efflux
mechanism, which allows them to resist the antibac-
terial effects of many essential oil components.
ConCluSIonS
The current method tested was able to produce
reliable MICs, but was unable to indicate the need
for membrane filtration in the MIC determinations
of essential oils. The MICs determined in this study
were either similar to those found by traditional
methods, or lower than those found by traditional
methods. These results are contrary to that of the
original hypothesis: MICs should be lower in tradi-
tional methods due to residual inhibition by essen-
tial oils. Replication of these results, as well as side
by side comparison of methods is needed to confirm
this conclusion.
RefeRenCeS
Atwal, R., S. John, and S. Turcios. 2010. In vitro an-
timicrobial activity assessment of Zymox® topical
cream against methicillin resistant Staphylococcus
aureus (MRSA). Int. J. Appl. Res. Vet. Med. 8: 51-52.
Bergan, T., and A. Lystad. 1972. Evaluation of disin-
fectant inactivators. Acta Path. Microbiol. Scand.
Sect. B 80:507-510.
Burt, S.A., R. Vlielander, H. P. Haagsman, and E.J.A.
Veldhuizen. 2005. Increase in activity of essential
oil components carvacrol and thymol against Esch-
erichia coli O157:H7 by addition of food stabiliz-
ers. J. Food Prot. 68:919-926.
Cox, S.D., and J.L. Markham. 2007. Susceptibility and
intrinsic tolerance of Pseudomonas aeruginosa to
selected plant volatile compounds. J. Appl. Micro-
biol. 103:930-936.
Dey, B.P., and F.B. Engley. 1983. Methodology for
recovery of chemically treated Staphylococcus au-
reus with neutralizing medium. Appl. Environ. Mi-
crobiol. 45: 1533-1537.
Fernandez-Lopez, J., N. Zhi, L. Aleson-Carbonell,
J.A. Perez-Alvarez, and V. Kuri. 2005. Antioxidant
and antibacterial activities of natural extracts: ap-
plication in beef meatballs. Meat Sci. 69:371-380.
Friedly, E.C., P.G. Crandall, S.C. Ricke, M. Roman,
C.A. O’Bryan, and V.I. Chalova. 2009. In vitro antil-
isterial effects of citrus oil fractions in combination
with organic acids. J. Food Sci. 74:M67-72.
Griffin, S. G., J. L. Markham, and D. N. Leach. 2010.
An agar dilution method for the determination of
the minimum inhibitory concentration of essential
oils. J. Essential Oil Res. 12: 249-255.
Kim, J. M., M. R. Marshall, J. A. Cornell, J. F. Pres-
ton, and C. I. Wei. 1995a. Antibacterial activity of
carvacrol, citral, and geraniol against Salmonella
typhimurium in culture medium and on fish cubes.
J. Food Sci. 60: 1364-1368, 1374.
Kim, J., M.R. Marshall, and C. Wei. 1995b. Antibac-
terial activity of some essential oil components
against five foodborne pathogens. J. Agric. Food
Chem. 43:2839-2845.
Kubo, I., K.I. Fujita, A. Kubo, K.I. Nihel, and T. Ogura.
2004. Antibacterial activity of coriander volatile
compounds against Salmonella choleraesuis. J.
Agric. Food Chem. 52:3329-3332.
Lin, C. M., S. R. Sheu, S. C., and Y. H. Tsai. 2010. De-
termination of bactericidal efficacy of essential oil
extracted from orange peel on the food contact
surfaces. Food Control. 21: 1710-1715.
Meers, P. D., and G.M. Churcher. 1974. Membrane
filtration in the study of antimicrobial drugs. J. Clin.
Path. 27: 288-291.
Nannapaneni, R., A. Muthaiyan, P.G. Crandall, M.G.
Johnson, C.A. O’Bryan, V.I. Chalova, T.R. Calla-
way, J.A. Carroll, J.D. Arthington, D.J. Nisbet, and
S.C. Ricke. 2008. Antimicrobial activity of com-
mercial citrus-based natural extracts against Esch-
erichia coli O157:H7 isolates and mutant strains.
Foodborne Path. Dis. 5:695-699.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 93
Nannapaneni, R., V. I. Chalova, P. G. Crandall, S. C.
Ricke, M. G. Johnson, and C. A. O’Bryan. 2009.
Campylobacter and Arcobacter species sensitivity
to commercial orange oil fractions. Int. J. Food Mi-
crobiol. 129: 43-49.
O’Bryan, C.A., P.G. Crandall, V.I. Chalova, and S.C.
Ricke. 2008. Orange essential oils antimicrobial
activities against Salmonella spp. J. Food Sci.
73:M264-267.
Prince, J., C.E.A. Deverill, and G.A.J. Ayliffe. 1975. A
membrane filter method for testing disinfectants.
J. Clin. Path. 28:71-76.
Tassou, C., K. Koutsoumanis, and G.J.E. Nychas.
2000. Inhibition of Salmonella enteritidis and
Staphylococcus aureus in nutrient broth by mint
essential oil. Food Res. Int. 33:273-280.
94 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
www.afabjournal.comCopyright © 2012
Agriculture, Food and Analytical Bacteriology
ABSTRACT
Four acetogenic bacteria isolates (designated as A2, A4, A10 and H3HH) were tested for phosphoenol-
pyruvate (PEP) and ATP-dependent phosphorylation of glucose and 2-deoxy-glucose. Although all organ-
isms had detectable phosphorylation activity, substantial variation existed in the rates of both PEP- and
ATP-dependent phosphorylation. Isolate A10 had the highest rate of PEP- dependent phosphorylation
(net rate of 11.62 nM per mg protein per min). Isolate A10 as well as isolates A2 and H3HH most likely
have a glucose phosphotransferase system (PTS). In contrast, isolate A4 had PEP-dependent glucose
phosphorylation rates very similar to control rates, suggesting the lack of PTS activity. These results were
confirmed by PEP dependent 2-deoxyglucose phosphorylation data. The rates of ATP-dependent glucose
phosphorylation were higher than PEP-dependent glucose dependent in all organisms surveyed. How-
ever, substantial variation existed for ATP-dependent glucose phosphorylation rates. The glucose PTS
of isolates A10 and H3HH were induced by the presence of extracellular glucose. Moreover, the specific
activity of the glucose PTS of both isolates increased as cultures progressed from the early log to late log
phase of growth. ATP- and PEP-dependent maltose and sucrose phosphorylation was detected in isolates
A10 and H3HH. Although activity was detected in both isolates (A10 and H3HH), the rate of activity varied
considerably, depending on the sugar and organism tested.
Keywords: Acetogenic bacteria, phosphoenolpyruvate (PEP), ATP-dependent phosphorylation,
glucose, 2-deoxy-glucose, rumen, acetate
InTRoduCTIon
The key to survival in a particular ecosystem (such
as the rumen) is the ability to adapt to changes of the
Correspondence: John Patterson [email protected] Tel: +1 -765-494-4826 Fax: +1-765-494-9347
ecosystem. Uptake of nutrients is a determinant of
the success of bacteria in the natural environments
(Matin and Veldkamp, 1978). Therefore, the ability
of an organism to adapt its sugar transport systems
to the prevailing conditions of its environment is es-
sential for its survival. The second objective was to
determine the effects of growth conditions (i.e en-
Influence on Growth Conditions and Sugar Substrate on Sugar Phosphorylation Activity in Acetogenic Bacteria
W. Jiang1, 2, R.S. Pinder2 ,3, and J.A. Patterson2*
1Current address: Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology Shanghai Institutes for Biological Sciences Chinese Academy of Sciences
2Department of Animal Sciences, Purdue University. West Lafayette, IN 479073Current address: 7855 South 600 East, Brownsburg, IN 46112
Agric. Food Anal. Bacteriol. 2:94-102, 2012
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 95
ergy source, stage of growth and presence of other
sugars) on the phosphorylating activity of acetogen-
ic bacteria. These PTS are capable of translocating
glucose, maltose and sucrose and are induced by
the presence of carbohydrates.
Because of the uniqueness and potential for utili-
zation of the Wood pathway (Ragsdale, 1991), much
of the attention focused on acetogens has concen-
trated on characteristics of this pathway. Conse-
quently, relatively little information is known about
other metabolic systems in these organisms. Al-
though acetogenic organisms are capable of utiliz-
ing sugars, the mechanisms responsible for uptake
and utilization of these compounds remain largely
unknown. Another motive for examining the sug-
ar transport system of acetogenic bacteria was to
explore the possibility that H2 utilization could be
regulated by the presence of sugars through the ac-
tivities of a PTS. Because bacterial PTS are known to
affect the metabolic activity of other energy systems
in bacterial cells, in part through the action of cAMP
and its receptor protein (CPR) on gene transcription
(Saier, 1991), our hypothesis was that some aceto-
gens do utilize the PTS system. Therefore, the first
objective for the research reported herein was to de-
termine the presence of PTS activity in acetogenic
ruminal isolates.
MATeRIAlS And MeThodS
Organisms, growth conditions and cell treatment
Several ruminal acetogenic bacteria were isolated
from dairy cattle and were characterized (Boccazzi
and Patterson, 2011; Pinder and Patterson, 2011).
Acetogenic medium (Boccazzi and Patterson, 2011)
was supplemented with sugars (glucose, maltose
or sucrose) as indicated in the results and discus-
sion section. Stock solutions of sugars were pre-
pared separately as anaerobic solutions (5% w/v),
autoclaved separately and aseptically added to the
acetogen medium once both the sugar solution and
acetogen medium had reached room temperature.
Acetogen medium (20 mL) was dispensed into 120
ml volume serum tubes and sealed with butyl rub-
ber stoppers. All of the gases used in the study were
passed through a copper furnace to remove residual
oxygen and unless mentioned otherwise consisted of
100% CO2.
Cells in 20 mL of acetogen medium were harvest-
ed by centrifugation (10,000 x g, 10 min, 4°C) washed
twice with NAKP buffer (50 mM sodium phosphate,
50 mM potassium phosphate, 5 mM MgCl2, and 1
mM dithiotreitol; pH 7.2), suspended in a toluene-
ethanol mixture (1:9) followed by vortexing for 1 min
and kept on ice before being used as described by
Martin and Russell (1986).
Phosphorylation assays
Cell samples were treated with 0.2 N NaOH (100°C,
15 min) prior to protein determination and protein
concentration was estimated with a Bio-Rad protein
assay (Richmond, CA) with bovine serum albumin
used as the protein standard. For the rate of sugar
phosphorylation measurement in toluene-treated
acetogenic cells the reaction mixture (1 mL) con-
tained NAKP buffer supplemented with 10 mM PEP
or 10 mM ATP and 0.1 mL of toluene-treated cells as
described by Martin and Russell (1986) as modified by
Jiang et al. (2012). The reaction for phosphorylation
was begun by the addition of the respective (1mM)
sugar containing either 0.2 µCi of D-[U-14C]-glucose,
2-deoxy-D-[U-14C]-glucose, [U-14C]-maltose or [U-14C]-
sucrose. ATP, PEP, [14C]-labeled and unlabeled glu-
cose, 2-deoxyglucose, maltose, and sucrose as well
as dithiohthreitol and BaBr2 were purchased com-
mercially (Sigma Chemical Co., St Louis, MO). After
incubation (39° C for 30 minutes) BaBr2 (10 mL of 30
mM in 90% ethanol) was combined with the reac-
tion mixture followed by further incubation (20 min-
utes on ice). Precipitated phosphorylation products
from the reaction mixture were retrieved with a 0.45
µm pore membrane filter (Millipore Corp., Bedford,
Mass), rinsed with 80% ethanol, air dried and counted
in a 1600-R liquid scintillation counter. Finally, influ-
ences of unlabeled glucose, maltose, or sucrose on
PEP- or ATP-dependent phosphorylation influences
96 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
were determined by adding each respective sugar
(10 mM) the reaction mixtures. Sugar phosphoryla-
tion by endogenous sources of PEP and ATP was as-
sessed in control assays without exogenous PEP or
ATP. All experiments were conducted is triplicates
and estimates of variation are presented as standard
deviations.
ReSulTS And dISCuSSIon
PEP- and ATP-dependent glucose phos-phorylation
ATP conservation is critical to anaerobic bacteria
because they lack of a complete TCA cycle severely
curtails the yield of ATP from glycolysis (Thauer et al.,
1977). PEP-dependent glucose phosphorylation was
detected in all four acetogenic bacteria tested (Ta-
ble 1). Among the organisms tested, isolate A10 had
the highest rate of PEP-dependent glucose phos-
phorylation (net rate of 11.33 nM of glucose phos-
phorylated per min) While isolate A4 had the lowest
net rate of PEP-dependent glucose phosphorylation
(0.15 nM of glucose phosphorylated per mg of cell
protein per min). These phosphorylation rates are
comparable to those of other ruminal bacteria (e.g
Prevotella ruminicola, Selenomonas ruminantium,
and Streptococcus bovis) surveyed by Martin and
Russell (1986, 1987). The rates of PEP-dependent
glucose phosphorylation determined with cells of
isolate A4 were so low that this organism most likely
does not possess a glucose PTS. In all the organisms
tested, the rate of ATP-dependant phosphorylation
was greater than that of PEP-dependent phosphory-
lation. This pattern is consistent to that observed
in nonacetogenic bacteria as well as acetogens (Ji-
ang et al., 2012; Martin and Russell, 1986; Moore and
Martin, 1991). Nevertheless, as observed with PEP-
dependent phosphorylation, isolate A4 did not pos-
sess relevant glucose transport systems dependent
on either PEP or ATP. Neither A2 or A4 grows vigor-
ously using glucose as the growth substrate, which
reinforces our conclusions.
The rates of 2-deoxyglucose phosphorylation
were slightly lower than those of glucose phosphory-
lation in all the acetogenic organisms tested (Table
1). In contrast, isolate A10 had a rate of PEP-depen-
dent 2-deoxyglucose phosphorylation approximate-
ly 20 fold greater than control, strongly suggesting
the presence of a PTS in this organism. The other
organism tested (isolate H3HH) had PEP-dependent
2-deoxyglucose phosphorylation rates that were be-
tween 10 and 20 times greater than ATP-dependent
2-deoxyglucose phosphorylation, suggesting that
these two organisms most likely contain a PTS as
well.
Table 1. Specific activities of glucose and 2-deoxyglucose phosphorylation with PEP or ATP as phosphoryl donors in acetogenic bacteria1
Glucose 2-deoxyglucose
acetogens none PEP ATP none PEP ATP
A2 1.38±0.10 2.18±0.08 20.45±0.99 ND2 ND ND
A4 1.05±0.18 1.20±0.13 3.27±0.11 ND ND ND
A10 0.29±0.02 11.62±0.06 14.01±0.52 0.31±0.03 11.14±0.32 0.35±0.01
H3HH 1.39±0.09 7.07±0.19 9.99±0.43 1.25±0.05 4.25±0.36 1.40±0.03
1Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute. Values are mean ± standard deviation (n=3).2ND=not determined.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 97
Effect of growth on glucose phosphory-lating activity of acetogenic cells
The specific activity of the glucose PTS in isolates
H3HH and A10 was not constant. Cells of isolate
H3HH and A10 grown on glucose had 9- and 4- fold
greater activity, respectively, then cells grown solely
on H2 + CO2 (Table 2). Conversely, the rate of ATP
dependant phosphorylation was unchaged regard-
less of whether the cells of either isolate A10 or H3HH
were grown on glucose or H2 + CO2. These results
suggest that ATP dependent glucose phosphoryla-
tion activity is constitutive while PEP-dependent glu-
cose phosphorylation is induced by the presence of
carbohydrates in cultures of acetogenic organisms.
Regulation of PTS activity by the presence of extra-
cellular carbohydrates is a well-documented phe-
nomenon (Saier, 1985). For example, Rephaeli and
Saier (1980) reported induction of several proteins of
the PTS (i.e. enzyme I, HPr, and the glucose specific
enzyme II) in response to the presence of extracel-
lular carbohydrates. Similar to glucose phosphory-
lation, the PEP-dependent 2-deoxy-glucose phos-
phorylation activity was induced in cells (of either
isolate A10 or H3HH) growing on glucose.
The specific activity of the PTS in cells grown sole-
ly on glucose was not constant (Table 3). The specific
activity of the PTS increased as the cultures of both
isolate A10 and H3HH progressed from early log to
late log growth phase. However, once the cultures
entered the stationary phase, glucose phosphoryla-
tion rates declined precipitously to levels lower than
those observed in cultures in early log growth phase.
A similar pattern was observed for ATP-dependent
phosphorylation. Feedback inhibition of the trans-
port systems by intracellular glucose-6-phosphate is
a plausible explanation for these events because in-
hibition of several enzyme II’s (the carbohydrate-spe-
cific permeases of the PTS) by glucose-6-phosphate
has been reported previously (Postma and Lengeler,
1985). During the early to mid log growth phase the
intracellular concentration of glucose-6-phosphate
would be relatively high because extracellular glu-
cose was in excess of the needs of the cells. However,
once the glucose supply was exhausted, the amount
of glucose entering the cells would decrease, caus-
ing the cells to enter the late log phase and begin to
slow down the growth rate. Additionally the intracel-
lular concentrations of glucose-6-phosphate would
decrease as well.
Effect of carbohydrate growth sub-strate on rates of glucose, maltose, and sucrose phosphorylation
Isolates H3HH and A10 are capable of grow-
Table 2. Effect of growth substrate on the specific activity PEP- and ATP- dependent phosphory-lation of glucose and 2-deoxyglucose by isolates H3HH and A101
Glucose 2-deoxyglucose
none PEP ATP none PEP ATP
H3HH
glucose 1.39±0.09 7.07±0.19 9.99±0.43 1.25±0.05 4.25±0.36 1.4±0.03
H2/CO2 0.48±0.05 0.83±0.16 9.20±0.26 0.25±0.02 0.42±0.07 0.42±0.1
A10
glucose 0.29±0.02 11.62±0.06 14.01±0.52 0.31±0.03 11.14±0.32 0.35±0.01
H2/CO2 0.96±0.08 3.57±0.13 13.05±0.23 0.56±0.1 2.86±0.02 0.71±0.061Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute.
Values are mean ± standard deviation (n=3).
98 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
ing on maltose and sucrose at rates similar to the
rate observed with growth on glucose ( Pinder and
Patterson, unpublished observations). Therefore,
we expanded our examination to encompass the
maltose and sucrose phosphorylation performed by
these isolates to gain addition information regard-
ing the sugar transports of these organisms. PEP-
and ATP- dependent phosphorylation of glucose,
maltose and sucrose was detected in both isolate
H3HH and isolate A10, regardless of the sugar (glu-
cose, maltose, or sucrose) used for growth (Tables
4 and 5). ATP- dependent glucose phosphorylation
was the highest phosphorylation activity detected
in both isolates, regardless of the growth substrate.
The rate of PEP- dependent glucose phosphoryla-
tion was higher than PEP- dependent maltose and
glucose phosphorylation in both isolates. Similarly,
S. ruminantium and S. bovis have higher rates of
Table 3. Effect of growth stage on the specific activity of PEP- and ATP-dependent phos-phorylation of glucose by isolates H3HH and A101
Growth period OD none PEP ATP
H3HH
Early log 0.5 0.73±.151 1.42±0.08 6.98±0.13
Mid log 1 0.56±0.06 3.30±0.05 9.91±0.5
Late log 1.5 1.09±0.16 10.33±0.74 20.32±0.55
Stationary 2.5 0.79±0.09 1.71±0.17 4.58±0.13
A10
Early log 0.3 0.57±0.02 3.18±0.13 6.55±0.33
Mid log 0.6 0.56±0.06 5.45±0.18 7.16±.09
Late log 1 0.46±0.11 15.58±0.06 16.94±.24
Stationary 1.2 0.66±0.08 0.91±0.04 2.91±0.04
1Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute. Values are mean ± standard deviation (n=3).
Table 4. Net specific activity of PEP- and ATP- dependent sugar phosphorylation of isolate H3HH growing on different growth substrates1
Glucose Maltose Sucrose
Growth
substrate
PEP ATP PEP ATP PEP ATP
glucose 2.98±0.01 28.14±0.36 1.43±0.09 0.56±0.34 0.19±0.1 ND2
maltose 1.77±.20 12.61±0.27 1.34±0.07 0.22±0.14 0.26±0.01 0.14±0.1
sucrose 1.63±0.02 23.8±0.36 1.57±0.3 0.3±.04 1.3±0.04 5.09±1.26
1 Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute. Values are mean ± standard deviation (n=3).2ND=No ATP-dependent phosphorylating activity was detected after subtracting the control values.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 99
PEP-dependent glucose phosphorylation as com-
pared to either maltose or sucrose phosphorylation
dependent on PEP (Martin and Russell, 1987, 1988).
ATP-dependent maltose phosphorylating activi-
ties were detected in both isolate A10 and H3HH.
However, the rates of these activates were so low in
both isolates (less than 1.3 fold greater than control
rates without exogenous PEP or ATP), that ATP- de-
pendent maltose phosphorylation probably does
not play a major role in maltose utilization by these
organisms. Neither glucokinases nor hexokinases
are able to phosphorylate maltose (Barman, 1969),
therefore it is not clear at present what enzymes
were responsible for the ATP-dependent maltose
phosphorylation activity detected in these isolates.
Possible candidates include maltose phosphorylase
or maltase. The two isolates (A10 and H3HH) dif-
fered in the rates of ATP-dependent maltose phos-
phorylation when grown on maltose or sucrose than
when grown on glucose, while isolate H3HH was op-
posite. Nevertheless, both isolates had similar rates
of PEP-dependent maltose phosphorylation, regard-
less of the sugar substrate for growth.
Sucrose activities (regardless of the phospho-
ryl donor) were highest when the organisms were
grown on sucrose, suggesting induction of a sucrose
PTS as well as sucrose kinase activity. Similar induc-
tion of PEP-dependent sucrose phosphorylation was
detected in Streptococcus bovis (Martin and Russell,
1987). The relative rates of ATP-and PEP-dependent
glucose phosphorylation of the two organisms sug-
gest that isolate H3HH phosphorylates sucrose pri-
marily through a sucrose kinase while isolate A10
uses primarily sucrose PTS. Nevertheless, the rates
of PEP-dependent sucrose phosphorylation in both
isolate A10 and H3HH were the lowest of all three
sugars tested.
Competition by other sugars
To determine whether uptake of glucose, maltose,
and sucrose was performed by the same or different
subsystems of the PTS in isolate A10 and H3HH, the
rate of phosphorylation of 14C-labeled sugar was de-
termined in the presence of a large (10mM) excess of
unlabeled sugar (Tables 6 and 7). The glucose and
maltose PEP-dependent phosphorylation activities
appear to originate from closely linked enzymes in
isolate H3HH, due to the relatively high amount of
reciprocal inhibition observed with these two sugars.
An excess of maltose inhibited 60% of 14C-glucose
phosphorylation, while and excess of glucose inhib-
ited 14C-maltose phosphorylation by 79%. A similar
pattern was observed in isolate A10, although the
degree of reciprocal inhibition was lesser. An excess
of maltose inhibited 51% of 14C-glucose phosphory-
lation, while an excess of glucose only inhibited 21%
of 14C-maltose phosphorylation. Furthermore, an
Table 5. Net specific activity of PEP- and ATP-dependent sugar phosphorylation of isolate A10 growing on different growth substrates1
Glucose Maltose Sucrose
Growth substrate PEP ATP PEP ATP PEP ATP
glucose 7.19±0.641 13.1±0.46 1.31±0.13 0.15±0.09 0.44±0.01 0.04±0.01
maltose 4.21±0.77 11.93±0.46 1.85±0.86 0.92±0.55 0.09±0.01 0.17±0.14
sucrose 7.59±0.47 8.56±0.52 1.95±0.02 0.64±0.03 1.12±0.03 0.34±0.03
1 Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute. Values are mean ± standard deviation (n=3).
100 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
excess of maltose only inhibited 14C-maltose phos-
phorylation by 44% in isolate A10 (compared to 94%
inhibition in isolate H3HH) which suggests that the
capacity for uptake and phosphorylation of maltose
is greater in isolate A10 than isolate H3HH. Recip-
rocal inhibition of PEP-dependent phosphorylation
was observed with combinations of glucose and
sucrose as well as maltose and sucrose in both iso-
lates. However, in isolate A10 the reciprocal inhi-
bition between maltose and sucrose was relatively
low (12 to 51% inhibition). Because the degree of
inhibition between the three sugars tested was not
always near the theoretical dilution (91% inhibition),
it appears that more than one subsystem (i.e. the
Table 6. Inhibition by unlabeled sugars of PEP- and ATP- dependent [14C]-sugar phosphoryla-tion in isolate H3HH
% inhibition of phosphorylation1
Glucose Maltose Sucrose
Radiolabeled sugar2 PEP ATP PEP ATP PEP ATP
glucose 87.1 72.6 60.5 NA3 39.1 NA
maltose 79 16.3 94.1 96 75.2 93.4
sucrose 59.1 79.2 51 85.3 84.3 NA
1Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute.% Inhibition was calculated as ((PTS activity with 10 mM unlabeled sugar/PTS activity without excess unlabeled sugar) x 100).2Cell were grown in excess of the same unlabeled sugar.3NA = No activity, experimental values were not greater than control values.
Table 7. Inhibition by unlabeled sugars of PEP- and ATP-dependent [14C]-sugar phosphorylation in isolate A10
% inhibition of phosphorylation1
Glucose Maltose Sucrose
Radiolabeled sugar2 PEP ATP PEP ATP PEP ATP
glucose 87.5 87.5 51.6 13.4 50.2 3.9
maltose 21.1 69.6 44.3 29.3 11.9 NA3
sucrose 24.1 73.5 29.5 35.3 50.9 79.41Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute.% Inhibition was calculated as ((PTS activity with 10 mM unlabeled sugar/PTS activity without excess unla-beled sugar) x 100).2Cell were grown in excess of the same unlabeled sugar.3NA = No activity, experimental values were not greater than control values.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 101
carbohydrate specific enzyme II and III) of the PTS
transports glucose, maltose and sucrose in the iso-
lates. Transport of glucose, maltose and sucrose by
different carbohydrate specific enzymes of the PTS
has been reported in other bacteria such as E. coli
(Meadow et al., 1990).
A much different picture emerged with ATP-de-
pendent phosphorylation of glucose, maltose and
sucrose in both isolate A10 and H3HH. Glucose
and maltose are phosphorylated by different ATP-
dependent systems in isolate H3HH. However, the
same relationship is less clear in isolate A10. Malt-
ose inhibited glucose phosphorylation by only 13%
while glucose inhibited maltose phosphorylation by
70% in isolate A10. This type if inhibition suggested
a feedback-type of inhibition by glucose upon ATP-
dependent maltose phosphorylation. A similar pat-
tern of feedback inhibition by glucose on sucrose
phosphorylation was observed in isolate A10.
Interestingly, an excess of unlabeled sucrose did
not reduce the rate of ATP-dependent 14C-sucrose
phosphorylation in isolate H3HH. Maltose and su-
crose are phosphorylated by the same enzyme sys-
tem in isolate H3HH in light of the relatively strong
reciprocal inhibition displayed between these two
sugars. The relationship between maltose and su-
crose ATP-dependent phosphorylation is less clear
in isolate A10. Sucrose did not inhibit maltose phos-
phorylation while maltose only achieved 29% inhibi-
tion on 14C-maltose phosphorylation and 35% inhibi-
tion on 14C-sucrose phosphorylation.
ConCluSIon
The constitutive nature of the ATP-dependent
glucose phosphorylating activities suggests that
this system is used as the initial system for uptake
of glucose in to the cell, and that the PTS serves as
a secondary system, in the same fashion as the am-
monia uptake systems of glutamate dehydrogenase:
glutamine synthetase. Further experiments will be
needed to determine the minimum concentration of
sugar needed to induce the PTS in these bacteria as
well as the mechanism how glucose uptake repress-
es activity of the Wood pathway.
RefeRenCeS
Barman, T. E. 1969. Enzyme handbook. Springer-Ver-
lag, New York, NY.
Boccazzi, P. and J. A. Patterson. 2011. Using hy-
drogen-limited continuous culture to isolate low
hydrogen threshold ruminal acetogenic bacteria.
Agric. Food Anal. Bacteriol. 1:33-44.
Drake, H. L. 1992. Acetogenesis and Acetogenic
bacteria. In: Lederberg, J. Ed. Encyclopedia of Mi-
crobiology. Academic Press, Inc. San Diego CA
Eden, G. and G. Fuchs. 1983. Autotrophic CO2 fixa-
tion in Acetobacterium woodii. II. demonstration
of enzymes involved. Arch. Microbiol. 135:68-73.
Genthner, B. R. S. and M. P. Bryant. 1987. Additional
characteristics of one-carbon compound utiliza-
tion by Eubacterium limosum and Acetobacterium
woodii. Appl. Environ. Microbiol. 53:471-476.
Jiang, W., R. S. Pinder, J.A. Patterson, and S. C. Ricke.
2012. Sugar phophorylation activity in ruminal ace-
togens. J. Environ. Sci. and Health, Part B. 47:843-
846.
Leedle, J. A. Z, M. P. Bryant and R. B. Respell. 1982.
Diurnal variations in bacterial numbers and fluid
parameters in ruminal contents of animals fed low-
or high-forage diets. Appl. Environ. Microbiol.
44:402-412.
Leedle, J. A. Z., K. Barsuhn, and R. B. Respell. 1986.
Postprandial trends in estimated ruminal digesta
polysaccharides and their relation to changes in
bacterial groups and ruminal fluid characteristics.
J. Anim. Sci. 62:789-803.
Martin S. A. and J. B. Russell. 1986. Phosphoenolpyr-
uvate-dependent phosphorylation of hexoses by
ruminal bacteria: Evidence for the phosphotrans-
ferase system. Appl. Environ. Microbiol. 52:1348-
1352.
Martin S. A. and J. B. Russell. 1987. Transport and
Phosphorylation of disaccharides by the ruminal
bacterium Streptococcus bovis. Appl. Environ. Mi-
crobiol. 53:2388-2393.
Martin S. A. and J. B. Russell. 1988. Mechanisms of
102 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
sugar transport in the rumen bacterium Selenomo-
nas ruminantium. J. Gen. Microbiol. 134:819-827.
Matin, A. and H. Veldcamp. 1978. Physiological ba-
sis of the selective advantage ofa Spirillum sp. in a
carbon limited environment. J. Gen Microbiol. 105:
187-197.
Meadow, N. D., D. K. Fox, and S. Roseman. 1990.
The bacterial phosphoenolpyruvate: glycose
phosphotransferase system. Annu. Rev. Biochem.
59:497-542.
Moore, G. A. and S. A. Martin. 1991. Effect of growth
conditions on the Streptococcus bovis phospho-
enolpyruvate glucose phosphotransferase system.
J. Anim. Sci. 69:4967-4973.
Pinder, R. S. and J. A. Patterson. 2011. Isolation and
initial characterization of plasmids in an aceto-
genic ruminal isolate. Agric. Food Anal. Bacteriol.
1:186-192.
Postma, P. W. and J. W. Lengeler. 1985. Phosphoen
olpyruvate:carbohydrate phosphotransferase sys-
tem of bacteria. Microbio. Rev. 49:232-269.
Postma, P. W., J. W. Lengeler and G. R. Jacobson.
1993. Phosphoenolpyruvate:carbohydrate phos-
photransferase systems of bacteria. Microbio. Rev.
5:543-594.
Ragsdale, S. W. 1991. Enzymology of the acetyl-CoA
pathway of CO2 fixation. Crit. Rev. Biochem. Mol.
BioI. 26:261-300.
Rephaeli, A. W. and M. H. Saier, Jr. 1980. Regulation
of genes coding for enzyme constituents of the
bacterial phosphotransferase system. J. Bacteriol.
141:658-663.
Romano, A. H., S. J. Eberhard, S. L. Dingle, and T. D.
McDowell. 1970. Distribution 0 the phosphoenol-
pyruvate: glucose phosphotransferase system in
bacteria. J. Bacteriol. 104:808-813.
Romano, A. H., J. D. Trifone and M. Brustolon. 1979.
Distribution of the phosphoenolpyruvate:glucose
phosphotransferase system in fermentative bacte-
ria. J. Bacteriol. 139-93 :97.
Saier, M. H., Jr. 1985. Mechanisms and regulation
of carbohydrate transport in bacteria. Academic
Press, Inc. Orlando, FL.
Saier, M. H., Jr, and J. Reizer. 1994. The bacterial
phosphotransferase system: new frontiers 30 years
later. Mol. Microbiol. 13:755-764.
Saier, M. H., Jr. 1991. A multiplicity of potential car-
bon catabolite repression mechanisms in prokary-
otic and eukaryotic microorganisms. New Biologist
3: 1137 -1147.
Thauer, R. K., K. Jungermann, K. Decker. 1977. En-
ergy conservation in chemotrophic anaerobic bac-
teria. Bact. Revs. 41:100-180.
Vadeboncoeur, C. 1984. Structure and properties of
the phosphoenolpyruvate: glucose phosphotrans-
ferase system of oral streptococci. Can. J. Micro-
biol. 30:495.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 103
www.afabjournal.comCopyright © 2012
Agriculture, Food and Analytical Bacteriology
ABSTRACT
Phytase and acid phosphatases in wheat and barley are the major enzymes which catalyze the release of
orthophosphate from phosphorylated substrates. Their activities may be influenced by numerous factors
including variety differences, growth conditions, and fertilization. The purpose of this study was to evaluate
the effect of nitrogen (N), phosphorus (P), and potassium (K) fertilization on phytase and acid phosphatase
activities in wheat and barley varieties which are developed and cultivated in Bulgaria. A randomized block
design method was applied to a field experiment to study eight treatments which included the applica-
tion of N, P, K and the combinations of N x P, N x K, P x K and N x P x K. It was established that increased
N contents of both wheat and barley grains stimulated phytase activities. The accumulation of P in the
grains resulted in decreases of the enzyme activities. Acid phosphatase activities in wheat and barley were
less impacted by the applied fertilizers as evidenced by small statistical differences that were established.
No specific trend of K-dependent influence on both enzymes was observed. The application of N- and P-
containing fertilizers may be used to modulate phytase activities in wheat and barley. If yielding a crop with
increased intrinsic phytase activities is needed, utilization of N-rich fertilizer is recommended.
Keywords: wheat, barley, fertilization, phytase, acid phosphatase, animal nutrition
InTRoduCTIon
Phytase and acid phosphatases in wheat and bar-
ley are the major enzymes which catalyze the release
of orthophosphate from phosphorylated substrates
(Viveros et al., 2000; Centeno et al., 2001). Inorganic
Correspondence:Vesela Chalova, [email protected]: 032-603-855 Fax: 032-644-102
phosphate is necessary for seed germination and
embryo growth (Brinch-Pedersen et al., 2002). The
levels of bioavailable phosphate are also important
when wheat and barley are used as feed ingredients
for monogastric animals (Pointillart et al., 1987). Non-
ruminants are incapable of utilizing phytate-bound
phosphorus (P) which may reach up to 80% of total P
content (Kirby and Nelson, 1988; Reddy et al., 1989;
Perney et al., 1993). Due to the importance of P to
Effect of Fertilization on Phytase and Acid Phosphatase Activities in Wheat and Barley Cultivated in Bulgaria
V. I. Chalova1, I. Manolov2, M. Nikolova3, L. Koleva1
1Department of Biochemistry and Molecular Biology, University of Food Technology, Plovdiv, Bulgaria2Department of Agrochemistry and Soil Science, Agricultural University, Plovdiv Bulgaria
3Department of Agriculture, University of Forestry, Sofia Bulgaria
Agric. Food Anal. Bacteriol. 2:103-110, 2012
104 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
animal health and the uncertainties of P bioavailabil-
ity in feed ration, farmers and animal producers are
inclined to over-supplement P containing sources to
create a margin of safety (Sutton et al., 2001). How-
ever, in countries with highly regulated animal waste
management, P overload is strictly monitored to pre-
vent pollution of soil and groundwater. In addition,
microbial phytase supplementation of animal diets,
which is meant to reduce the amount of excreted P
by making more of it bioavailable to animals, is very
often constrained by expenditure associated with
production and application of the enzyme (Afinah
et al., 2010). To more precisely formulate P levels in
animal diets and avoid elevated feed cost and envi-
ronmental pollution, while achieving optimal animal
performance, more information about the capacity
of the intrinsic orthophosphate releasing enzymes in
feed ingredients is necessary.
By studying phytate-degrading enzyme activities
in legume seeds, cereals, and cereal by-products,
Steiner et al. (2007) and Viveros et al. (2000) estimat-
ed intermediate phytase activities in cereals which,
however, varied over a wide range. Even for one
plant species, data for phytase and acid phospha-
tase activities reported by different authors varied
considerably (Viveros et al., 2000, Greiner and Egli,
2003; Steiner et al., 2007; Zarei, 2007). The variations
could be explained by differences in the varieties
used for the studies, growth conditions, and fertiliza-
tion (Liu et al., 2006; Steiner et al., 2007; 2008; Kaya
et al., 2009). Although information on phytase and
acid phosphatase activities in wheat and barley has
been published, little is known about their modula-
tion by nitrogen (N), P, and potassium (K) which are
major fertilizing agents used in agriculture to im-
prove soil quality and crop yields. The purpose of
this study was to evaluate the effect of N, P and K
fertilization on respective seed mineral contents as
related to phytase and acid phosphatase activities
in wheat and barley cultivated in Bulgaria. Although
Ca2+ and Mg2+ were not included in our fertilization
experiment, their contents in seeds were also evalu-
ated and discussed as potential determinants of the
enzyme activities (Igamnazarov et al., 1998).
MATeRIAlS And MeThodS
Experimental field design and fertiliza-tion
A field experiment was carried out in 2009/10 near
village Sadievo (42° 31’ 1.2” N, 26° 4’ 58.8” E), region
of Stara Zagora, Southern Bulgaria. Bulgarian variet-
ies wheat (Aglika) and barley (Aheloj 2) were grown in
soil type “vertisols” (pH(kcl) 5.3) which contained 16.3
mg NH4-N /kg, 14.0 mg NO3-N /kg, 2 mg P2O5/100g,
and 24 mg K2O /100g before the experiment. A ran-
domized block design method was used to study
eight treatments which included the application of
N, P, K, and combinations of N x P, N x K, P x K, and N
x P x K. The cereals grown in non-fertilized soil were
used as a control. Each treatment consisted of four
replications which were performed on plots sizing 5
x 5 m (25 m2). Ammonium nitrate, triple superphos-
phate and potassium chloride were applied to field
to supply N, P2O5 and K2O at the rates of 100 kg/ha,
120 kg/ha, and 80 kg/ha for the wheat, and 80 kg/ha,
120 kg/ha, 80 kg/ha for the barley respectively.
Cereals (wheat and barley) were field collected
and air dried. Representative samples (100 g) were
taken, ground to pass a 1 mm sieve and stored in
sealed containers. All reagents used throughout the
experiments were of analytical grade and bought
from Sigma (Buchs, Switzerland).
Determination of N, P, K, Ca, and Mg in cereal grains
Seed samples were digested with concentrated
HNO3 and heated in a MarsXpress microwave diges-
tion system (CEM GmbH, Germany) to determine P,
K, Ca, and Mg contents. Concentration levels of K,
P, Ca, and Mg were established by using an Opti-
cal Emission Spectrometry with Inductively Coupled
Plasma (ICP OES), Liberty Series II at 769.896 nm,
213.618 nm, 315.887 nm, and 279.079 nm respective-
ly. N was determined by Kjeldahl method (Bremner,
1996).
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 105
Enzyme activity measurements
Intrinsic phytase activities in wheat and barley
were determined by the extraction procedure of
Grainer and Egli (2003) with some modifications. The
method is based on the quantification of inorganic
phosphate released by phytase from phytate which
was used as a substrate. The liberated phosphate
was measured according to the ammonium-molyb-
date method (James, 1999). Briefly, samples (3 g)
were extracted for 30 min with 100 ml 0.25 M acetate
buffer solution (pH 5) at constant stirring and room
temperature (22ºC). Solid particles were removed
by centrifugation for 15 min at 6000 g (MPW Med.
Instruments, Warsaw, Polska) and supernatants were
analyzed for phytase and acid phosphatase enzyme
activities. For the phytase evaluation, the reaction
mixture consisted of 0.9 ml acetate buffer (0.25 M,
pH 5), 2 ml 7.5 mM sodium phytate (Sigma-Aldrich
P8810), and 0.1 ml test solution was incubated for 30
min at 37ºC. The enzyme reaction was stopped by
adding a stop solution (2:1:1 v/v/v) consisted of nitric
acid (1:2 v/v nitric acid:water), ammonium molybdate
(5%), and ammonium metavanadate (0.235%). The
yellow complex, formed after the reaction between
the liberated inorganic phosphate and the acidic
molybdate/vanadate reagent, was measured with
a spectrophotometer (Carl Zeiss, Jena, Germany)
at 415 nm. Phytase activity was calculated against a
standard curve constructed with potassium dihydro-
gen phosphate and expressed as unit/kg (U/kg) on a
dry matter (DM) basis. One phytase unit was defined
as the amount of the enzyme which liberates 1 µmol
of inorganic phosphorus per minute from 5 mmol of
sodium phytate at pH 5 and 37ºC.
Acid phosphatase activity was determined as de-
scribed by Zyla et al. (1989). The method is based
on the quantification of the p-nitrophenol released
from p-nitrophenyl phosphate by the catalytic action
of the enzyme. Reaction mixture contained 1 ml 10
mM substrate (p-nitrophenyl phosphate) dissolved
in 0.25 M acetate buffer (pH 5) and 0.2 ml extracted
enzyme. After incubation for 30 min at 37 ºC, the re-
action was stopped by the addition of 5 ml 50 mM
NaOH. The intensity of yellow color was measured
with a spectrophotometer and the enzyme activity
was calculated against a standard curve constructed
with graded concentrations of p-nitrophenol. One
unit acid phosphatase activity was defined as the
amount of the enzyme which liberates 1 µmol of p-
nitrophenol per minute under above conditions.
Variability, replication, and statistical analysis
Statistical analysis was performed using the Sta-
tistical Package for the Social Sciences (SPSS) pro-
gram (IBM SPSS Stattistics 17, Somers, NY, USA).
Presented results are averaged means of at least two
independent experiments ± standard deviations.
Mean differences and between-subject effect were
established by one-way analysis of variance (ANO-
VA) using the general linear model procedure and
Duncan’s multiple comparison test. Statistical differ-
ences were considered significant at p < 0.05.
ReSulTS And dISCuSSIon
Effect of fertilization on mineral con-tents of wheat and barley grains
Plant fertilization is one of the most important in-
tensifying factors of wheat and barley crop produc-
tion. In addition to crop yield, it influences the qual-
ity of harvested product which may include mineral
and protein contents, chlorophyll and carotenoides,
amino acid composition and enzyme activities (Ko-
szanski et al., 1997; Manolov et al., 1999; Černý et
al., 2010). N, P and K are macronutrients which are
required by plants in relatively large amounts. They
are commonly included in agricultural practices as
fertilizing agents to improve soil fertility and modu-
late plant enzyme activities towards desired crop
characteristics (Stewart et al., 2004; Kaya et al., 2009;
Balabanli et al., 2010).
In our study, the application of N-containing fer-
tilizers in all cases (N, NP, NK and NPK) resulted in
increases of N contents of both wheat and barley
grains compared to controls (Tables 1 and 2). Av-
106 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
erage increments of 19.38% and 19.53% in grain N
concentrations in response to N fertilization were es-
tablished for wheat and barley respectively. Our data
agreed with Bettaieb-Ben Kaab et al. (2006) who re-
ported increased concentrations of N in barley grains
compared to control in response to all levels of N
fertilization which included 40, 80, and 120 kg/ha.
Albrizio et al. (2010) reported up to 15.8% average
increases in N contents of wheat and barley grains as
consequence of N fertilization which is close to our
findings. Our results were not unexpected because
of plant capabilities to accumulate N upon exces-
sive N soil availability (Golik et al., 2005). According
to Przulj and Momčilović (2003), N is accumulated in
Table 1. Effect of fertilization differences on mineral content of wheat grains
Fertilization, kg/ha
N, % P, % K, % Ca, % Mg, %
control 1.78 ± 0.15bc 0.24 ± 0.08b 0.41 ± 0.03 0.046 ± 0.008b 0.105 ± 0.009
N100 2.14 ± 0.12a 0.21 ± 0.02c 0.39 ± 0.03 0.048 ± 0.004b 0.093 ± 0.006
P120 1.65 ± 0.12c 0.29 ± 0.03a 0.38 ± 0.05 0.043 ± 0.001b 0.97 ± 0.004
K80 1.75 ± 0.17 bc 0.24 ± 0.07b 0.35 ± 0.02 0.042 ± 0.009b 0.107 ± 0.002
N100P120 2.16 ± 0.20a 0.25 ± 0.02b 0.39 ± 0.04 0.039 ± 0.004b 0.110 ± 0.002
N100K80 2.04 ± 0.09ab 0.24 ± 0.09b 0.38 ± 0.02 0.045 ± 0.006b 0.105 ± 0.001
P120K80 1.63 ± 0.10c 0.29 ± 0.03a 0.42 ± 0.09 0.083 ± 0.006a 0.104 ± 0.004
N100P120K80 2.16 ± 0.11a 0.32 ± 0.04a 0.38 ± 0.04 0.043 ± 0.002b 0.101 ± 0.003
Data represent average means of at least two independent experiments ± standard deviations. a-c Means in a column with different superscripts differ significantly (p<0.05). Data for K and Mg were not found
significantly different (p>0.05).
Table 2. Effect of fertilization differences on mineral content of barley grains
Fertilization, kg/ha N, % P, % K, % Ca, % Mg, %
control 1.51 ± 0.13b 0.23 ± 0.10cd 0.32 ± 0.03d 0.049 ± 0.004c 0.107 ± 0.009
N80 1.78 ± 0.15a 0.22 ± 0.03cd 0.39 ± 0.02ab 0.047 ± 0.003c 0.115 ± 0.001
P120 1.44 ± 0.18bc 0.28 ± 0.04ab 0.40 ± 0.02a 0.055 ± 0.002c 0.124 ± 0.001
K80 1.39 ± 0.11c 0.24 ± 0.02c 0.37 ± 0.03bc 0.051 ± 0.002c 0.107 ± 0.003
N80P120 1.90 ± 0.26a 0.24 ± 0.09c 0.34 ± 0.04bc 0.039 ± 0.004d 0.109 ± 0.002
N80K80 1.91 ± 0.11a 0.20 ± 0.02d 0.35 ± 0.03c 0.045 ± 0.006cd 0.100 ± 0.001
P120K80 1.31 ± 0.07c 0.30 ± 0.09a 0.43 ± 0.02a 0.072 ± 0.001b 0.116 ± 0.002
N80P120K80 1.63 ± 0.30a 0.26 ± 0.07b 0.39 ± 0.02ab 0.131 ± 0.002ab 0.118 ± 0.006
Data represent average means of at least two independent experiments ± standard deviations. a-d Means in a column with different superscripts differ significantly (p<0.05). Data for Mg were not found sig-
nificantly different (p>0.05).
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 107
wheat and barley during vegetation period to pro-
vide optimal protein and nucleic acid syntheses and
is translocated to kernel during reproductive phase.
Positive response of N content of wheat and barley
grains to N fertilization was also reported by Koszan-
ski et al. (1997), and Małecka and Blecharczyk (2008).
Phosphate-based fertilization exhibited similar
trend of increase in P concentrations in both wheat
and barley (Tables 1 and 2). Except for the combined
fertilization with P and N, the grains, collected from
plots enriched with P, PK and NPK, contained sig-
nificantly higher P concentrations than non-fertilized
grains (p< 0.05). Our data agreed with Syltie and
Dahnke (1983) who also observed increased P-con-
tent responses of two hard red spring wheat culti-
vars to incremented application of a P-rich fertilizer
to soil.
Fertilization of wheat with K80 did not influenced
K contents of grains. No significant differences in K
grain concentrations (p< 0.05) among all treatments
were observed (Table 1). This is probably due to
relatively high initial content of K in soil (24 mg K2O
/100g) before starting the experiment. When wheat
is grown in soil containing optimal K concentrations,
further increase of K availability may not affect K
plant content (Slaton et al., 2008). In barley, signifi-
cant differences among K contents of grains were
established but they were ambiguously related to K
dose applied to soil. They were rather due to inter-
relationships of macronutrients where P (P, NP, PK,
and NPK) exerted the most stimulating effect on K
accumulation in barley grains (Table 2).
Although Ca and Mg ions were not included in
our field experiment as fertilizers, they were quanti-
tatively measured because of possible inter-element
relationships (Markert, 1993; Li et al., 2010) and po-
tential influence on phytase and acid phosphatase
activities. Indeed, Ca contents of both wheat and
barley subjected to the experimental fertilization de-
sign were found significantly different with PK and
NPK contributing the most. None of the fertilizers or
their combinations influenced Mg contents of wheat
and barley grains.
Effect of fertilization on phytase and acid phosphatase activities in wheat and barley grains
In our study, nitrogen fertilization (N and NK) and
the respective high N contents in seeds (Table 1 and
2) stimulated phytase activities in both wheat and
barley (Table 3 and 4). Similarly, Kaya et al. (2009) es-
tablished positive effect of N fertilization on phytase
activity in chickpea (Akcin 91) as evidenced by the in-
creased activity of the enzyme (4.3 U/g) compared to
control (3.8 U/g) in a response to soil fertilization with
N at the level of 60 kg N/ha. According to Eastwood
and Laidman (1971), the increased phytase levels at
higher N availability is mediated by certain nitrogen-
containing compounds including glutamine, purine
and pyrimidine nucleotides. Although significantly
not different from the controls, highest acid phos-
phatase activities (absolute values) were estimated
in wheat (6 529 ± 130 U/kg) and barley (4189 ± 254
U/kg) seeds containing highest N concentrations.
Increasing acid phosphatase activities from 5.27 to
7.87 mmol/kg in wheat leaves which corresponded
to increasing N levels ranging from 13.1 to 45.4 mg
N-NO3/kg were observed by Koszanski et al. (1997).
In contrast to N, the wheat and barley seeds con-
taining highest P concentrations (P, PK, NPK; Table 1
and 2) exhibited the lowest levels of phytase activi-
ties (Table 3 and 4). Although the biological function
of phytase is to liberate inorganic P to provide suf-
ficient amounts for germinating seeds and growing
plants, it looks that excessive P availability may inhib-
it the enzyme. By studying the control mechanisms
of the phytin-phytase system in wheat embryos,
Sartirana and Bianchetti (1967) established that the
rate of phytin breakdown was controlled in vivo by
the concentration of inorganic phosphate, through
the inhibition of phytase activity. Statistical decrease
of acid phosphatase activity caused by enhanced P
concentrations was established only for barley fertil-
ized with P120K80 (Table 4).
In addition to P concentrations, Ca ions may also
contribute to phytase inhibition. In fact, wheat seeds
fertilized with P120K80 resulted in highest accumula-
tion of Ca (0.083 ± 0.006%) and one of the lowest lev-
108 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
els phytase- and acid phosphatae activities (Table 3).
Similarly, the barley seeds containing 0.072 ± 0.001%
Ca (Table 2) exhibited phytase- and acid phosphatae
activities significantly lower than the control (Table 4).
According to Igamnazarov et al. (1998), the influence
of Ca ions on phytase activity is dose-dependent.
Low Ca concentrations (1x10-5 M) did not influence
phytase activity in cotton plants. However, higher Ca
concentrations (5x10-5 M) reduced phytase activity
by 12%.
ConCluSIonS
Overall mineral soil fertilization influenced phy-
tase and acid phosphatase activities in both wheat
and barley grains. Acid phosphatase activities were
less impacted as evidenced by small statistical differ-
ences that were established. While the increased N
contents of seeds stimulated phytase activities, the
abundance of P negatively controlled the liberation
of phytine-bound P caused by phytase. No specific
trend of K influence on both enzymes was estab-
lished. Therefore, the application of N- and P-con-
taining fertilizers may be used to modulate phytase
activities in wheat (Aglika) and barley (Aheloj 2). If
yielding a crop with increased intrinsic phytase ac-
tivities is needed, utilization of N-rich fertilizer may
be the choice.
ACknowledgeMenTS
This research was supported by project “Best
Management Practices for Sustainable Crop Pro-
duction in Bulgaria” financed by International Plant
Nutrition Institute (IPNI) USA and K+S KALI GmbH
Germany.
RefeRenCeS
Afinah, S., A. M. Yazid, M. H. Anis Shobirin, and M.
Shuhaimi. 2010. Phytase: application in food indus-
try. Int. Food Res. J. 17:13-21.
Albrizio,R., M. Todorovic, T. Matic, A. M. Stellacci.
Table 3. Effect of fertilization differences on phytase and acid phosphatase activities in wheat
Fertilization, kg/ha
Phytase Activity, U/kg
Acid Phosphatase Activity, U/kg
control 1759 ± 73c 5381 ± 327 ab
N100 2349 ± 75b 6529 ± 130 a
P120 1160 ± 93f 5243 ± 292 b
K80 1691 ± 137cd 5283 ± 322 ab
N100P120 2168 ± 90b 5317 ± 253 ab
N100K80 3455 ± 184a 5331 ± 224 ab
P120K80 1593 ± 112cd 5246 ± 139 b
N100P120K80 1478 ± 34de 6565 ± 311 a
Data represent average means of at least two inde-
pendent experiments ± standard deviationsa-f Means in a column with different superscripts dif-
fer significantly (p<0.05).
Table 4. Effect of fertilization differences on phytase and acid phosphatase activities in barley
Fertilization, kg/ha
Phytase Activity, U/kg
Acid Phosphatase Activity, U/kg
control 2570 ± 125c 4288 ± 283a
N80 3038 ± 216ab 4189 ± 254ab
P120 1410 ± 85d 3664 ± 40abc
K80 3442 ± 316a 3778 ± 106abc
N80P120 2536 ± 204c 3722 ± 228abc
N80K80 3372 ± 227ab 3583 ± 170bc
P120K80 1564 ± 42d 3509 ± 35c
N80P120K80 2763 ± 235bc 3849 ± 205abc
Data represent average means of at least two inde-
pendent experiments ± standard deviations. a-d Means in a column with different superscripts dif-
fer significantly (p<0.05).
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 109
2010. Comparing the interactive effects of water
and nitrogen on durum wheat and barley grown
in a Mediterranean environment. Field Crops Res.
115:179-190.
Balabanli, C., S. Albayrak, and O. Yüksel. 2010. Ef-
fects of nitrogen, phosphorus and potassium fer-
tilization on the quality and yield of native range-
land. Turk. J. Field Crops 15:164-168.
Bettaieb-Ben Kaab, L., C. Rahmoune, M. Lauriere,
and M. Ben Naceur. 2006. Effect of N fertilization
on storage protein and some amino acid quanti-
ties of two Tunisian barley varieties differing in
their degrees of adaptation to environmental con-
ditions. Sci. Technol. C 24:7-12.
Bremner, J. M. 1996. Nitrogen - total. In: D. L.
Sparks, A. L. Page, P. A. Helmke, R. H. Loeppert, P.
N. Soltanpour, M. A. Tabatabai, C. T. Johnston, and
M. E. Sumner. Eds. Methods of Soil Analysis. Part
3-Chemical Methods. American Society of Agron-
omy-Soil Science Society of America, Madison, WI.
p 1085-1121.
Brinch-Pedersen, H., L. D. Sørensen, and P. B. Holm.
2002. Engineering crop plants: getting a handle on
phosphate. Trends Plant Sci. 7:118-125.
Centeno, C., A. Viveros, A. Brenes, R. Canales, A. Lo-
zano, and C. de la Cuadra. 2001. Effect of several
germination conditions on total P, phytate P, phy-
tase, and acid phosphatase activities and inositol
phosphate esters in rye and barle. J. Agric. Food
Chem. 49:3208-3215.
Černý, J., J. Balík, M. Kulhánek, K. Čásová, and V.
Nedvěd. 2010. Mineral and organic fertilization ef-
ficiency in long-term stationary experiments. Plant
Soil Environ. 56:28-36.
Eastwood, D., and D. L. Laidman. 1971. The mobili-
zation of macronutrient elements in the germinat-
ing wheat grain. Phytochemistry 10:1275-1284.
Golik, S. I., H. O. Chidichimo, and S. J. Sarandón.
2005. Biomass production, nitrogen accumulation
and yield in wheat under two tillage systems and
nitrogen supply in the Argentine rolling pampa.
World J. Agric. Sci. 1:36-41.
Greiner, R., and I. Egli. 2003. Determination of the
activity of acidic phytate-degrading enzymes in ce-
real seeds. J. Agric. Food Chem. 51:847-850.
Igamnazarov, R. P., B. O. Beknazarov, and M. M. Ab-
dullaeva. 1998. Influence of some ions on the ac-
tivity of cottonplant phytase. Chem. Nat. Comp.
34:307-308.
James, C. S. 1999. Analytical chemistry of foods. As-
pen Publishers, Inc., Gaithersburg, MD. 178 p.
Kaya, M., Z. Kücükyumuk, and I. Erdal. 2009. Phytase
activity, phytic acid, zinc, phosphorus andprotein
contents in different chickpea genotypes inrela-
tion to nitrogen and zinc fertilization. African J.
Biotech. 8:4508-4513.
Kirby, L., and T. Nelson. 1988. Total and phytate
phosphorus content of some feed ingredients de-
rived from grains. Nutr. Report Intl. 37:277-280.
Koszanski, Z., S. Karczmarczyk, D. Sciazko, E. Koszan-
ska, and U. Tyrakowska. 1997. Effect of irrigation
and mineral fertilization on spring cereals cultivat-
ed on a sandy soil. Part II. Activity of some physi-
ological processes and chemical composition of
grain. Rom. Agric. Res. 7-8:25-34.
Li, B., S. Huang, M. Wei, H. L. Zhang, A. Shen, J. Xu,
and X. Ruan. 2010. Dynamics of soil and grain mi-
cronutrients as affected by long-term fertilization
in an aquic inceptisol. Pedosphere 20:725-735.
Liu, Z. H., H. Y. Wang, X. E. Wang, G. P. Zhang, P.
D. Chen, and D. J. Liu. 2006. Genotypic and spike
positional difference in grain phytase activity, phy-
tate, inorganic phosphorus, iron, and zinc con-
tents in wheat (Triticum aestivum L.). J. Cereal Sci.
44:212-219.
Małecka, I., and A. Blecharczyk. 2008. Effect of till-
age systems, mulches and nitrogen fertilization
on spring barley (Hordeum vulgare). Agron. Res.
6:517-529.
Manolov, I., V. Chalova, and S. Kostadinova. 1999. Ef-
fect of nitrogen fertilization and variety differences
on nitrate reductase activity of wheat (Triticum aes-
tivum). Bulg. J. Agric. Sci. 5:599-604.
Markert, B. 1993. Interelement correlations detect-
able in plant samples based on data from refer-
ence materials and highly accurate research sam-
ples. Fresenius’ J. Anal. Chem. 345:318-322.
Perney, K. M., A. H. Cantor, M. L. Straw, and K. L.
Herkelman. 1993. The effect of dietary phytase on
growth performance and phosphorus utilization of
110 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
broiler chicks. Poult. Sci. 72:2106-2114.
Pointillart, A., A. Fourdin, and N. Fontaine. 1987.
Importance of cereal phytase activity for phytate
phosphorus utilization by growing pigs fed diets
containing triticale or corn. J. Nutr. 117:907-913.
Przulj, N., and V. Momčilović. 2003. Dry matter and
nitrogen accumulation and use in spring barley.
Plant Soil Environ. 49:36-47.
Reddy, N. R., M. D. Pierson, S. K. Sathe, and D. K.
Salunkhe. 1989. Phytates in cereals and legumes.
CRC Press Inc., Boca Raton, FL. 152 p.
Sartirana, M. L., and R. Bianchetti. 1967. The effects
of phosphate on the development of phytase in
the wheat embryo. Physiol. Plantarum 20:1066-
1075.
Slaton, N. A., R. E. DeLong, M. Mozaffari, S. Clark, C.
Allen, and R. Thompson. 2008. Wheat grain yield
response to phosphorus and potassium fertilizer
rate. Pages 69-71 In: N. A. Slaton. Ed. Arkansas Soil
Fertility Studies 2007. Research Series 558. Univer-
sity of Arkansas Press, Fayettevill, AR.
Steiner, T., R. Mosenthin, B. Zimmermann, R. Greiner,
and S. Roth. 2007. Distribution of phytase activ-
ity, total phosphorus and phytate phosphorus in
legume seeds, cereals and cereal by-products as
influenced by harvest year and cultivar. Anim. Feed
Sci. Technol. 133:320-334.
Stewart, W. M., D. W. Dibbb, A. E. Johnstonc, and
T. J. Smyth. 2005. The contribution of commercial
fertilizer nutrients to food production. Agron. J.
97:1-6.
Sutton, A., T. Applegate, S. Hankins, B. Hill, G. Alle,
W. Greene, R. Kohn, D. Meyer, W. Powers, and T.
van Kempen. 2001. Manipulation of animal diets to
affect manure production, composition and odors:
State of the science. National Center for Manure
and Animal Waste Management.
Syltie, P. W., and W. C. Dahnke. 1983. Mineral and
protein content, test weight, and yield variations
of hard red spring wheat grain as influenced by
fertilization and cultivar. Plant Foods Hum. Nutr.
32:37-49.
Viveros, A., C. Centeno, A. Brenes, R. Canales, and
A. Lozano. 2000. Phytase and acid phosphatase
activities in plant feedstuffs. J Agric. Food Chem.
48:4009-4013.
Zarei, M. A. 2007. Phytase activity in the grain of 6
varieties of wheat cultivated in Kurdistan province.
Int. J. Poult. Sci. 6:634-636.
Zyla, K., M. Kujawski, and J. Koreleski. 1989. Dephos-
phorylation of phytate compounds by means of
acid phosphatase from Aspergillus niger. J. Sci.
Food Agric. 49:315-324.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 111
www.afabjournal.comCopyright © 2012
Agriculture, Food and Analytical Bacteriology
ABSTRACT
Mixed populations of domesticated and feral pig gut microorganisms (Recombined Porcine-Derived
Continuous Flow culture; RPCF and Feral Culture; FC, respectively) were grown in continuous culture to
investigate the effects of tylosin on antimicrobial resistance. Cultures established in steady state were in-
oculated with 9.7 log10 colony forming units (CFU) of a tylosin-resistant Enterococcus faecium and allowed
7 days to re-establish equilibrium before administration of 100 µg tylosin mL-1. Total culturable anaerobes
recovered on non-antibiotic supplemented medium, thus inclusive of tylosin-sensitive and -insensitive bac-
teria, ranged from 7.15 to 9.20 log10 CFU mL-1 throughout 8 days of tylosin administration and 6 subse-
quent days without tylosin administration. Recovery of total anaerobes on tylosin-supplemented medium
revealed that populations of total tylosin-insensitive anaerobes ranged from 6.30 to 9.02 log10 CFU mL-1
during the experiment. Concentrations of the introduced tylosin-resistant E. faecium decreased to near
minimum detectable levels (1.3 log10 CFU mL-1) in the cultures before initiation of tylosin administration
and then increased to 6.80 ± 0.28 and 8.30 ± 0.43 log10 CFU mL-1 in RPCF and FC cultures, respectively,
and remained higher than day 0 concentrations for the remainder of the experiment. Endogenous tylosin-
insensitive Enterococcus were undetectable before administration of tylosin but tylosin-resistant E. faecalis
and E. hirea found to have acquired an ermB gene of expected size and sequence of that contained in the
introduced E. faecium were enriched to 7.74 ± 0.37 and 3.85 ± 4.03 after initiation of tylosin administra-
tion. These results demonstrate the acquisition, propagation and persistence of tylosin-resistance in mixed
populations of domestic and feral swine gut microflora.
Keywords: Anaerobic bacteria, antimicrobial resistance, antimicrobial resistance transfer, continu-
ous flow culture, domestic swine, Enterococcus, feral swine, gut microflora, macrolide, tylosin. bac-
terial activity
Correspondence: Robin C. Anderson, [email protected]: +1 -979-260-9317 Fax: +1-979-260-9332
Transfer of tylosin resistance between Enterococcus spp. during continuous-flow culture of feral or domestic porcine gut microbes†
N. Ramlachan1,2, R.C. Anderson1, K. Andrews1, R.B. Harvey1 and D.J. Nisbet1
1United States Department of Agriculture/Agricultural Research Service, Food & Feed Safety Research Unit, College Station, Texas, USA
2Current address: Department of Biosciences, Agriculture and Food Technology, University of Trinidad and Tobago, Piarco, Trinidad, WI
† Mention of trade name, proprietary product, or specific equipment does not constitute a guarantee or warrenty by the USDA and does not imply its approval to the exclusion of other products that may be suitable.
Agric. Food Anal. Bacteriol. 2:111-120, 2012
112 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
InTRoduCTIon
Macrolide antibiotics are commonly used in hu-
man and veterinary medicine, primarily to treat in-
fections caused by Gram-positive bacteria (Gaynor
and Mankin, 2003). In the swine industry, the mac-
rolide antibiotic tylosin is also used as a feed addi-
tive to improve production efficiency (Gaynor and
Mankin, 2003). Concern exists, however, that the
continued agricultural use of antibiotics, especially
their sub-therapeutic use for growth promotion, is
contributing to the emergence and proliferation of
microbial populations resistant to many antibiotics
used to treat medically important diseases (Aar-
estrup, 2005). For macrolide antibiotics, resistance
can occur via acquisition of erm methyltransferases,
which catalytically inactivate the macrolide’s target-
ed binding site, via acquisition of multidrug efflux
pumps or even, albeit infrequently, via point muta-
tions in the microorganism’s genome or inactivation
of the macrolide (Chopra and Roberts, 2001; Gaynor
and Mankin, 2003; Karlsson et al., 2004; Poole, 2005).
Recovery of bacteria harbouring erm genes from
domestic conventionally-raised and non-antibiotic-
raised swine as well as from swine production habi-
tats has been reported (Chee-Sanford et al., 2001;
Jackson et al., 2004; Wang et al., 2005). Likewise,
macrolide resistance in gut bacteria from undomes-
ticated swine has also been reported (Ramlachan et
al., 2007; Stanton and Stoffregen, 2004). However, it
is still not clear just how easily that native popula-
tions of gut bacteria may acquire macrolide resis-
tance and how long acquired resistance may per-
sist within affected populations once the selective
pressure of the antibiotic is removed. For instance,
an immediate increase in proportions of macrolide-
resistant enterococci was observed in pigs following
initiation of subtheapeutic feeding of tylosin to pigs
(Aarestrup and Carstensen, 1998).
More recently, continuous flow cultures estab-
lished with mixed populations of gut bacteria origi-
nating from domesticated and feral swine were used
to assess the effects of low (25 µg mL-1) and high (100
µg mL-1) amounts of tylosin administration on select
populations of resident bacteria (Ramlachan et al.,
2008). Results from that study indicated numbers of
an exogenously introduced macrolide-resistant En-
terococcus faecium were rapidly enriched in continu-
ous flow cultures during treatment with 100 µg tylo-
sin mL-1 but high numbers of the resistant bacterium
were maintained only during tylosin administration.
Moreover, results revealed that tylosin administra-
tion differentially selected for tylosin resistant bacte-
ria from within the autochthonous populations, with
acquisition of tylosin resistance appearing within en-
dogenous Enterococcus spp. in the population from
the domestic pig but not in the population from the
feral pig. However, the source of this resistance ac-
quisition by the endogenous Enterococcus spp. in
the domestic pig culture was not determined. Con-
sequently, the present experiment was conducted
to further investigate the potential development,
propagation, persistence and transfer of resistance
elements within the enterococcal community in the
respective continuous flow cultures.
MATeRIAlS And MeThodS
Continuous flow culture establishment
The two separate mixed populations of porcine
gut bacteria had been used and characterized in
earlier studies and were established in continuous
flow culture as previously described (Harvey et al.,
2002; Hume et al., 2001; Ramlachan et al., 2008). The
culture defined as Recombined Porcine-Derived
Continuous Flow (RPCF) culture had been previ-
ously established with cecal contents obtained from
a traditionally reared domestic pig and the culture
defined as our Feral culture (FC) was established un-
der similar conditions with cecal contents from an
adolescent feral boar. Both cultures were established
and maintained as parent cultures in BioFlo chemo-
stats (New Brunswick Scientific Company, Edison,
NJ) with culture volumes of 550 ml. The culture me-
dium was Viande Levure broth (Barnes et al., 1979)
which was prepared and maintained anaerobically
under a stream of carbon dioxide and infused at 0.40
ml/min which corresponds to a 24 h vessel turnover.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 113
media were incubated 48 to 72 h at 37°C in a Bac-
tron Anaerobic Chamber (Sheldon Labs Manufactur-
ing Inc., Cornelius, OR) and colonies enumerated
on agar medium without tylosin selection include
those in the population that are both sensitive and
insensitive to tylosin; colonies enumerated on agar
medium with 100 µg tylosin mL-1 are only those in
the population that are tylosin-insensitive. For con-
firmation of tylosin resistance, 10 tylosin-insensitive
colonies per population were subsequently selected
and tested as previously described (Ramlachan et al.,
2008). Specific identification of bacteria from select
colonies was achieved using rapid ID 32 STREP, rap-
id 20E, 20NE, 20A, and rapid ID 32 A identification
strips (bioMérieux, Hazelwood, MO). Indole spot
tests (Anaerobe Systems, Morgan Hill, CA), E-testTM
(AB Biodisk, Piscataway, NJ) and fermentation acid
production determined via gas chromatography
(Hinton et al., 1990) were also used in this analysis.
PCR to confirm transfer of resistance genes
Bacteria were lysed with equal volume of 0.2%
(w/v) of Triton X-100 and heated to boiling at 100°C
for 5 min in water bath, allowed to cool and subse-
quently used as templates for PCR. Specific primers
for the following genes: ermB, ermC, ermF, ermG
and ermQ (see Table 1) were used for amplifications
as previously published (Bendle et al., 2004; Frye et
al., 2006; Löfmark et al., 2006; Perrin-Guyomard et
al., 2005). Amplification was carried out on a MJ ther-
mocycler Model PTC200 (Fisher Scientific, Hampton,
NH) using the following conditions: 5 min at 94°C; 35
cycles of 94°C for 1 min, 55 °C for 1 min and 72 °C for
2 min. All PCR products were analyzed by gel elec-
trophoresis (1% agarose in 1x TAE buffer), stained
with ethidium bromide and visualized by UV light.
Sizes of products were determined by comparing
them with a 100 bp ladder (New England Biolabs,
Ipswich, MA).
Cultures were incubated at 39°C and agitated at 100
rpm. Once established in steady state, these respec-
tive parent cultures contained representative species
of genera common to the pig gut (Robinson et al.,
1981) including but not limited to Bacteroides, Clos-
tridium, Enterococcus and Streptococcus (Harvey et
al., 2002; Ramlachan et al., 2008). Of these, B. unifor-
mis (possessing ermG) from culture RPCF and C. ha-
thewayi (possessing ermF) from culture FC showed
resistance to tylosin at MIC >512 µg mL-1; with B. uni-
formis being prominent within culture RPCF and C.
hathewayi being the predominant anaerobe recov-
ered from culture FC (Ramlachan et al., 2007; 2008).
Neither culture contained endogenous Enterococ-
cus spp. with measurable tylosin resistance.
Both parent cultures were used to provide inocula
(10% vol/vol) to establish separate RPCF and FC test
cultures, in duplicate, which after 7 days were each
inoculated with 5 x 109 colony forming units (CFU) of
a multi-drug resistance E. faecium strain so as to pro-
vide an exogenous gene donor exhibiting resistance
to tylosin. The E. faecium strain used here, which was
phenotypically distinguishable from Enterococcus
spp. endogenous to the mixed populations in the
test cultures, as described previously (Ramlachan et
al., 2008). The respective cultures were each allowed
another 7 days culture to re-establish equilibrium as
evidenced by the gradual decline of the inoculated
E. faecium strain, which was present below our limit
of detection (10 CFU mL-1 by day 0). The cultures
were then continually infused with culture medium
containing 100 µg tylosin mL-1 for 8 days, which was
immediately followed by 6 days of infusion of me-
dium lacking tylosin. Collection of fluid samples from
the test cultures began on day -3 relative to tylosin
treatment and continued during 8 days of tylosin
administration and 6 days of tylosin withdrawal. Col-
lected samples were quantitatively cultured, via plat-
ing of 10-fold serial dilutions, to recovery media that
had been prepared with or without 100 µg tylosin
mL-1. Recovery media were anaerobic Brucella blood
agar (Anaerobe Systems, Morgan Hill, CA), for de-
tection of total anaerobes and M Enterococcus (ME)
agar (Becton Dickinson and Company, Sparks, MD)
for detection of Enterococcus spp. Inoculated agar
114 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
Statistical analysis
Log10 transformations of bacterial concentrations
obtained from duplicate cultures were analyzed for
main effects of culture type (RPCF versus FC culture)
and day of cultivation on days 0 through the end of
the experiment using a repeated measures analysis
of variance (Statistix 9 Analytical Software, Tallahas-
see, FL). Samples yielding no detectable colonies of
bacteria were assigned a limit of detection value of
1.3 log10 CFU mL-1 which was our limit of detection.
Comparison of means to values observed on day 0
for each of the respective cultures was accomplished
using a Two Sided Dunnett’s Multiple Comparison
procedure with P < 0.05.
ReSulTS And dISCuSSIon
Continuous flow culture of intestinal microorgan-
isms has been used to study competitive interac-
tions between commensal and pathogenic micro-
flora (Harvey et al., 2002; Hume et al., 2001; Nisbet
et al., 2000) as well as to investigate potential fac-
tors affecting spontaneous acquisition of antibiotic
resistance (Kim et al., 2005). In the present experi-
ment, populations of total culturable anaerobes re-
covered on non-antibiotic supplemented Brucella
blood agar, thus representing numbers of both ty-
losin-sensitive and –insensitive populations, did not
differ (P = 0.30; SEM = 0.13) between the RPCF or
FC cultures, ranging from 7.15 to 9.20 log10 CFU mL-1
throughout the experiment (Figure 1). When tested
for main effects of day, concentrations of total cultur-
able anaerobes were affected only marginally within
the RPCF cultures (P = 0.041) and were not affected
in the FC cultures (P = 0.058) (Figures 1). Moreover,
effects of tylosin on total culturable anaerobes in the
mixed populations were not readily apparent as vi-
able cell counts observed after initiation of tylosin
administration did not differ from those populations
measured on day 0. Populations of total culturable
tylosin-insensitive anaerobes were recovered on
tylosin-supplemented Brucella blood agar and were
observed in both RPCF and FC cultures even before
administration of tylosin administration (Figure 1),
likely due to the presence of the ermG-containing B.
uniformis and the ermF-containing C. hathewayi en-
Table 1. Oligonucleotide primers used in PCR amplification of Enterococcus spp. isolate.
Gene Primer Sequence (5’-3’) Accession Number
Reference
ermB F: TAACGACGAACCTGGCTAAAAT
R: ATCTGTGGTATGGCGGGTAAGAJ243541 Frye et al., 2006
ermC F: AGTACAGAGGTGTAATTTCG
R: AATTCCTGCATGTTTTAAGGNC001386 Frye et al., 2006
ermF F: GCCAACAATGTTGTTGTT
R: CGAAATTGTCCTGACCTGN/A Bendle et al., 2004
ermG F: ACTGCTGAATTGGTAAAGAGATG
R:TGTGCTTATGTTGTAAGGTATGCN/A Löfmark et al., 2006
ermQ F: CACCAACTGATATGTGGC
R: CAATCTACACTAGGCATGN/A Bendle et al., 2004
vatA F: ATAATGAATGGAGCAAACCATAGGATG
R: ACCAATCCAAACATCATTACCN/A
Perrin-Guyomard et al., 2005
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 115
Figure 1. Recovery of total culturable anaerobes (A; containing both tylosin-sensitive and -insensi-tive bacteria) and of tylosin-insentive anaerobes (B) during continuous flow culture of mixed popu-lations (in duplicate) of porcine gut bacteria obtained from a domestic (culture RPCF, circles) or a feral (culture FC, squares) swine. Cultures were experimentally innoculated on day -7 with an exogenous tylosin-resistant Enterococcus faecium. Tylosin administration (100 µg mL-1) began af-ter sampling on day 0 and ceased after sampling on day 8 (as indicated by arrow). Bacteria were quantitatively recovered on Brucella blood agar supplemented without (A) or with 100 µg tylosin mL-1 (B). Tests for differences in bacterial concentrations on days 0 through 14 were accomplished using a repeated measures analysis of variance; asterisks indicate daily concentrations that differ from concentrations observed on day 0 for the respective cultures (SEM = 0.29 and 0.30 for total anaerobes in RPCF and FC cultures, respectively; SEM = 0.43 and 0.35 for tylosin-insensitive an-aerobes in RPCF and FC cultures, respectively).
0
2
4
6
8
10
12
-3 0 3 6 9 12 15
Log 1
0C
FU m
l-1
Day of incubation
Total anaerobes RPCF cultureTotal anaerobes FC culture
A
0
2
4
6
8
10
12
-3 0 3 6 9 12 15
Log 1
0C
FU m
l-1
Day of incubation
Tylosin-insensitive anaerobes RPCF cultureTylosin-insensitive anaerobes FC culture
* *
B
116 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
dogenous to the RPCF and FC cultures, respectively.
Concentrations of total culturable tylosin-insensitive
anaerobes ranged from 6.30 to 9.02 log10 CFU mL-1
and exhibited similar concentration curves as those
observed for total culturable anaerobes (Figure 1).
Consequently, a main effect due to the different cul-
tures was not observed (P = 0.20; SEM = 0.17). Main
effects of day of cultivation were observed on popu-
lations of total culturable tylosin-insensitive anaer-
obes recovered from the RPCF (P = 0.049) and the
FC cultures (P = 0.027) but when compared to num-
bers measured on day 0, the total culturable tylosin-
insensitive anaerobes differed only on days 3 and 4
of tylosin treatment in the RPCF culture (Figure 1).
Populations of the exogenous tylosin-resistant
E. faecium, which characteristically developed into
small, light pink colonies, were inoculated to achieve
6.95 log10 CFU mL-1 in the RPCF and FC cultures 7
days before initiation of tylosin administration. Num-
bers of the exogenous tylosin-resistant E. faecium
declined rapidly soon after inoculation to near or be-
low our level of detection (1.3 log10 CFU mL-1) by day
0 (Figure 2). A main effect of culture on numbers of
exogenous tylosin-resistant E. faecium recovered on
days 0 through 14 was not observed (P = 0.065; SEM
= 0.26) although a main effect of day was observed
for both cultures (P = 0.0001 and < 0.0001 for RPCF
and FC cultures, respectively). In both cases, num-
bers of tylosin-resistant E. faecium began increas-
ing soon after initiation of tylosin administration
Figure 2. Recovery of an experimentally introduced (on day -7) exogenous tylosin-resistant En-terococcus faecium during continuous flow culture of mixed populations (in duplicate) of porcine gut bacteria obtained from a domestic (culture RPCF, circles) or a feral (culture FC, squares) swine. Tylosin administration (100 µg mL-1) began after sampling on day 0 and ceased after sampling on day 8 (as indicated by arrow). Bacteria were quantitatively recovered on M Enterococcus agar supplemented with 100 µg tylosin mL-1. Tests for differences in bacterial concentrations on days 0 through 14 were accomplished using a repeated measures analysis of variance; asterisks indicate daily concentrations that differ from concentrations observed on day 0 for the respective cultures (SEM = 0.60 and 0.58 for RPCF and FC cultures, respectively).
0
2
4
6
8
10
12
-3 0 3 6 9 12 15
Log 1
0C
FU m
l-1
Day of incubation
Tylosin-resistant Enterococcus faecium RPCF culture Tylosin-resistant Enterococcus faecium FC culture
*
*
* * * ** * *
***
* * ** * * *
*
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 117
Figure 3. Recovery of an endogenous tylosin-resistant Enterococcus during continuous flow cul-ture of mixed populations (in duplicate) of porcine gut bacteria obtained from a domestic (culture RPCF, circles) or a feral (culture FC, squares) swine. Cultures were experimentally innoculated on day -7 with an exogenous tylosin-resistant Enterococcus faecium. Tylosin administration (100 µg mL-1) began after sampling on day 0 and ceased after sampling on day 8 (as indicated by arrow). Bacteria were quantitatively recovered on M Enterococcus agar supplemented with 100 µg tylosin mL-1. Tests for differences in bacterial concentrations on days 0 through 14 were accomplished using a repeated measures analysis of variance; asterisks indicate daily concentrations that differ from concentrations observed on day 0 for the respective cultures (SEM = 0.73 and 0.95 for RPCF and FC cultures, respectively).
0
2
4
6
8
10
12
-3 0 3 6 9 12 15
Log 1
0C
FU m
l-1
Day of incubation
Tylosin-resistant endogenous Enterococcus spp. RPCF culture Tylosin-resistant endogenous Enterococcus spp. FC culture
*
* *
* * **
* * **
and although numbers began to decline gradually
after day 6 of treatment they remained higher than
numbers recovered on day 0 for the duration of this
experiment (Figure 2). These findings are consistent
with those observed in our earlier study (Ramlachan
et al., 2008) which, except for a 2 log10 lower inocu-
lation of the tylosin-resistant E. faecium, was con-
ducted similarly to this study. Thus, it appears that
the tylosin resistance in this E. faecium may have
been inducible only in the presence of the antibiotic
or that in the absence of the selective pressure of
tylosin; this tylosin-resistant E. faecium may be less
competitive in the mixed populations.
At the beginning of the present experiment, pop-
ulations of endogenous tylosin sensitive Enterococ-
cus spp., which developed into large and deep red
colonies, achieved concentrations of 7.63 ± 1.0 and
5.65 ± 1.85 log10 CFU mL-1 in the RPCF and FC cul-
tures. Endogenous tylosin-insensitive Enterococcus
spp., were not detected from among these popu-
lations prior to administration of tylosin. Beginning
as soon as 2 days after the start of tylosin adminis-
tration, however, numbers of tylosin-insensitive En-
terococcus colonies exhibiting morphological char-
acteristics indistinguishable from the endogenous
Enterococcus spp. yet clearly distinguishable from
118 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
the exogenous tylosin-resistant E. faecium began
increasing in both of the duplicate RPCF cultures
and in one of the FC cultures. Although numbers of
tylosin-insensitive Enterococcus recovered on days
0 through 14 did not differ between the RPCF and
FC cultures (P = 0.067, SEM = 0.65), a significant ef-
fect of day of cultivation was observed for the RPCF
cultures (P < 0.0001) but not for the FC cultures (P =
0.500) (Figure 3). These populations, which we sus-
pected were derived from the endogenous popula-
tion, achieved a maximum concentration in the RPCF
cultures after 7 days of treatment and persisted at >
6.00 log10 CFU mL-1 even during withdrawal (Figure
3). Populations of tylosin-insensitive Enterococcus
spp. similarly indistinguishable from the endoge-
nous Enterococcus spp. emerged in the FC culture
but not until after 7 days of tylosin administration
(Figure 3). The population in the FC culture persisted
during the tylosin withdrawal period but at a much
lower density than those in the RPCF cultures (Figure
3). Further tests of representative isolates confirmed
that these Enterococcus spp. identified as E. faeca-
lis from the RPCF cultures and as E. hirea from the
FC culture, were indeed tylosin-resistant. Moreover,
PCR amplification of DNA extracted from the en-
dogenous tylosin-resistant Enterococcus spp. from
both RPCF and FC cultures produced PCR products
of the expected size and sequence of the ermB gene
amplicon obtained for the exogenous E. faecium
(Figure 4). However, PCR products for ermC, ermF,
ermG and ermQ were not detected from these en-
dogenous tylosin-resistant Enterococcus spp. These
results suggest that the endogenous enterococci
had acquired resistance to tylosin via acquisition of
the ermB gene from E. faecium. Whereas it is attrac-
tive to speculate that this acquisition occurred most
simply via direct genetic exchange between these
Gram-positive bacteria, we cannot exclude the pos-
sibility of other bacterial hosts may have served as
intermediaries in this transfer.
Figure 4. A PCR product was obtained for ermB (311bp) at the expected size for select colonies of Enterococcus faecium (lane 2), Enterococcus hirea from FC (lane 4) and Enterococcus faecalis from RPCF (lane 5). All colonies were grown on M Enterococcus agar supplemented with 100 µg tylosin mL-1. Colonies tested at the start of the experiment showed no evidence that Enterococcus spp. from the FC (lane 1) or the RPCF (lane 7) possessed the ermB gene. Lanes 3 and 6 are the marker lanes illustrating the product obtained to be approximately 311 bp.
1 2 3 4 5 6 7
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 119
In conclusion, results from this study showed that
tylosin administration differentially promoted en-
richment of tylosin-insensitive bacterial populations
within continuous flow cultures of mixed popula-
tions of gut bacteria derived from gut contents of
a traditionally reared domesticated pig (RPCF) and
a feral pig (FC). In the initial absence of the selec-
tive pressure of 100 µg tylosin mL-1, populations of
an introduced exogenous tylosin-resistant E. fae-
cium declined and did not reappear at substantial
numbers until after the initiation of tylosin adminis-
tration. Conversely, populations of endogenous tylo-
sin-resistant Enterococcus spp., while initially absent
or at undetectable concentrations in the mixed cul-
ture populations, were enriched in cultures derived
from both the domestic and feral pig. However,
once enriched the endogenous tylosin-resistant En-
terococcus populations persisted even during with-
drawal of the selective pressure of tylosin. Results
from our study also provided evidence that at 100
µg tylosin mL-1, genetic transfer of the tylosin resis-
tance occurred between the exogenous E. faecium
introduced to the cultures and the endogenous En-
terococcus spp., as the resistance gene, known as
ermB, was found in the newly-resistant endogenous
Enterococcus spp. These findings have implications
for transfer of antibiotic resistance in other species,
showing that even in feral populations which can be
assumed to have low levels of previous antibiotic ex-
posure; resistance can be obtained in endogenous
bacterial populations after exposure to bacterial
strains with transferrable resistant genes.
ACknowledgeMenTS
We thank Matthew Quattrini for his expert techni-
cal assistance.
RefeRenCeS
Aarestup, F. M. 2005. Veterinary drug usage and an-
timicrobial resistance in bacteria of animal origin.
Basic Clin. Pharmacol. Toxicol. 96:271-281.
Aarestup, F. M., and B. Carstensen. 1998. Effect of ty-
losin used as a growth promoter on the occurrence
of macrolide-resistant enterococci and staphylo-
cocci in pigs. Microb. Drug Resist. 4:307-312.
Barnes, E. M., C. S. Impey, and B. J. H. Stevens. 1979.
Factors affecting the incidence of and anti-salmo-
nella activity of the anaerobic cecal flora of the
young chick. J. Hygiene 82:263-283.
Bendle, J. S., P. A. James, P. M. Bennett, M. B. Avi-
son, A. P. MacGowan, and K. M. Al-Shafi. 2004. Re-
sistance determinants in strains of Clostridium dif-
ficile from two geographically distinct populations.
Int. J. Antimicrob. Agents 24:619-621.
Chee-Sanford, J. C., R. I. Aminovm, I. J. Krapac, N.
Garrigues-Jeanjean, and R. I. Mackie. 2001. Occur-
rence and diversity of tetracycline resistance genes
in lagoons and groundwater underlying two swine
production facilities. Appl. Environ. Microbiol.
67:1494-1502.
Chopra, I., and M. Roberts. 2001. Tetracycline resis-
tance: mode of action, applications, molecular bi-
ology, and epidemiology of resistance. Microbiol.
Mol. Biol. Rev. 65:232-260.
Frye, G. J., T. Jesse, F. Long, G. Rondeau, S. Porwol-
lik, M. McClelland, C. R. Jackson, M. Englen, and P.
J. Fedorka-Cray. 2006. DNA microarray detection
of antimicrobial resistance genes in diverse bacte-
ria. Int. J. Antimicrob. Agents 27:138-151.
Gaynor, M., and A.S. Mankin. 2003. Macrolide anti-
biotics: binding site, mechanism of action, resis-
tance. Curr. Top. Med. Chem. 3:949-961.
Harvey, R. B., R. E. Droleskey, M. E. Hume, R. C. An-
derson, K. J. Genovese, K. Andrews, and D.J. Nis-
bet. 2002. In vitro inhibition of Salmonella enterica
serovars Choleraesuis and Typhimurium, Esche-
richia coli F-18, and Escherichia coli O157:H7 by
a porcine continuous-flow competitive exclusion
culture. Curr. Microbiol. 45:226-229.
Hume, M. E., D. J. Nisbet, S. A. Buckley, R. L. Ziprin,
R. C. Anderson, and L. H. Stanker. 2001. Inhibition
of in vitro Salmonella Typhimurium colonization in
porcine cecal bacteria continuous-flow competi-
tive exclusion cultures. J. Food Prot. 64:17-22.
Jackson, C. R., P. J. Fedorka-Cray, J. B. Barrett, and S.
R. Ladely. 2004. Effects of tylosin use on erythromy-
120 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
cin resistance in enterococci isolated from swine.
Appl. Environ. Microbiol. 70:4205-4210.
Karlsson, M., C. Fellström, K.-E. Johansson, and
A. Franklin. 2004. Antimicrobial resistance in
Brachyspira pilosicoli with special reference to
point mutations in the 23S rRNA gene associated
with macrolide and lincosamide resistance. Micro-
bial Drug Resist. 10:204-208.
Kim, W. K., N. Karabasil, S. Bulajic, K. D. Dunkley, T.
R. Callaway, T. L. Poole, S. C. Ricke, R. C. Anderson,
and D. J. Nisbet. 2005. Comparison of spontane-
ous antibiotic frequency of Salmonella Typhimuri-
um growth in glucose amended continuous cul-
ture at slow and fast dilution rates. J. Environ. Sci.
Health, Part B 40:475-484.
Löfmark, S., C. Jernberg, J. K. Jansson, and C. Ed-
lund. 2006. Clindamycin-induced enrichment and
long-term persistence of resistant Bacteroides spp.
and resistance genes. J. Antimicrob. Chemother.
58:1160-1167.
Nisbet, D. J., R. C. Anderson, D. E. Corrier, R. B. Har-
vey, and L. H. Stanker. 2000. Modeling the surviv-
ability of Salmonella typhimurium in the chicken
cecae using an anaerobic continuous-culture of
chicken cecal bacteria. Microb. Ecol. Health Dis.
12:42-47.
Perrin-Guyomard, A., C. Soumet, R. Leclercq, F.
Doucet-Populaire, and P. Sanders. 2005. Antibiotic
susceptibility of bacteria isolated from pasteur-
ized milk and characterization of macrolide-lincos-
amide-streptogramin resistance genes. J. Food
Prot. 68:347-52.
Poole, K. 2005. Efflux-mediated antimicrobial resis-
tance. J. Antimicrob. Chemother. 56:20-51.
Ramlachan, N., R. C. Anderson, K. Andrews, R. B.
Harvey, and D. J. Nisbet. 2008. A comparative
study on the effects of tylosin on select bacteria
during continuous flow culture of mixed popula-
tions of gut microflora derived from a feral and a
domestic pig. Foodborne Path. Dis. 5:21-31.
Ramlachan, N., R. C. Anderson, K. Andrews, G. La-
ban, and D. J Nisbet. 2007. Characterization of an
antibiotic resistant Clostridium hathewayi strain
from a continuous flow exclusion chemostat cul-
ture derived from the cecal contents of a feral pig.
Anaerobe 13:153-160.
Robinson, I. M., M. J. Allison, and J. A. Bucklin. 1981.
Characterization of the cecal bacteria of normal
pigs. Appl. Environ. Microbiol. 41:950-955.
Stanton, T. B., and W. C. Stoffregen. 2004. Tetracy-
cline resistant bacteria in organically raised and fe-
ral swine. 104th American Society for Microbiology
General Meeting. (Abstr.# Z-029).
Wang, Y., G. R. Wang, N. B. Shoemaker, T. R. White-
head, and A. A. Salyers. 2005. Distribution of the
ermG gene among bacterial isolates from por-
cine intestinal contents. Appl. Environ. Microbiol.
71:4930-4934.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 121
www.afabjournal.comCopyright © 2012
Agriculture, Food and Analytical Bacteriology
ABSTRACT
The objective of this study was to compare the bark and wood of low, non-irrigated, and high, irrigated,
specific gravity poplar clones for overall sugar recovery and sugar-degradation inhibitory byproducts
production when pretreated with dilute acid (160°C for 60 min in unstirred batch stainless steel reactors),
coupled to enzymatic hydrolysis. Overall, the combined xylose and glucose recoveries for low and high
specific gravity bark were 18.65 and 24.82 (g of sugar per 100 g of biomass), respectively, and 37.04 and
35.53 (g of sugar per 100 g of biomass) for low and high specific gravity wood, respectively. Total sugar
yields of 62 and 57% were calculated for low and high specific gravity wood, while sugar yields of 49 and
71% were obtained for low and high specific gravity bark. The glucose recovery was 48% for high specific
gravity wood and 55% for low specific gravity wood. The combined glucose and xylose content of low and
high specific gravity poplar wood was similar; yet, the glucose recovery in low specific gravity wood was
higher by 7%. The average ratio of sugar-derived inhibitory byproducts to potential sugars in high and low
specific gravity wood was 0.34; a similar value for bark was 0.66. Given the negative effects of inhibitory
byproducts on the bioprocessing chain, it may be prudent to omit bark when saccharifying poplar. The
low specific gravity clone displayed two advantages: 1) higher glucose recovery; and, 2) the ability to be
cultivated under dry land conditions. In summary, low specific gravity poplar clones, with rainfall as the sole
water supply, could prove to be viable feedstock sources.
Keywords: Poplar, dilute acid pretreatment, enzymatic hydrolysis, xylose, glucose, furfural, hydroxymeth-ylfurfural, formic acid, and acetic acid.
Correspondence: D. J. Carrier [email protected]: 479-575-2542; Fax: 479-575-2689
Sugar Recovery from the Pretreatment/Enzymatic Hydrolysis of High and Low Specific Gravity Poplar Clones
A. C. Djioleu1, A. Arora2, E. M. Martin1, J. A. Smith1, M. H. Pelkki3, and D. J. Carrier1
1Department of Biological and Agricultural Engineering, University of Arkansas, 203 Engineering Hall, Fayetteville, AR 72701
2Division of Microbiology, Indian Agricultural Research Institute, New Delhi, India 1100123School of Forest Resources, University of Arkansas at Monticello, Monticello, AR 71656
Agric. Food Anal. Bacteriol. 2:121-131, 2012
122 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
InTRoduCTIon
The development of second generation bioetha-
nol from lignocellulosic biomass shows significant
promise for the conservation of petroleum crude
and movement toward energy security. Cellulose
and hemicellulose, the most abundant constituents
of lignocellulosic biomass can be converted into fer-
mentable sugars for the production of ethanol. Dif-
ferent forestry products and residues, agricultural
byproducts, grasses, food processing and munici-
pal solid wastes can serve as lignocellulosic feed-
stock. Eastern cottonwood (Populus deltoides) is a
prevalent understory species in the southeast United
States. It is fast-growing, drought resistant, and has
the potential for becoming an economically valuable
feedstock for the production of cellulosic biofuels
(Kim et al., 2009; Sannigrahi and Ragauskas, 2010).
Sannigrahi and Ragauskas (2010) report that pop-
lar wood contains 39 to 49% (average 44%) glucan,
13 to 19% (average 15%) xylan and 17 to 29% (aver-
age 24%) lignin, on a dry weight basis. The pretreat-
ment of lignocellulosic biomass and subsequent en-
zymatic hydrolysis of cellulose to fermentable sugars
are the most cost intensive steps in converting bio-
mass to ethanol. Among the existing pretreatment
technologies, dilute acid pretreatment is preferred
since it removes a large fraction of the xylan and
opens pores for subsequent enzymatic hydrolysis of
the cellulose (Sannigrahi et al., 2011).
Martin et al. (2011) reported on the recovery of
xylose, the main component of hemicellulose, from
dilute acid pretreated high and low specific gravity
poplar clones. Pretreating in 1% dilute acid for 100
min in non-stirred reactors resulted in xylose recov-
eries of 55 and 50% for low and high-density poplar
clones. The low specific gravity clone was cultivated
under dry land conditions. These findings are im-
portant both environmentally and economically be-
cause not only would the omission of irrigation save
water, but a lack of irrigation would also reduce the
cost of transporting and/or pumping water to plant-
ing locations. This study is a continuation of past
research to further evaluate the saccharification ef-
ficiency of high and low specific gravity hybrid pop-
lar wood. The goal of this work is to maximize the
yield of hemicellulosic sugar, xylose, from dilute acid
pretreatment, and to link pretreatment to enzymatic
hydrolysis to yield the cellulosic sugar, glucose. In
addition, a mass balance of the monomeric sugars,
including sugar-degraded inhibitory byproducts,
was prepared. An analysis of these data was used
to determine differences in sugar recovery from the
high and low specific gravity clones, and to couple
the information with the decrease in sugar recovery
due to the production of degradation compounds
caused by the detrimental effects of dilute acid pre-
treatment.
MATeRIAlS And MeThodS
Poplar feedstock
The cottonwood clones were from Eastern Texas.
The clones were grown at the University of Arkansas
Pine Tree Branch Station; the 14 year-old mid-rota-
tion stands were harvested and used for this study.
The high specific gravity clones, S13C20, were irri-
gated during the first 10 yr growth and had a spe-
cific gravity of 0.48. The low specific gravity clones,
S7C15, were not irrigated and had a specific gravity
of 0.40.
Percent moisture/solid determination
Wood chips were ground to a 20 mesh particle size
using a Wiley Mini Mill (Torget et al., 1988). Ground
samples (approximately 0.5 g) were analyzed for per-
cent moisture/solid content using an Ohaus MB45
Moisture Analyzer (Parsippany, NJ).
Pretreatment
In preparing the biomass, one gram of 20 mesh
material and 20 mL of 0.98% H2SO4 were added to
thick-walled stainless steel reactors, (interior diam-
eter 14.22 mm, wall thickness 5.59 mm, length 200
mm, for a total chamber volume capacity of 32 ml)
and then placed in a fluidized sand bath (Techne In-
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 123
corporated, Burlington, NJ) at 160 °C for 60 min with
an air flow of 3.0 cubic foot per min.
The volume of the resulting hydrolysate was mea-
sured and recorded for quantification. Samples were
filtered through #1 Whatman filter paper, using a
Buchner funnel. Liquid fractions were analyzed by
high pressure liquid chromatography (HPLC) for the
presence of degradation compounds such as: fur-
fural, hydroxmethylfurfural (HMF), formic acid and
acetic acid prior to neutralizing. After neutralizing
with calcium carbonate, an aliquot of the liquid frac-
tion was analyzed by HPLC for carbohydrates. To
aid the enzymatic hydrolysis, the recovered solids
were washed with 30 mL of Millipore water, stirred
for 30 min, and filtered (Balan et al., 2009; Kumar and
Wyman, 2009). Liquid fractions from filtration were
analyzed by HPLC for both carbohydrates and inhibi-
tory compounds.
Enzymatic hydrolysis
To prepare for enzymatic hydrolysis, one gram of
solids, 500 µL of Accellerase ®1500 (Genencor) as
specified by the manufacturer, 5 mL of citrate buf-
fer, pH 4.8, and up to 10 mL of Millipore water were
added to 50 mL amber bottles. The bottles were
placed in a 55 °C shaking water bath for 48 h. Af-
ter completion of enzymatic hydrolysis, the samples
were boiled to denature the enzymes; the pH was
adjusted to neutral, and the samples were analyzed
for carbohydrate content.
Compositional Analysis
Procedure for compositional analysis of the bio-
mass followed those established in the technical re-
ports from the National Renewable Energy Labora-
tory (NREL) (Sluiter et al., 2008ab; Sluiter et al., 2011).
Poplar biomass, either wood or bark, was dried in a
120°C oven overnight prior to analysis.
HPLC analysis
Liquid aliquots from pretreatment, enzymatic
hydrolysis, and compositional analysis were fil-
tered through a 0.2 µm syringe filter, and analyzed
for carbohydrate content with a Waters 2695 HPLC
equipped with a Shodex SP-G pre-column and
SP0810 column (heated to 85 ºC) with water as the
eluent at a flow rate of 0.2 mL/min. Carbohydrates
were detected with a Waters 2414 Refractive Index
Detector. This method was adapted from National
Renewable Energy Laboratory (Sluiter et al., 2009a).
In detecting inhibitory compounds, liquid fractions
(that had not been neutralized) were filtered through
a 0.2 µm syringe filter and analyzed by Waters Al-
liance 2695 Separation Module, equipped with an
Aminex HPX-87H ion exchange column (300 mm X
7.8 mm), heated at 55 °C. Samples were run at a flow
rate of 0.6 mL/min and compounds were detected
by Waters 2996 Photodiode Array Detector at 280
nm for furfural and HMF and 210 nm for formic acid
and acetic acid.
Statistical Analysis
Calculations of carbohydrate and degradation
compounds (HMF, furfural, formic acid, and acetic
acid) were obtained using Microsoft Office Excel
2007. Analysis of the variance (ANOVA) was deter-
mined using JMP 9.0, LSMeans Differences Student’s
t, with α= 0.050.
ReSulTS And dISCuSSIon
The compositional analysis of oven-dried high
and low specific gravity bark and wood is presented
in Table 1. The percent solids for the compositional
analysis were 96% and 97%, respectively, for high and
low gravity poplar wood. Extractive concentrations
were similar for low and high specific gravity bark;
and for low and high specific gravity wood. The aver-
age xylose content was 12.3% for high specific grav-
ity wood and 13.3% for low specific gravity wood.
The average content was not significantly different
for the two wood densities. The average glucose
content was 46.3% for low specific gravity wood, and
49.7% for high specific gravity wood. Overall, these
values are similar to values previously reported by
124 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
Table 1. Compositional analysis of wood and bark from low and high specific gravity poplar
Compositional Analysis, g per 100 g of Biomass
Biomass Glucose Xylose Extractives Lignin/Ash Ash
Low wood 46.3 ± 2.57 13.3 ± 1.08 1.24 ± 0.26 18.48 ± 1.37 0.58 ± 0.13
High wood 49.7 ± 0.95 12.3 ± 0.26 1.48 ± 0.27 16.44 ± 1.73 0.37 ± 0.06
Low bark 25.8 ± 1.07 12.3 ± 0.87 8.58 ± 0.00 34.71 ± 2.46 4.20 ± 0.06
High bark 20.8 ± 2.44 14.2 ± 2.89 6.60 ± 0.00 37.89 ± 2.49 4.64 ± 0.39
Figure 1. Glucose and xylose recovery based on compositional analysis of low and high specific gravity wood (A) and low and high specific gravity bark (B) after dilute acid pretreatment and en-zymatic hydrolysis
0
20
40
60
80
100
120
Glucose Xylose
Pe
rce
nt
Re
cove
ry
Low wood
High wood
A
0
20
40
60
80
100
120
Glucose Xylose
Pe
rce
nt
Re
cove
ry
Low bark
High bark
B
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 125
Kim et al. (2009), Min et al. (2011), Sannigrahi et al.
(2010), and the United States Department of Energy
(2010). The bark composition was very different than
the composition of wood. Bark had on average ap-
proximately 25 g per 100 g of biomass less glucose
than that of wood. The low specific gravity clone’s
bark was thick and rough, in comparison to the high
specific gravity clone’s bark that was thinner and
smooth.
Martin et al. (2011) reported that dilute acid pre-
treatment of wood at 140ºC from the lower specific
gravity clone yielded the highest average xylose re-
covery of 56%. In this work, dilute acid pretreatment
of high specific gravity and of low specific gravity
clones at 140ºC and 160ºC resulted in xylose recov-
eries of 49 and 45%, respectively, which is lower than
previously reported. Martin et al. (2011) did not in-
tegrate pretreatment and enzymatic hydrolysis, and
overall carbohydrate recoveries were not calculated.
Moreover, carbohydrate yields were based on base-
line composition data provided by Kim et al. (2009).
In the present study, the pretreatment and hydrolysis
steps were integrated and calculations were based
on composition values presented in Table 1.
Of the pretreatment conditions explored by Mar-
tin et al. (2011), it was determined that the optimum
time/temperature parameters for dilute acid pre-
treatment, allowing for maximum glucose recovery
in subsequent enzymatic hydrolysis of poplar wood,
were 160°C for 60 min in 1% dilute acid. Xylose and
glucose recoveries from low and high specific grav-
ity poplar wood and bark are presented in Figure 1.
Monomeric sugar recovery was based on dry weight
percentages of the theoretical compositional analy-
sis (average percent solid of high specific gravity
wood and low specific gravity wood prior to pretreat-
ment was taken as 90%). Relating this to the percent
recovery after dilute acid pretreatment and enzymat-
ic hydrolysis, the xylose recovery was approximately
96% for high specific gravity and 87% for low spe-
cific gravity wood. The glucose recovery was 48% for
high specific gravity wood, and 55% for low specific
gravity wood. Results from this work indicated that
glucose yields from low specific gravity wood were
significantly higher than from high specific gravity
wood. Glucose recovery was adversely affected by
the high percentages of degradation products, par-
ticularly formic acid. Formic acid composition in low
specific gravity wood pretreatment hydrolysates was
as high as 15%, and approximately 14% in high spe-
cific gravity wood pretreatment hydrolysates.
Martin et al. (2011) also reported that the highest
xylose recovery from the dilute acid pretreatment of
low specific gravity bark was 31%, observed at 160°C
for 60 min. In varying the pretreatment temperatures
between 140°C and 200°C resulted in recoveries be-
tween 10 and 28%. The present work reports that di-
lute acid pretreatment at 160°C for 60 min, coupled
to enzymatic hydrolysis, resulted in higher overall
xylose and glucose recoveries. Specifically, the over-
all glucose and xylose recoveries were 37 and 73%,
respectively, for low specific gravity bark and 62 and
Table 2. Carbohydrate recovery from wood and bark in low and high specific gravity poplar
Recovery of Sugars, g per 100 g of Biomass
Pretreatment/Wash Enzymatic HydrolysisTotal
Glucose Xylose Glucose Xylose
Low Wood 3.53±0.20 11.35±1.85 21.95±1.42 0.21±0.02 37.04
High Wood 4.01±0.22 11.73±0.31 19.72±0.98 0.07±0.03 35.53
Low Bark 6.21±1.00 7.18±2.26 3.43±0.83 1.83±1.00 18.65
High Bark 6.57±0.73 8.94±3.02 6.40±0.55 2.91±0.89 24.82
126 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
84%, respectively, for high specific gravity bark. Thus,
as presented in Table 2, the combined xylose and
glucose recoveries for low specific gravity and high
specific gravity bark were 18.65 and 24.82 (g of sug-
ars per 100 g of biomass), respectively; and, 37.04
and 35.53 (g of sugars per 100 g of biomass) for low
and high specific gravity wood, respectively.
Poplar is touted as a potentially important woody
energy crop, and many groups have reported sugar
recovery from this feedstock. Negro et al. (2003),
using steam explosion pretreatment at 210°C for 4
min coupled to enzymatic hydrolysis, reported re-
coveries of 60 and 41% for glucose and xylose, re-
spectively. Pan et al. (2006, 2007) investigated the
conversion of a commercially available poplar clone
NM-6, Populus nigra X Populus maximowiczii, using
ethanol organosolv pretreatment with hot aqueous
ethanol. This process was implemented to not only
recover usable sugars for fermentation to ethanol,
but also to obtain a range of valuable lignin based
co-products. At 60 min 180°C pretreatment with
1.25% sulfuric acid and 60% ethanol, the reported
yields were 82% for glucose and 72% for xylose,
based on initial biomass composition. The effect of
various pretreatment technologies combined with
different plant cell wall hydrolyzing enzyme concen-
trations was reported by the Consortium for Applied
Fundamentals and Innovation (CAFI), sharing iden-
tical characterized poplar feedstock, thus, enabling
the comparison of processing technologies. The
series of papers were reported in one single 2009
issue of Biotechnology Progress. Balan et al. (2009)
reported glucan recoveries of 93% and xylan recov-
eries of 65%, when using ammonia fiber expansion
(AFEX) pretreatment coupled to enzymatic hydro-
lysis. Pretreatment conditions for optimum results
were a temperature of 180°C, 2:1 ammonia to bio-
mass loading, 23% moisture for a 30 min treatment,
with biomass milled to 50 mm. Using steam pretreat-
ment at 200°C, for 5 min with 3% SO2, Bura et al.
(2009) recovered 100% of the glucose and 89% of the
xylan. Kumar and Wyman (2009) compared a number
of the saccharification conditions and maximum xy-
lose recoveries using AFEX, ammonia recycled per-
colation (ARP), dilute acid, lime, controlled pH, and
sulfur dioxide (SO2) pretreatments also, linked to en-
zymatic hydrolysis. The maximum xylose recoveries
were 72.3, 94.6, 70.9, 72.9, 105.5 and 85.3 %, respec-
tively for the listed pretreatment techniques. Simi-
larly, Kumar and Wyman (2009) reported maximum
glucose recoveries of 61.1, 77.0, 89.8, 73.1, 65.9 and
90.8 %, respectively for AFEX, ammonia recycled
percolation (ARP), dilute acid, lime, controlled pH
and sulfur dioxide (SO2) pretreatments linked to en-
zymatic hydrolysis. Importantly, the work of Kumar
and Wyman (2009) reported that for the above list
of leading pretreatments, the maximum sugar yields
were 64.0, 79.6, 84.9, 71.9, 76.1 and 89.4 %, respec-
tively, indicating that SO2 pretreatment maximized
sugar recovery. In this work, total sugar yields of 62
and 57% were calculated for low and high specific
gravity wood, while sugar yields of 49 and 71% were
determined for low and high specific gravity bark.
Results reported in this work showed that the calcu-
lated recovery is similar to what was obtained with
AFEX, but lower than what can be derived from di-
lute acid and SO2 pretreatments (Kumar and Wyman,
2009). However, this work shows that more sugars
are recovered from low specific gravity poplar.
As illustrated by the CAFI work, there are a num-
ber of available pretreatment technologies; howev-
er, the dilute acid pretreatment, although it contains
many drawbacks, is more than likely to be adopted
at the deployment scale because of its low cost and
ease of use (Sannigrahi et al., 2011). Dilute acid pre-
treatment has been used for hardwoods (Esteghla-
lian et al., 1997; Jung et al., 2010; Lloyd and Wyman,
2005; Lu et al., 2009; Martin et al., 2010; Martin et al.,
2011; Schell et al., 2003; Torget et al. 1998; Wyman et
al., 2005; Wyman et al., 2008). However, dilute acid
pretreatment, which involves the use of high temper-
atures, is a harsh treatment that produces inhibitory
byproducts, including acetic acid, furfural, hydroxy-
methylfurfural (HMF), and formic acid (Palmqvist and
Hahn-Hagerdal, 2000). These degradation chemicals
reduce the sugar yields as well as ethanol yields by
50 to 60% (Du et al., 2010). Shuai, et al. (2010) com-
pared dilute acid pretreatment to sulfur dioxide-cat-
alyzed steam explosion (SPROL), using the softwood,
spruce, as the biomass feedstock. Known inhibitors
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 127
Figure 2. Pretreatment hydrolysate from low specific gravity wood (A) and low specific gravity bark (B). UV Chromatogram was acquired at 210 nm. The retention times of formic acid, acetic acid, HMF and furfural were approximately 13, 15, 30 and 44 min, respectively
A
B
128 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
were 35% lower with SPORL treatment compared
to dilute acid treatment. However, SPORL pretreat-
ments are costly and difficult to scale-up, further pro-
moting the use of dilute acid pretreatment.
Xylose is degraded into furfural, and further into
formic acid, while glucose is degraded into HMF, and
further degraded into formic acid and levulinic acid
(Palmqvist and Hahn-Hagerdal, 2000). In addition,
mannose and galactose go through similar degra-
dation pathways as glucose (Palmqvist and Hahn-
Hagerdal, 2000). Therefore, the yields of formic acid
during dilute acid pretreatment would increase not
only from degradation of xylose and glucose, but
also from the degradation of mannose and galac-
tose. Figure 2 presents a typical chromatogram from
wood and bark dilute acid hydrolysates, where for-
mic acid, acetic acid, HMF and furfural had retention
times of 13, 15, 30 and 44 min, respectively. Unfortu-
nately, many of the compounds seen in the UV trace
in Figure 2 remain unidentified. The intensity of the
unidentified 6.1 min peak in the bark UV trace is over
1 absorbance units, dwarfing all of the other peaks in
the chromatogram. Moreover, the work of Du et al.
(2010) illustrates that a UV trace does not detect all
of the compounds that are present. While compar-
ing the chromatograms of dilute acid pretreatment
corn stover prehydrolysates, Du et al. (2010) detect-
ed 38 compounds when using mass spectrometry
and only two compounds with UV detection. Thus,
the chromatograms presented in Figure 2 may not
fully illustrate the entire slate of compounds present
in poplar dilute acid hydrolysates.
Table 3 represents the calculated yields, of in-
hibitory products (g per 100 g of biomass) that were
generated from wood and bark when pretreating
with dilute acid. The values in Table 3 values were
calculated by tying the concentrations of inhibitors
in the prehydrolysates (determined by HPLC) to the
volume of hydrolysate and masses of the pretreated
feedstock. Of the four monitored inhibitory prod-
ucts, formic acid displayed the highest concentra-
tion, ranging from 14 to 15 g per 100 g of hydrolyzed
biomass. Formic acid is a known enzymatic hydrolysis
inhibitor (Cantarella et al., 2004). Hodge et al. (2008)
illustrated unequivocally that if inhibitory products,
such as formic acid, were not removed from the pre-
treated biomass, the reactor could not be loaded
with more than 15% (v/v). By washing the pretreated
biomass with three volumes of water, to remove the
inhibitory products from the pretreated corn stover
biomass, Hodge et al. (2008) showed that the reactor
could be loaded to 30% (v/v), illustrating the impor-
tance of removing or minimizing inhibitory products.
Similarly, Kumar and Wyman (2009) reported that
the enzymatic hydrolysis step could be enhanced by
10% when washing the dilute acid pretreated bio-
mass prior to treatment with enzymes. In this work,
the ratio of inhibitory compounds (Table 3) to po-
tential sugars in wood and bark (Table 2) was 0.34
and 0.66 (g per g), respectively. Given the negative
Table 3. Inhibitory products detected in low and high specific gravity poplar wood and bark di-lute acid pre-hydrolysates
Inhibitors in Prehydrolysates, g per 100 g of Biomass
Biomass HMF Furfural Formic acid Acetic acid
Low wood 0.13±0.24 1.90±0.21 15.01±2.67 4.46±0.92
High wood 0.12±0.00 1.72±0.06 13.59±0.18 4.88±0.05
Low bark 0.46±0.11 2.66±0.64 14.08±1.62 5.21±0.76
High bark 0.54±0.12 2.49±0.51 16.71±1.86 6.17±0.60
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 129
effects of the inhibitory compounds on the biopro-
cessing chain, as highlighted by Hodge et al. (2008)
and Kumar and Wyman (2009), it may be prudent to
omit bark when saccharifying poplar.
From a sustainability perspective, growing feed-
stock with minimum amounts of water can be a sub-
stantial advantage. The low specific gravity poplar
was cultivated in southern Arkansas for 15 years, us-
ing rainfall as the sole water supply. The data pre-
sented in this study highlight, in fact, that the low
specific gravity clone yields 4% more carbohydrates
than its high density irrigated counterpart. This in-
creased carbohydrate yield could offset the greater
growth observed in irrigated clones and will play a
role in determining the total cost of carbohydrate
production from poplar plantations. Data from this
present study illustrate that non-irrigated low spe-
cific gravity clones displayed comparable feedstock
characteristics to those of irrigated high specific
gravity clones. The study presented by Negro et al.
(2003) was also concerned with water usage, and
stated that Populus nigra is promising for south and
central Europe, due to the high yield and drought
resistance of this species.
ConCluSIonS
This study reports that non-irrigated 15 year-old
low specific gravity poplar wood yielded compa-
rable percentages of xylose, but significantly higher
glucose percentage recovery, when pretreated with
dilute acid coupled to enzymatic hydrolysis than its
irrigated high specific gravity counterpart. Although
this is a preliminary study, specific gravity may be an
important property to predict the saccharification
potential of poplar biomass.
ACknowledgeMenTS
The authors would like to thank the University of
Arkansas, Division of Agriculture, and the Depart-
ment of Biological and Agricultural Engineering, for
financial assistance. The authors would also like to
acknowledge National Science Foundation award
no. 0828875; Department of Energy award no.
08GO88035 for the pretreatment equipment and
support of EMM; and CRREES National Research
Initiative award no. 2008-01499 for the HPLC instru-
ment. The authors are very grateful to Dr. Ed Clau-
sen for critically reviewing this manuscript.
RefeRenCeS
Balan, V., L. da Costa Sousa, S. P. S. Chundawat, D.
Marshall, L. N. Sharma, C. K. Chambliss, and B. E.
Dale. 2009. Enzymatic digestibility and pretreat-
ment degradation products of AFEX-treated hard-
woods (Populus nigra). Biotechnol. Prog. 25:365-
375.
Bura, R., R. Chandra, and J. Saddler. 2009. Influence
of xylan on the enzymatic hydrolysis of steam-pre-
treated corn stover and hybrid poplar. Biotechnol.
Prog. 25:315-322.
Cantarella, M., L. Cantarella, A. Gallifuoco, A. Spera,
and F. Alfani. 2004. Effect of inhibitors released
during steam-explosion treatment of poplar wood
on subsequent enzymatic hydrolysis and SSF. Bio-
technol. Prog. 20:200-206.
Du, B., L. Sharma, C. Becker, S. Chen, R. Mowery, P.
van Walsum P and K. Chambliss. 2010. Effect of
varying feedstock-pretreatment chemistry com-
binations on the formation and accumulation of
potentially inhibitory degradation produces in bio-
mass hydrolysates. Biotechnol. Bioeng. 107:430-
440.
Esteghlalian, A., A. G. Hashimoto, J. J. Fenske, and
M. H. Penner. 1997. Modeling and optimization of
the dilute-sulfuric acid pretreatment of corn sto-
ver, poplar and switchgrass. Bioresour. Technol.
59:129-136.
Hodge, D., N. Karim, D. Schell and J. Macmillan.
2008. Soluble and insoluble solids contributions to
high-solids enzymatic hydrolysis of lignocellulose.
Bioresour. Technol. 99:8940-8948.
Jung, S., M. Foston, M. C. Sullards, and A. J. Ragaus-
kas. 2010. Surface characterization of dilute acid
pretreated Populus deltoides by ToF-SIM. Energy
130 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
Fuels 24:1347-1357.
Kim, Y., N. S. Mosier, and M. R. Ladisch. 2009. Enzy-
matic digestion of liquid hot water pretreated hy-
brid poplar. Biotechnol. Prog. 25:340-348.
Kumar, R., and C. E. Wyman. 2009. Effects of cellu-
lose and xylanases enzymes on the deconstruction
of solids from pretreatment of poplar by leading
technologies. Biotechnol. Prog. 25:302-314.
Lloyd, T. A., and C. Wyman. 2005. Combined sugar
yields for dilute sulfuric acid pretreatment of corn
stover followed by enzymatic hydrolysis of the re-
maining solids. Bioresour. Technol. 96:1967-1977.
Lu, Y., R. Warner, M. Sedlak, N. Ho, and N. S. Mosier.
2009. Comparison of glucose/xylose cofermenta-
tion of poplar hydrolysates processed by differ-
ent pretreatment technologies. Biotechnol. Prog.
25:349-356.
Martin, E. M., J. Duke, M. Pelkki, E. Clausen, and
D. J. Carrier. 2010. Sweetgum (Liquidambar sty-
raciflua L.): Extraction of shikimic acid coupled to
dilute acid pretreatment. Appl. Biochem. Biotech-
nol. 162:1660-1668.
Martin, E., K. Bunnell, C. Lau, M. Pelkki, D. Patterson,
E. Clausen, J. Smith, and D. J. Carrier. 2011. Hot
water and dilute acid pretreatment of high and low
specific gravity Populus deltoides clones. J. Ind.
Microbiol. Biotechnol. 38:355-361.
Min, D., L. Quanzi, H. Jameel, V. Chiang, and H.
Chang. 2011. Comparison of pretreatment pro-
tocols for cellulase-mediated saccharification of
wood derived from transgenic low-xylan lines of
cottonwood (P. trihocarpa). Biomass Bioenergy 35:
3514-3521.
Negro, M. J., P. Manzanares, I. Ballesteros, J. M.
Oliva, A. Cabanas, and M. Ballesteros. 2003. Hy-
drothermal pretreatment conditions to enhance
ethanol production from poplar biomass. Appl.
Biochem. Biotechnol. 105-108:87-100.
Palmqvist, E.and B. Hahn-Hagerdal. 2000. Fermen-
tation of lignocellulosic hydrolysates. II: inhibitors
and mechanisms of inhibition. Bioresour. Technol.
74:25-33.
Pan, X., N. Gilkes, J. Kadla, K. Pye, S. Saka, D. Gregg,
K. Ehara, D. Xie, D. Lam, and J. Saddler. 2006. Bio-
conversion of hybrid poplar to ethanol and co-
products using an organosolv fractionations pro-
cess: Optimization of process yields. Biotechnol.
Bioeng. 94:851-861.
Pan, X., D. Xie, K-Y Kang, S-LYoon, and J. N. Sad-
dler. 2007. Effect of organosolv ethanol pretreat-
ment variables on physical characteristics of hybrid
poplar substrates. App. Biochem. Biotechnol.
137-140:367-377.
Sannigrahi, P., and A. J. Ragauskas. 2010. Poplar as
a feedstock for biofuels: A review of compositional
characteristics. Biofuels, Bioprod Biorefin. 4:209-
226.
Sannigrahi, P., D. H. Kim, S. Jung, and A. J. Ragaus-
kas. 2011. Pseudo-lignin and pretreatment chemis-
try. Energy Environ. Sci. 4:1306-1310.
Schell, D. J., J. Farmer, M. Newman, and J. D. Mc-
Millan. 2003. Dilute-sulfuric acid pretreatment of
corn stover in pilot-scale reactor – investigation of
yields, kinetics, and enzymatic digestibilities of sol-
ids. Appl. Biochem. Biotechnol. 105:69-85.
Shuai, L., Q. Yang, J. Y. Zhu, F-C Lu, P. J. Weimer, J.
Ralph, and X-J Pan. 2010. Comparative study of
SPORL and dilute-acid pretreatments of spruce for
cellulosic ethanol production. Bioresour. Technol.
101:3106-3114.
Sluiter, A., B. Hames, R. Ruiz, C. Scarlata, J. Sluiter,
and D. Templeton. 2008a. Determination of sug-
ars, byproducts, and degradation products in liq-
uid fraction process samples. Laboratory Analytical
Procedure, Technical Report NREL/TP-510-42623.
National Renewable Energy Laboratory, Golden,
CO.
Sluiter, A., B. Hames, R. Ruiz, C. Scarlata, J. Sluiter,
and D. Templeton. 2008b. Determination of ex-
tractives in biomass. Laboratory Analytical Proce-
dure, Technical Report NREL/TP-510-42619. Na-
tional Renewable Energy Laboratory, Golden, CO.
Sluiter, A., B. Hames, R. Ruiz, C. Scarlata, J. Sluiter,
and D. Templeton. 2011. Determination of struc-
tural carbohydrates and lignin in biomass. Labora-
tory Analytical Procedure, Technical Report NREL/
TP-510-42618. National Renewable Energy Labo-
ratory, Golden, CO.
Torget, R., M. Himmel, K. Grohmann, and J. D.
Wright. 1988. Initial design of a dilute sulfuric acid
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 131
pretreatment process for aspen wood chips. Appl.
Biochem. Biotechnol. 17:89-104.
United States Department of Energy. Energy Efficien-
cy & Renewable Energy Biomass Program: Feed-
stock Composition and Property Database http://
www.afdc.energy.gov/progs/search3.cgi?14904.
Accessed June, 2010.
Wyman, C. E., B. E. Dale, R. T. Elander, M. Holtzap-
ple, M. R. Ladisch, and Y. Y. Lee. 2005. Coordinat-
ed development of leading biomass pretreatment
technologies. Bioresour. Technol. 96:1959-1966.
Wyman, C. E., B. E. Dale, R. T. Elander, M. Holtzap-
ple, M. R. Ladisch, Y. Y. Lee, C. Mitchinson, and J.
N. Saddler. 2008. Comparative sugar recovery and
fermentation data following pretreatment of pop-
lar woody leading technologies. Biotechnol. Prog.
25:333-339.
132 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
www.afabjournal.comCopyright © 2012
Agriculture, Food and Analytical Bacteriology
ABSTRACT
Microbial diversity in tannery waste disposal sites was characterized in this research. The research work
consisted of isolation and cultivation of microbes on laboratory media and the subsequent characteriza-
tion of pure isolates. The 16S rRNA gene of isolated bacteria was analyzed for molecular characteriza-
tion of bacterial diversity at those areas. 16S rRNA gene amplification was successful for sixteen isolates.
Restriction digestion of these amplified 16S rRNA genes by two different restriction enzymes, HinP1I and
MspI, revealed six different restriction patterns of the 16S rRNA gene. Representative 16S rRNA genes of
these six different patterns were selected for DNA sequencing to characterize these bacteria further. 16S
rRNA genes of five of the representative bacterial colonies of the six selected patterns were successfully
sequenced. The identified bacterial species included both gram positive and gram negative bacteria from
the groups γ-proteobacteria and Firmicutes.
Keywords: Hazaribagh, Tannery, Bangladesh, Molecular diversity
InTRoduCTIon
Leather, a traditional export item in Bangladesh,
enjoys a good reputation worldwide for its quality
(Sharif and Mainuddin, 2003). This sector plays a sig-
nificant role in the economy of Bangladesh in terms
of its contribution to export and domestic market
(Sharif and Mainuddin, 2003). In Bangladesh, tanning
Correspondence: S. Yeasmin, [email protected]; [email protected]: +1 -229-386-3363 Fax: +1-229-86-3239
or the process of making leather is mostly carried out
in the south-western region of Dhaka city, occupying
25 hectares of land at Hazaribagh, where about 90%
of tannery industries of Bangladesh are located. Due
to lack of appropriate waste management practices,
both solid wastes and liquid effluents from these
industries are deposited at different low-lying loca-
tions of Hazaribag without proper treatments (Zahid
et al., 2006). Components of these wastes include
rotten flesh, fat, blood and skin, toxic chemicals,
dissolved lime, chromium sulfate, alkali, hydrogen
Culture dependent molecular analysis of bacterial community of Hazaribagh tannery exposed area in Bangladesh
A. A. Maruf 1, 3, 5, M. M. Moosa1, 4, 5, S. M. M. Rashid 1,5, H. Khan2, S. Yeasmin1
1 Department of Genetic Engineering and Biotechnology, University of Dhaka, Dhaka 1000, Bangladesh.2 Department of Biochemistry and Molecular Biology, University of Dhaka, Dhaka 1000, Bangladesh.
3 Present address: UChicago Research Bangladesh Ltd., House 338, Road 24, New DHOS, Mohakhali, Dhaka 1206, Bangladesh.
4 Present address: Department of Biochemistry and Molecular Biology, University of Dhaka, Dhaka 1000, Bangladesh.5 Contributed equally to the study.
Agric. Food Anal. Bacteriol. 2:132-138, 2012
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 133
sulfide, sulfuric acid, bleach, dyes, oil, formic acid,
heavy metals, suspended solids, organic matters
and so on (Bhuiyan et al., 2011; Zahid et al., 2006).
Consequently, soil sediment, groundwater and sur-
face water of nearby rivers (Buriganga and Turag) are
polluted heavily through percolation of the leachate
from these dumping sites (Zahid et al., 2006).
Despite the toxic chemical load, a number of bac-
terial species are found to be abundant in the micro-
flora of tannery effluents (Lefebvre et al., 2006; Tripa-
thi et al., 2011). While the details of the mechanism
of resistance of this microflora to toxic chemicals are
yet to be deciphered, three possible mechanisms
are likely to operate separately or in combination:
a) efflux systems can reduce toxic chemical loads
(Mosqueda and Ramos, 2000; Nies and Silver, 1989;
Nies and Silver, 1995); b) toxic chemicals can be de-
graded (Franco et al., 2005) or converted to less tox-
ic forms (Basu et al., 1997; Fakruddin et al., 2009; Ilias
et al., 2011; Masood and Malik, 2011; Rafiqullah et
al., 2009); c) toxic chemicals can be sequestered into
complex compounds (Nies, 1999) or compartments
(Avery, 1995; Cooksey, 1993). The study of these
microorganisms and/or their mode of resistance can
lead to the development of novel biological meth-
ods of remediation of these toxic chemicals which
can be less expensive compared to physicochemical
remedial strategies (Farabegoli et al., 2004; Hasega-
wa et al., 2010; Sivaprakasam et al., 2008; Tripathi et
al., 2011; Yan et al., 2011). This study aimed to char-
acterize microbial contents of tannery effluent en-
riched environment of Hazaribagh region of Dhaka.
MATeRIAlS And MeThodS
Sample collection
Samples were collected both from long-term and
short time tannery waste disposal sites of Hazaribag
tannery area to ensure proper representation of mi-
crobial community diversity. The sites of sample col-
lection was categorized into four broad categories: a)
short term tannery waste disposal site; b) long term
tannery waste disposal site; c) submerged tannery
waste disposal site and d) edges of tannery waste
disposal pond.
Sample preparation
A 5 g waste sample was mixed with 30 mL distilled
water. It was divided into two 15 mL test tube and
centrifuged at 2000 rpm for five minutes. A volume of
100 µL supernatant from each sample was inoculated
on lysogeny broth (LB) agar plate and incubated at
37°C.
Pure culture isolation
Pure cultures were isolated from the mixed cul-
tures of microorganisms. The pure cultures were pre-
pared by streak plate method and preserved at 4°C
in a refrigerator. Sampling was done twice from the
sites in January, 2009 and March, 2009. A total of 28
colonies were selected based on colony morphology
and labeled as SY-1 to SY-28. These 28 isolates were
studied further.
Isolation of genomic DNA from bacteria
Colonies from pure cultures were inoculated into
LB media. The cultures were incubated overnight
at 37°C temperature at 120 rpm. A 1.5 mL bacterial
culture aliquot was placed into a sterile Eppendorf.
It was spun in a centrifuge at 10,000 rpm for 2 min-
utes. Later the supernatants were discarded and
bacterial cells were harvested. Genomic DNA was
isolated from these bacterial cells according to the
CTAB (Cetyl Trimethyl Ammonium Bromide) method
(Chen and Kuo, 1993) with slight modifications. Solu-
tions of 567µL TE (Tris EDTA), 3 µL 10% SDS and 3µL
of 20 mg/ml proteinase K were added with the cell
pellets and thoroughly mixed. The suspension was
then incubated for 1 hour at 37°C in water bath. A 5M
NaCl (100µL) solution was added to this suspension
and mixed thoroughly. An 80µL CTAB/NaCl solution
was added, mixed thoroughly and the resulting sus-
pension was incubated at 65°C. Equal volumes of
chloroform: Isoamyl Alcohol (IAA) equivalent to 24:1
were added to the suspension and shaken vigorously
134 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
for 15 minutes. The resulting suspension was spun at
14000 rpm for 10 minutes. The aqueous phase from
the Eppendorf tube was transferred to a new steril-
ized Eppendorf tube.
Equal volumes of Phenol: Chloroform: IAA (Iso-
amyl Alcohol) = 25: 24: 1 were added to it and mixed
thoroughly by inverting the tube for five minutes.
The resulting suspension was spun at 14,000 rpm
for 10 minutes. The aqueous phase (above the white
interface layer) was transferred carefully by a 200 µL
micropipette to a clean tube and the remainder was
discarded. DNA was precipitated with double vol-
ume of absolute ethanol. It was spun for 15 minutes
at 14,000 rpm at 4°C to pellet the DNA. The pellet
was collected and washed once or twice with ice
cold EtOH. It was done once with 70% EtOH or 76%
EtOH/10 mM AcNH4 (ammonium acetate). A second
wash with 70% EtOH was subsequently performed.
It was spun 15 min at 14,000 rpm, 4°C. The superna-
tant was removed and the pellet was dried by leaving
tube open at room temperature for an hour. The pel-
let was resuspended in TE (pH of TE was maintained
8.0). The aliquot of pellet was stored at -20°C.
PCR amplification of 16s rRNA gene
Isolated bacterial genomic DNA was used as
template to amplify 16S Small-subunit (SSU) rRNA
genes by PCR using the primers 8F (5’-AGAGTTT-
GATCCTGGCTCAG) and 805R (5’-GACTACCAGGG-
TATCTAAT) as described by Lane and coworkers
(Lane et al., 1985). Each 25µL PCR mixture included
2.5 µL of 10X PCR buffer, 2 µL of deoxynucleoside tri-
phosphate mix, 1.5 µL of MgCl2, 0.5µL of each primer,
0.3 µL of Taq polymerase (Takara Taq™, Otsu, Japan),
1 µL of genomic DNA lysate and 16.7 µL of PCR H2O
(following the manufacturers’ protocols). Thirty cycles
of amplification (92°C for 30 s, 58°C for 40 s, and 72°C
for 90 s) usually were sufficient to obtain a product of
the appropriate length that was visible in ethidium
bromide-stained agarose gels.
Restriction Fragment Length Polymor-phism and sequencing
The PCR product was digested with 2 U each of
MspI (Takara, Japan) and HinP1I (Takara, Japan) re-
striction enzymes for 1 h at 37°C. Each restriction
digestion mixture contained 7 µL PCR product, 2 µL
10x T Buffer, 2 µL 0.1% BSA, 2 µL respective restric-
tion enzyme and the final volume was brought to 23
µL by adding 10 µL nuclease free H2O. Besides, PCR
product was digested with both these restriction
enzymes. The restriction fragments were separated
by gel electrophoresis on 2% Gene-Pure agarose
(Sigma). Restriction fragment length polymorphism
(RFLP) types were sorted by visual inspection of digi-
tized gel images. Representative RFLP types were
sequenced from Macrogen Inc. (Seoul, Republic of
Korea) using the reverse primer 805R.
Phylogenetic analysis
The evolutionary history was inferred using the
Minimum Evolution method (Rzhetsky and Nei,
1992). The percentage of replicate trees in which the
associated taxa clustered together in the bootstrap
test (10000 replicates) is shown next to the branch-
es (Felsenstein, 1985). The tree was drawn to scale,
with branch lengths in the same units as those of the
evolutionary distances used to infer the phylogenetic
tree. The evolutionary distances were computed us-
ing the Maximum Composite Likelihood method
(Tamura et al., 2004) and were in the units of the
number of base substitutions per site. The ME tree
was searched using the Close-Neighbor-Interchange
(CNI) algorithm (Nei and Tamura, 2000) at a search
level of 3. The Neighbor-joining algorithm (Saitou
and Nei, 1987) was used to generate the initial tree.
All positions containing gaps and missing data were
eliminated from the dataset (complete deletion op-
tion). There were a total of 556 positions in the fi-
nal dataset. Phylogenetic analyses were conducted
using the software MEGA4 (Tamura et al., 2007).
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 135
ReSulTS
Isolation of pure culture
A total of 28 pure cultures were isolated from four
different sampling categories based on unique mor-
phological appearance of the initial mixed culture.
They were labelled from SY-1 to SY-28. Three differ-
ent colonies (SY-12, SY-17 and SY-18) were collected
from long term waste disposal site, 5 different colo-
nies (SY-4, SY-5, SY-7, SY-8 and SY-21) from short term
waste disposal site, 9 different colonies (SY-2, SY-3,
SY-9, SY-15, SY-16, SY-22, SY-26, SY-27 and SY-28)
from submerged waste and 11 other colonies (SY-1,
SY-6, SY-10, SY-11, SY-13, SY-14, SY-19, SY-20, SY-23,
SY-24 and SY-25) from the edges of the waste dispos-
al pond. Of these 28 pure colonies PCR amplification
of 16S SSU rRNA was successful for the recovered
genomic DNA from 16 colonies. Of them, 4 colonies
failed to show any banding pattern upon restriction
digestion (SY-7, SY-12, SY-16 and SY-17). RFLP based
screening (MspI, HinP1I and MspI+HinP1I) of the re-
mainder of the 12 colonies identified six different re-
striction patterns. Representative colonies from each
pattern were selected (SY-9, SY-14, SY-23, SY-24, SY-
26 and SY-27) for DNA sequencing. The relationship
between different colonies and respective restriction
pattern is given in Table 1.
Identification of Bactria by 16S rRNA gene sequence comparison
Sequencing of the 16S ribosomal RNA gene was
successful for five bacterial strains (SY-14, SY-23, SY-
24, SY-26 and SY-27). Sequences were deposited
at the DDBJ/EMBL/GenBank nucleotide sequence
databases with accession numbers AB622992 to
AB622996. Sequencing of 16S rRNA gene of SY-9
was not successful. Nucleotide blast suggested
close homology of these sequences with different
soil bacterial species (Table 2). Phylogenetic analysis
suggested a close relationship between the identi-
fied microorganisms (Figure 1).
dISCuSSIon
Bioremediation by microorganisms is one of the
efficient and economical ways to decontaminate
sites of pollution. Exploring the microbial diversity
is the key to develop this effective and environmen-
tally friendly technology (Paul et al., 2005). Due to
lack of proper waste management practices, Haz-
aribag has become heavily polluted with effluents
from nearby tannery industries (Arias-Barreiro et al.,
2010; Bhuiyan et al., 2011; Zahid et al., 2006). How-
ever, little is known about the microbial flora of this
region and their interaction with the ecosystem. The
current study aimed to explore microbial diversity of
this area.
To ensure proper representation, samples were
collected from four different types of waste disposal
sites of Hazaribagh tanning area (short term tannery
waste disposal site; long term tannery waste disposal
site; submerged tannery waste disposal site; and the
edges of tannery waste disposal pond) as discussed
in the Materials and Methods section. Twenty eight
different pure culture colonies (SY-1 to SY-28) were
isolated from the collected samples.
Pure culture technique was followed to isolate the
differing colonies so that all of the individuals in a
Table 1. The relationship between different colonies and respective restriction pattern. Strains marked with bold numbers were selected for sequencing. SY-9 could not be sequenced.
Pattern Bacterial Strains
I SY-23
II SY-26
III SY-9
IV SY-24,1, 25
V SY-27, 28, 2
VI SY-14, 15, 4
136 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
culture have originated from a single individual. This
allowed the characterization of microorganisms with-
out confounding presence of other different types
of microorganisms. While isolating microorganisms
from complex mixtures, the isolation procedure was
repeated at least once to make sure that an isolat-
ed colony was single cell derived. These microbial
colonies were isolated by observation of colony mor-
phology. Samples collected from long term waste
disposal site showed the highest microbial diversity.
Genomic DNA was isolated from the pure cultures.
The amount of genomic DNA isolated was minimal
for some colonies but still sufficient to carry out am-
plification of the 16S rRNA gene.
Isolated genomic DNA was amplified with primers
specific for bacterial 16S rRNA gene (8F and 805R).
PCR was successful for 16 pure cultures (SY-1, SY-2,
SY-4, SY-7, SY-9, SY-12, SY-14 to 17, and SY-23 to 28).
16S rRNA genes of other 12 microbial colonies were
not amplified by polymerase chain reaction. Later, six
different restriction patterns were observed in these
16 PCR products by digesting the PCR products with
two different restriction enzymes HinP1I and MspI,
both alone and in combination. One colony from
each pattern was selected for 16S rRNA gene se-
quencing.
Sequencing was successful for five bacterial
strains. After 16S rRNA gene sequence analysis bac-
terial strains SY-14, SY-23, SY-24, SY-26 and SY-27 ex-
hibited the best nucleotide blast match with Provi-
dencia vermicola strain AR_PSBH1, Providencia sp.
FD32, Bacillus subtilis strain Bio AAS1, Bacillus sp.
FRC_Z41 and Proteus penneri strain Z2 respectively.
The identified bacterial species included both gram
positive and gram negative bacteria from the groups
γ-proteobacteria and Firmicutes (Table 2).
Table 2. Identification of Bacteria by 16S rRNA gene sequence comparison
Bacteria strain Accession The best BLASTn match Group
SY-14 AB622992Providencia vermicola strain AR_PSBH1
γ-proteobacteria Gram negative
SY-23 AB622993 Providencia sp. FD32 γ-proteobacteria Gram negative
SY-24 AB622994Bacillus subtilis strain Bio AAS1
Firmicutes Gram positive
SY-26 AB622995 Bacillus sp. FRC_Z41 Firmicutes Gram positive
SY-27 AB622996 Proteus penneri strain Z2 γ-proteobacteria Gram negative
Figure 1. Analysis of evolutionary relationship between the 5 taxa. Previously classified Providen-cia rettgeri (GenBank accession: FJ151630) and Bacillus tequilensis (GenBank accession: FR865173) was added to the tree to show γ- proteobacteria and Firmicutes specific clustering of the clades.
γ-proteobacteria
Firmicutes
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 137
A literature survey revealed that similar bacterial
species were previously identified in different stud-
ies on tannery effluent and soil microflora. Members
of Providencia genus are known to reside in different
soil habitats (Rani et al., 2008; Thacker et al., 2006).
Different species of Proteus (Usha and Kalaiselvi,
2009) and Bacillus (Chaturvedi, 2011; Megharaj et al.,
2003) genus were found in tannery effluents. Thus,
results of the study are in harmony with those of pre-
vious studies.
Considerable research has been performed
throughout the world to determine the microbial
diversity of different communities. Nevertheless, to
our knowledge, no study was carried out to evalu-
ate molecular microbial diversity of tannery exposed
area in Bangladesh. The current study was per-
formed with a view to shed light on this important
aspect. The study identified five different bacterial
species which were present in the tannery effluent
exposed area. Further biochemical characterization
of individual bacterial species could elucidate de-
tails of their mechanism of survival which can later
be used for bioremediation purposes.
RefeRenCeS
Arias-Barreiro, C. R., H. Nishizaki, K. Okubo, I. Aoya-
ma, and I. C. Mori. 2010. Ecotoxicological charac-
terization of tannery wastewater in Dhaka, Bangla-
desh. J. Environ. Biol. 31:471-475.
Avery, S. V. 1995. Caesium accumulation by microor-
ganisms: uptake mechanisms, cation competition,
compartmentalization and toxicity. J. Ind. Micro-
biol. Biotechnol. 14: 76-84.
Basu, M., S. Bhattacharya, and A. K. Paul. 1997. Iso-
lation and characterization of chromium-resistant
bacteria from tannery effluents. Bull. Environ. Con-
tam. Toxicol. 58:535-542.
Bhuiyan, M., N. Suruvi, S. Dampare, M. Islam, S.
Quraishi, S. Ganyaglo, and S. Suzuki. 2011. Investi-
gation of the possible sources of heavy metal con-
tamination in lagoon and canal water in the tan-
nery industrial area in Dhaka, Bangladesh. Environ.
Monit. Assess. 175:633-649.
Chaturvedi, M. K. 2011. Studies on chromate re-
moval by chromium-resistant Bacillus sp. isolated
from tannery effluent. J. Environ. Prot. (Irvine, Ca-
lif). 2:76-82.
Chen, W., and T. Kuo. 1993. A simple and rapid
method for the preparation of gram-negative bac-
terial genomic DNA. Nucleic Acids Res. 21:2260.
Cooksey, D. A. 1993. Copper uptake and resistance
in bacteria. Mol. Microbiol. 7:1-5.
Fakruddin, M., R. M. Mazumdar, T. K. Tania, S. Islam,
M. N. Nipa, A. Iqbal, and H. R. Bhuiyan. 2009. Iso-
lation and characterization of chromate resistant
and reducing bacteria from tannery effluent of
Chittagong, Bangladesh. J. of Bio-Science. 17:71-
76.
Farabegoli, G., A. Carucci, M. Majone, and E. Rolle.
2004. Biological treatment of tannery wastewater
in the presence of chromium. J. Environ. Manage.
71:345-349.
Felsenstein, J. 1985. Confidence limits on phylog-
enies: an approach using the bootstrap. Evolution.
39:783-791.
Franco, A., C. Calheiros, C. Pacheco, P. De Marco,
C. Manaia, and P. Castro. 2005. Isolation and char-
acterization of polymeric galloyl-ester-degrading
bacteria from a tannery discharge place. Microb.
Ecol. 50:550-556.
Hasegawa, C. M., A. M. Barbosa, and K. Takashima.
2011. Biotreatment of industrial tannery wastewa-
ter using Botryosphaeria rhodina. J. Serb. Chem.
Soc.76:439-446.
Ilias, M., I. Rafiqullah, B. Debnath, K. Mannan, and
M. M. Hoq. 2011. Isolation and characterization of
chromium(VI)-reducing bacteria from tannery efflu-
ents. Indian J. Microbiol. 51:76-81.
Lane, D. J., B. Pace, G. J. Olsen, D. A. Stahl, M. L.
Sogin, and N. R. Pace. 1985. Rapid determination
of 16S ribosomal RNA sequences for phylogenetic
analyses. Proc. Natl. Acad. Sci. U.S.A. 82:6955-
6959.
Lefebvre, O., N. Vasudevan, K. Thanasekaran, R. Mo-
letta, and J. J. Godon. 2006. Microbial diversity in
hypersaline wastewater: the example of tanneries.
Extremophiles. 10:505-513.
Masood, F., and A. Malik. 2011. Hexavalent chro-
138 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
mium reduction by Bacillus sp. strain FM1 isolated
from heavy-metal contaminated soil. Bull. Environ.
Contam. Toxicol. 86:114-119.
Megharaj, M., S. Avudainayagam, and R. Naidu.
2003. Toxicity of hexavalent chromium and its re-
duction by bacteria isolated from soil contaminat-
ed with tannery waste. Curr. Microbiol. 47:51-54.
Mosqueda, G., and J.-L. Ramos. 2000. A set of
genes encoding a second toluene efflux system
in Pseudomonas putida DOT-T1E is linked to the
tod genes for toluene metabolism. J. Bacteriol.
182:937-943.
Nei, M., and K. Tamura. 2000. Molecular Phyloge-
netics and Evolution, Oxford University Press, New
York.
Nies, D. H. 1999. Microbial heavy-metal resistance.
Appl. Microbiol. Biotechnol. 51:730-750.
Nies, D. H., and S. Silver. 1989. Plasmid-determined
inducible efflux is responsible for resistance to cad-
mium, zinc, and cobalt in Alcaligenes eutrophus. J.
Bacteriol. 171:896-900.
Nies, D. H., and S. Silver. 1995. Ion efflux systems
involved in bacterial metal resistances. J. Ind. Mi-
crobiol. Biotechnol. 14:186-199.
Paul, D., G. Pandey, J. Pandey, and R. K. Jain. 2005.
Accessing microbial diversity for bioremediation
and environmental restoration. Trends Biotechnol.
23:135-142.
Rafiqullah, I. M., A. Hossain, M. Ilias, and M. M. Hoq.
2009. Chromium (VI) reducing native microorgan-
isms for remediation of chromium eco-toxicity in
environment of Bangladesh. Banglad. J. Sci.Ind.
Res. 43:455-466.
Rani, M. S., K. V. Lakshmi, P. S. Devi, R. J. Madhuri,
S. Aruna, K. Jyothi, G. Narasimha, and K. Ven-
kateswarlu. 2008. Isolation and characterization of
a chlorpyrifos-degrading bacterium from agricul-
tural soil and its growth response. Afr. J. Microbiol.
Res. 2:026-031.
Rzhetsky, A., and M. Nei. 1992. A Simple Method for
Estimating and Testing Minimum-Evolution Trees.
Mol. Biol. Evol. 9: 945.
Saitou, N., and M. Nei. 1987. The neighbor-joining
method: a new method for reconstructing phylo-
genetic trees. Mol. Biol. Evol. 4:406-425.
Sharif, M. I., and K. Mainuddin. 2003. Country case
study on environmental requirements for leather
and footwear export from Bangladesh, edited,
Bangladesh Centre for Advanced Studies, Dhaka.
Sivaprakasam, S., S. Mahadevan, S. Sekar, and S.
Rajakumar. 2008. Biological treatment of tannery
wastewater by using salt-tolerant bacterial strains.
Microb. Cell Fact. 7:15.
Tamura, K., M. Nei, and S. Kumar. 2004. Prospects
for inferring very large phylogenies by using the
neighbor-joining method. Proc. Natl. Acad. Sci. U.
S. A. 101:11030-11035.
Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007.
MEGA4: Molecular evolutionary genetics analy-
sis (MEGA) Software Version 4.0. Mol. Biol. Evol.
24:1596-1599.
Thacker, U., R. Parikh, Y. Shouche, and D. Mad-
amwar. 2006. Hexavalent chromium reduction by
Providencia sp. Process Biochem. 41:1332-1337.
Tripathi, M., S. Vikram, R. K. Jain, and S. K. Garg.
2011. Isolation and growth characteristics of
chromium(VI) and pentachlorophenol tolerant
bacterial isolate from treated tannery effluent for
its possible use in simultaneous bioremediation.
Indian J. Microbiol. 51:61-69.
Usha, K., and K. Kalaiselvi. 2009. Physico-chemical
analysis and microbial characterization of tannery
effluent. J. Ecobiol. 25:163-166.
Yan, B. H., H. J. Yang, J. H. Wei, and L. Luo. 2011.
Isolation from tannery wastewater and character-
ization of bacterial strain involved in nonionic sur-
factant degradation. Adv Mat Res. 183-85:22-26.
Zahid, A., K. Balke, M. Hassan, and M. Flegr. 2006.
Evaluation of aquifer environment under Hazarib-
agh leather processing zone of Dhaka city. Environ.
Geol. 50:495-504.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 139
www.afabjournal.comCopyright © 2012
Agriculture, Food and Analytical Bacteriology
ABSTRACT
The use of by-product feedstuffs and prebiotics in animal diets has increased in recent years. The pres-
ent study was undertaken to determine what effects novel by-product feedstuffs, including prebiotics, have
on survival of the important foodborne pathogenic bacteria Escherichia coli O157:H7 and Salmonella en-
terica Typhimurium in pure and mixed ruminal and fecal culture fermentations from cattle and swine. By-
product feedstuffs utilized in this study included: hyperimmunized whole egg, lysine biomass, lysine bio-
mass (spray dried), threonine biomass (drum dried), threonine biomass (spray dried), beer well yeast (drum
dried), beer well yeast (spray dried), ethanol yeast (pan dried) and corn meal as a control to simulate normal
dietary conditions. Prebiotics examined included: PremiDex ™, CitriStim™, a CitriStim:PremiDex blend
(50%:50%), and a commercial oligosaccharide source feedstuff. Pure culture populations of E. coli O157:H7
were reduced (P < 0.05) by 2% w/v of each of spray dried threonine, drum-dried threonine, ethanol yeast,
hyper-immunized whole egg, and a blend of CitriStim:PremiDex. No effects on Salmonella populations
were observed in pure cultures. Fermentations of mixed ruminal microorganisms from cattle fed a forage
based diet demonstrated that 2% PremiDex reduced (P < 0.05) E. coli O157:H7 populations compared
to controls i and the CitriStim:PremiDex blend reduced E. coli O157:H7 and Salmonella populations (P <
0.05) in fermentations from cattle fed high grain diets. The anti-foodborne pathogen effects appear to be
an indirect effect mediated by the microbial population of the intestinal tract, such as has been reported
previously for prebiotics.
Keywords: by-products, prebiotics, probiotic, feedstuff, E. coli O157:H7, Salmonella, food safety
Correspondence: T. R. Callaway, [email protected]: +1-979-260-9374 Fax: +1-979-260-9332
Impact of By-product Feedstuffs on Escherichia coli O157:H7 and Salmonella Typhimurium in Pure and Mixed Ruminal and Fecal Culture in Vitro†
T. R. Callaway1, S. Block2, K. J. Genovese1, R. C. Anderson1, R. B. Harvey1, D. J. Nisbet1
1USDA/ARS, Food and Feed Safety Research Unit, College Station, TX 778452Archer Daniels Midland Company, Decatur, IL
† Proprietary or brand names are necessary to report factually on available data; however, the USDA neither guarantees nor warrants the standard of the product, and the use of the name by the USDA implies neither approval of the product,
nor exclusion of others that may be suitable. USDA is an equal opportunity provider and employer.
Agric. Food Anal. Bacteriol. 2:139-148, 2012
140 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
InTRoduCTIon
Enterohemorrhagic Escherichia coli (EHEC), such
as E. coli O157:H7, and Salmonella enterica are two
of the most critical foodborne pathogenic bacteria
and are often found asymptomatically in the gastro-
intestinal tract of farm animals (Ferens and Hovde,
2011; Scallan, et al., 2011). Both pathogens can sur-
vive undetected within the gastrointestinal micro-
bial population of cattle (Berg, et al., 2004; Callaway,
et al., 2006; Kunze, et al., 2008), and Salmonella is
often found in cattle, swine and poultry (Borland,
1975; Davies, et al., 1999). When these pathogens
are transmitted to a human they cause severe illness
or even death, the combined yearly cost of these
pathogens to the U.S. economy is in excess of $15
billion (Scharff, 2010).
Dietary effects on gastrointestinal pathogen pop-
ulations have been examined extensively, and the
effects have been extremely variable depending on
the specific feedstuff utilized and the production
situation (Callaway, et al., 2009; Diez-Gonzalez, et al.,
1998; Kudva, et al., 1995). In recent years there has
been a dramatic increase in the use of corn based
by-product feedstuffs in food animal diets (Richman,
2007). This growth has been especially notable in
the ethanol fermentation by products, such as distill-
ers grains (DG). However, research has shown that
the inclusion of DG in cattle diets can increase fecal
prevalence and shedding of E. coli O157:H7 (Jacob,
et al., 2009; Jacob, et al., 2010; Jacob, et al., 2008c;
Wells, et al., 2009). The present study was designed
to examine a variety of novel corn-derived feedstuffs
and selected commercially available prebiotic prod-
ucts (PremiDex, commercial oligosaccharide, CitriS-
tim) in regard to their ability to provide a selective ef-
fect on E. coli O157:H7 and Salmonella Typhimurium
populations in pure and mixed culture in vitro.
MATeRIAlS And MeThodS
Bacterial strains and culture conditions
Escherichia coli O157:H7 strain 933 (ATCC 43895)
was originally isolated from a human hemorrhagic
colitis outbreak, and the Salmonella enterica Ty-
phimurium isolates that were used in this study were
originally isolated from cattle and swine. All isolates
were obtained from the Food and Feed Safety Re-
search Unit (USDA/ARS, College Station, TX) culture
collection. Both E. coli O157:H7 strain 933 and S.
Typhimurium were selected for resistance to novo-
biocin (No) and nalidixic acid (NA; 20 and 25 µg/
mL, respectively) by repeated transfer and selec-
tion in the presence of sub-lethal concentrations of
each antibiotic. This resistant phenotype was stable
through multiple unselected transfers in batch cul-
ture and through repeated culture vessel turnovers
in continuous culture (data not shown).
Pure culture studies
Feedstuffs were added to 16 x 100 mm tubes
containing anoxic Trypic Soy Broth (TSB, (cooled
after autoclaving under anoxic conditions [90% N2,
5% H2, 5% CO2]; Difco Laboratories; Detroit, MI) to
reach final concentrations of 2% wt/vol. Feedstuffs
utilized in this study were: PremiDex, CitriStim, a
CitriStim:PremiDex, commercial oligosaccharide,
hyperimmunized whole egg, lysine biomass (drum
dried), lysine biomass (spray dried), threonine bio-
mass (drum dried), threonine biomass (spray dried),
beer well yeast (drum dried), beer well yeast (spray
dried), ethanol yeast (pan dried) and corn meal as a
control. Corn meal was used as a control to simu-
late the typical ingredients in a ruminant diet that
would be replaced by the by-product feedstuffs.
Feedstuffs were added into tubes immediately be-
fore the pathogens were inoculated. Escherichia coli
O157:H7 strain 933 (ATCC 43895) or S. Typhimurium
were grown anaerobically and aseptically inoculated
into feedstuff containing tubes at approximately 6 x
105 CFU/mL of E. coli O157:H7 or 3 x 105 CFU/mL of
S. Typhimurium at t = 0. Tubes in triplicate (n = 3)
were incubated at 39 °C for 24 h, when 1 mL aliquots
were removed for enumeration (described below).
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 141
Animal diets
All animals were maintained in accordance with a
protocol approved by the Southern Plains Agricul-
tural Research Center Animal Care and Use Commit-
tee (ACUC No 06002). Holstein cattle (n = 4) were
provided ad libitum access to water and minerals
at all times. Ruminal fluid was collected from cattle
grazing bermudagrass pasture (n=2) and a high-
grain diet (n=2). Cattle in the pasture-fed group
were grazed on an early vegetative stage ryegrass
pasture at the time of ruminal fluid collection. The
grain-fed cattle were fed a commercial feedlot ra-
tion (corn soybean mix; Producer’s Co-op, Bryan, TX)
and was maintained on this feedlot diet for 10 d prior
to ruminal or fecal collection. Crossbred pigs (n=4)
were provided ad libitum access to water and miner-
als at all times. Pigs were fed a commercial finish-
ing diet (Producer’s Co-op, Bryan, TX ) comprised of
soybean meal and corn twice daily. Animals were
maintained on this diet for 14 d prior to fecal fluid
collection.
Ruminal and fecal fluid collection
Ruminal contents were collected by hand from
the ventral sac of two ruminally cannulated Holstein
cows on each diet (n = 2/diet group). The ruminal
contents were collected from all cattle at approxi-
mately the same time (between 0800 and 0900 h).
Immediately after removal from the rumen, the con-
tents from each cow were strained via a fine mesh
nylon strainer (Reaves and Co., Durham, NC) and
pooled. Ruminal fluid was transported to the labo-
ratory and incubated for 30 min at 39 °C to allow gas
production to buoy large particles to the top of the
flasks. Fresh ruminal fluid contained approximately
1010 cells/ml of total culturable anaerobes, as deter-
mined by serial dilution in anaerobic reinforced clos-
tridial broth in triplicate tubes.
Fecal samples from cattle were collected directly
per rectum by digital grab. Feces were collected
from all cattle at the same time. Immediately upon
collection, the feces were strained via a fine mesh
nylon strainer to obtain a fecal fluid which was then
pooled. Fecal fluid was transported to the labora-
tory as described above. Fresh fecal fluid contained
approximately 1010 cells/ml of total culturable an-
aerobic bacteria as determined by serial dilution as
described above.
Swine feces were collected directly per rectum by
digital grab from all pigs at the same time, pooled
equally by weight, and was added directly to the fe-
cal fermentation media (described below) at a 33%
w/v final concentration. Fresh swine feces contained
approximately 109 cells/g of total culturable anaero-
bic bacteria.
In vitro mixed ruminal microbial fermen-tations
Incubations of cattle ruminal and fecal fluids were
performed by combining the gastrointestinal fluid
(33% vol/vol) with an anoxic basal medium contain-
ing (per liter): 292 mg K2HPO4, 202 mg KH2PO4, 436
mg NH4SO4, 480 mg NaCl, 100 mg MgSO4•7H2O, 64
mg CaCl2•H2O, 4,000 mg Na2CO3, 600 mg cysteine
hydrochloride (Cotta and Russell, 1982) supplement-
ed with 1 g/L glucose. Swine feces was added to
the same basal medium in a 33% w/v concentration.
Approximately 104-5 CFU/mL E. coli O157:H7 strain
933 or S. Typhimurium were added to the buffered
gastrointestinal fluid fermentations in all experi-
ments. The resultant suspensions were anaerobi-
cally transferred to 18 × 150 mm Balch tubes (Bellco
Glass, Vineland, NJ; 10 ml per tube). Feedstuffs de-
scribed above were added to each tube to reach fi-
nal concentrations of 2 % wt/vol under an anoxic gas
phase. Tubes in triplicate (n = 3) were then sealed
using rubber stoppers with aluminum crimps and in-
cubated for 24 h at 39°C under a N2, CO2, H2 (90:5:5
v/v) gas phase. Samples were removed after 24 h of
incubation and centrifuged (10,000 × g, 5 min, 24°C)
to remove particulate matter.
Bacterial enumeration
Samples were taken from all pure and mixed cul-
ture in vitro fermentations at 24 h to determine the
effect of feedstuffs on populations of E. coli O157:H7
142 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
and S. Typhimurium. Samples were serially diluted
(in 10-fold increments) in phosphate buffered saline
(PBS, pH 7.0), and subsequently plated on MacCo-
nkey’s agar (supplemented with 25 µg/mL NO and
20 µg/mL NA) and incubated at 37°C overnight for
direct counting of E. coli O157:H7 CFU/ml. To deter-
mine populations of S. Typhimurium, samples were
serially diluted as described above and plated on
Brilliant Green Agar (supplemented with 25 µg/mL
NO and 20 µg/mL NA) and incubated at 37°C over-
night for direct counting.
Statistical analysis
Pure culture experiments were performed with
(n=3) tubes on consecutive days. Mixed ruminal
bacteria experiments were performed in duplicate
tubes (n=2) on consecutive days, and the values pre-
sented are means. Students’ t-test was used to de-
termine significance of differences between means
of each treatment.
ReSulTS
In pure culture studies, none of the feedstuffs
used in this study affected Salmonella Typhimurium
populations (Figure 1) compared to controls using
corn meal. However, populations of E. coli O157:H7
in pure cultures were reduced (P < 0.05) when: spray
dried threonine biomass, drum-dried threonine bio-
mass, ethanol yeast, hyper-immunized whole egg,
and a blend of CitriStim:PremiDex were included;
although it must be noted that this statistically sig-
Figure 1. Effects of feedstuffs on populations of E. coli O157:H7 (light bars) and Salmonella Ty-phimurium (dark bars) in pure cultures. Feedstuffs were included at 2% w/v, and bars represent the mean of 3 fermentations, and error bars indicate standard deviation. Bars marked with superscript a indicate differences from control of P < 0.05.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 143
Figure 2. Effects of feedstuffs on populations of E. coli O157:H7 (light bars) and Salmonella Ty-phimurium when inoculated into mixed ruminal microorganism fermentations from cattle fed a forage-based diet. Feedstuffs were included at 2% w/v, and bars represent the mean of 3 fermen-tations, and error bars indicate standard deviation. Bars marked with superscript a indicate differ-ences from control of P < 0.05.
nificant reduction was less than a 10-fold decrease in
E. coli O157:H7 populations (Figure 1).
When pathogens were added to in vitro mixed
ruminal microorganism fermentations of cows fed
high forage diets, the inclusion of 2% Premidex re-
duced (P < 0.05) E. coli O157:H7 and reduced (P <
0.06) Salmonella Typhimurium populations com-
pared to controls (Figure 2). However, when cows
were fed high grain diets (data not shown) there was
no effect of feedstuff addition on pathogen popula-
tions in ruminal fluid fermentations. In in vitro mixed
fecal microorganism fermentations of cattle fed high
grain diets (Figure 3), E. coli O157:H7 populations
were numerically reduced in hyperimmunized whole
egg and beer well yeast (spray dried) and was sig-
nificantly reduced (P < 0.05) in fermentations con-
taining the CitriStim:PremiDex blend. Salmonella
Typhimurium populations in these in vitro fermenta-
tions were also reduced (P < 0.05) by addition of the
CitriStim:PremiDex blend.
When these by-product feedstuffs were included
in in vitro pig fecal fermentations, PremiDex and the
CitriStim:PremiDex blend reduced (P < 0.05) E. coli
O157:H7 populations more than 10-fold compared
to corn meal controls (Figure 4). However, the ad-
dition of the commercial oligosaccharide product
and hyperimmunized whole egg increased (P < 0.05)
populations of Salmonella Typhimurium more than 1
log10 CFU/ml compared to corn meal controls.
144 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
dISCuSSIon
In recent years, food safety has become an in-
creasingly important issue to animal producers (Da-
vies, 2011; Sargeant, et al., 2007) and to the national
economy as a whole (Scharff, 2010). Research has
shown that diet composition and feeding methods
can affect intestinal microbial populations of cattle,
including populations of foodborne pathogenic bac-
teria, such as E. coli O157:H7 and Salmonella (Bu-
chko, et al., 2000; Diez-Gonzalez, et al., 1998; Fox,
et al., 2007; Jacob, et al., 2008b). Distillers grains
(DG) have seen a rapid increase in inclusion in ani-
mal diets (Klopfenstein, et al., 2008; Richman, 2007),
following the increase in the production of ethanol
from corn fermentation (Richman, 2007). Distill-
ers grains as well as other by-products have some
broad impacts on some members of the microbial
ecosystem (Callaway, et al., 2010; Fron, et al., 1996;
Williams, et al., 2010). Recently, the inclusion of DG
in cattle diets was shown to increase fecal shedding
of E. coli O157:H7 (Jacob, et al., 2008b; Jacob, et
al., 2008c; Wells, et al., 2009). In in vitro studies,
it was found that ruminal fluid from cattle fed DG
supported a higher level of E. coli O157:H7 growth,
and that the inclusion of DG in fermentations also
increased E. coli O157:H7 populations (Jacob, et al.,
2008a). However, results were variable based largely
Figure 3. Effects of feedstuffs on populations of E. coli O157:H7 (light bars) and Salmonella Ty-phimurium when inoculated into mixed fecal microorganism fermentations from cattle fed a grain-based diet. Feedstuffs were included at 2% w/v, and bars represent the mean of 3 fermentations, and error bars indicate standard deviation. Bars marked with superscript a indicate differences from control of P < 0.05.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 145
upon source of DG (Jacob, et al., 2009; Jacob, et al.,
2010; Wells, et al., 2009). Other researchers found
that inclusion of high levels of corn or wheat DDGS
in feedlot diets of cattle may allow E. coli O157:H7
improved survival in feces (Yang, et al., 2010).
Emerging microbial diversity data indicates that
different gastrointestinal microbial populations are
selected for by different feedstuffs, possibly due to
the presence (or absence) of some limiting compo-
nent in the diet, such as is found in prebiotic feed-
stuffs (Patra and Saxena, 2009; Tajima, et al., 2001).
In the present study, a variety of novel by-product
feedstuffs and prebiotic compounds were examined
to determine their impact on foodborne pathogenic
bacterial populations in pure and mixed cultures of
bacteria from cattle and swine. In general, the novel
by-product feedstuffs did not affect populations of
E. coli O157:H7 or Salmonella in pure or mixed cul-
ture fermentations. In pure cultures, the direct ef-
fects of the different by-products were negligible,
with no feedstuff causing as much as a 10-fold de-
crease in pathogen populations, though a blend of
CitriStim:PremiDex (a prebiotic source of oligosac-
charides such as maltooligosaccharides) did cause a
significant reduction in E. coli O157:H7 populations.
When the prebiotic PremiDex was included in
ruminal fluid fermentations from a cow fed a high
forage diet, populations of both E. coli O157:H7 and
Figure 4. Effects of feedstuffs on populations of E. coli O157:H7 (light bars) and Salmonella Ty-phimurium when inoculated into mixed fecal microorganism fermentations from growing swine fed a commercial finishing diet. Feedstuffs were included at 2% w/v, and bars represent the mean of 3 fermentations, and error bars indicate standard deviation. Bars marked with superscript a indicate differences from control of P < 0.05.
146 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
Salmonella populations were decreased significant-
ly; but this effect disappeared in ruminal fluid from
cattle fed a high grain diet. However, when fecal bac-
teria from cattle fed high grain diets were fermented
with by-products feeds, the CitriStim:PremiDex pre-
biotic blend reduced E. coli O157:H7 populations.
Collectively, these results indicate that CitriStim and/
or PremiDex reduced E. coli O157:H7 populations
and could be an effective dietary additive to reduce
foodborne pathogenic bacteria prior to harvest in
ruminant animals, although further research is need-
ed to clarify the magnitude of the effect in further in
vitro studies and in live animals during feeding trials.
In swine fecal fermentations, prebiotic ad-
dition had a greater impact than in the cattle
ruminal or fecal fermentations. PremiDex and the
CitriStim:PremiDex blend significantly decreased E.
coli O157:H7 populations in swine fecal fermenta-
tions, while no novel by-product feedstuff affected
E. coli O157:H7 populations. However, residual bio-
mass and hyperimmunized whole egg increased S.
Typhimurium populations more than 20-fold in these
in vitro fecal fermentations. The difference in effects
of these feedstuffs between the two pathogenic spe-
cies is likely due to indirect effects on other members
of the microbial population who either outcompete
the pathogen (possibly mediated via a prebiotic-
type effect), or alternatively creation of a competi-
tive “vacuum” in the fecal microbial ecosystem that
is consequently exploited by Salmonella. Further
research is needed to understand the mechanism
behind this impact on pathogen populations.
ConCluSIonS
Collectively, it appears that PremiDex, and the
CitriStim:PremiDex blend had the greatest impact
on foodborne pathogenic bacterial populations in
mixed gastrointestinal microbial fermentations in the
feedstuffs examined presently. Populations of E. coli
O157:H7 in fecal fermentations from cows fed high
grain diets and swine fecal fermentations were most
strongly affected by the CitriStim:PremiDex blend
inclusion. The anti-foodborne pathogen effect ap-
pears to be indirectly mediated by prebiotic effects
on the mixed gastrointestinal microbial consortium
rather than by direct effects against the pathogens.
Further research is needed to clarify the mode of ac-
tion of these and other by-product feedstuffs and
how much impact they have on the mixed microbial
ecosystem when fed to live animals.
RefeRenCeS
Berg, J. L., T. A. McAllister, S. J. Bach, R. P. Stillborn,
D. D. Hancock, and J. T. LeJeune. 2004. Esche-
richia coli O157:H7 excretion by commerical feed-
lot cattle fed either barley- or corn-based finishing
diets. J. Food Prot. 67:666-671.
Borland, E. D. 1975. Salmonella infection in poultry.
Vet. Rec. 97:406-408.
Buchko, S. J., R. A. Holley, W. O. Olson, V. P. J. Gan-
non, and D. M. Veira. 2000. The effect of different
grain diets on fecal shedding of Escherichia coli
O157:H7 by steers. J. Food Prot. 63:1467-1474.
Callaway, T. R., M. A. Carr, T. S. Edrington, R. C. An-
derson, and D. J. Nisbet. 2009. Diet, Escherichia
coli O157:H7, and cattle: A review after 10 years.
Curr. Iss. Mol. Biol. 11:67-80.
Callaway, T. R., S. E. Dowd, T. S. Edrington, R. C. An-
derson, N. Krueger, N. Bauer, P. J. Kononoff,and D.
J. Nisbet. 2010. Evaluation of bacterial diversity in
the rumen and feces of cattle fed different levels of
dried distillers grains plus solubles using bacterial
tag-encoded FLX amplicon pyrosequencing. J.
Anim. Sci. 88:3977-3983.
Callaway, T. R., T. S. Edrington, A. D. Brabban, J. E.
Keen, R. C. Anderson, M. L. Rossman, M. J. Engler,
K. J. Genovese, B. L. Gwartney, J. O. Reagan, T. L.
Poole, R. B. Harvey, E. M. Kutter, and D. J. Nisbet.
2006. Fecal prevalence of Escherichia coli O157,
Salmonella, Listeria, and bacteriophage infecting
E. coli O157:H7 in feedlot cattle in the southern
plains region of the United States. Foodborne
Path. Dis. 3:234-244.
Cotta, M. A., and J. B. Russell. 1982. Effect of pep-
tides and amino acids on efficiency of rumen bac-
terial protein synthesis in continuous culture. J.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 147
Dairy Sci. 65:226-234.
Davies, P., J. Funk, and M. Morrow. 1999. Fecal shed-
ding of Salmonella by a cohort of finishing pigs in
North Carolina. Swine Health Prod. 7:231-234.
Davies, P. R. 2011. Intensive swine production and
pork safety. Foodborne Path. Dis. 8:189-201.
Diez-Gonzalez, F., T. R. Callaway, M. G. Kizoulis, and
J. B. Russell. 1998. Grain feeding and the dissemi-
nation of acid-resistant Escherichia coli from cattle.
Science. 281:1666-1668.
Ferens, W. A., and C. J. Hovde. 2011. Escherichia
coli O157:H7: Animal reservoir and sources of hu-
man infection. Foodborne Path. Dis. 8:465-487.
Fox, J. T., B. E. Depenbusch, J. S. Drouillard, and T. G.
Nagaraja. 2007. Dry-rolled or steam-flaked grain-
based diets and fecal shedding of Escherichia coli
O157 in feedlot cattle. J. Anim. Sci. 85:1207-1212.
Fron, M., H. Madeira, C. Richards, and M. Morrison.
1996. The impact of feeding condensed distillers
byproducts on rumen microbiology and metabo-
lism. Anim. Feed Sci. Technol. 61:235-245.
Jacob, M. E., J. T. Fox, J. S. Drouillard, D. G. Renter,
and T. G. Nagaraja. 2008a. Effects of dried distill-
ers’ grain on fecal prevalence and growth of Esch-
erichia coli O157 in batch culture fermentations
from cattle. Appl. Environ. Microbiol. 74:38-43.
Jacob, M. E., J. T. Fox, J. S. Drouillard, D. G. Renter,
and T. G. Nagaraja. 2009. Evaluation of feeding
dried distiller’s grains with solubles and dry-rolled
corn on the fecal prevalence of Escherichia coli
O157:H7 and Salmonella spp. in cattle. Foodborne
Path. Dis. 6:145-153.
Jacob, M. E., J. T. Fox, S. K. Narayanan, J. S. Drouil-
lard, D. G. Renter, and T. G. Nagaraja. 2008b. Ef-
fects of feeding wet corn distiller’s grains with
solubles with or without monensin and tylosin on
the prevalence and antimicrobial susceptibilities of
fecal food-borne pathogenic and commensal bac-
teria in feedlot cattle. J. Anim Sci. 86:1182-1190.
Jacob, M. E., Z. D. Paddock, D. G. Renter, K. F. Lech-
tenberg, and T. G. Nagaraja. 2010. Inclusion of
dried or wet distillers’ grains at different levels in
diets of feedlot cattle affects fecal shedding of
Escherichia coli O157:H7. Appl. Environ. Micro-
biol. 76:7238-7242.
Jacob, M. E., G. L. Parsons, M. K. Shelor, J. T. Fox,
J. S. Drouillard, D. U. Thomson, D. G. Renter, and
T. G. Nagaraja. 2008c. Feeding supplemental
dried distiller’s grains increases faecal shedding of
Escherichia coli O157 in experimentally inoculated
calves. Zoon. Pub. Health. 55:125-132.
Klopfenstein, T. J., G. E. Erickson, and V. R. Bremer.
2008. Board invited review: Use of distillers by-
products in the beef cattle feeding industry. J.
Anim Sci. 86:1223-1231.
Kudva, I. T., P. G. Hatfield, and C. J. Hovde. 1995.
Effect of diet on the shedding of Escherichia coli
O157:H7 in a sheep model. Appl. Environ. Micro-
biol. 61:1363-1370.
Kunze, D. J., G. H. Loneragan, T. M. Platt, M. F. Miller,
T. E. Besser, M. Koohmaraie, T. Stephens, and M.
M. Brashears. 2008. Salmonella enterica burden in
harvest-ready cattle populations from the southern
high plains of the United States. Appl. Environ. Mi-
crobiol. 74:345-351.
Patra, A. K., and J. Saxena. 2009. Dietary
phyto,chemicals as rumen modifiers: a review of
the effects on microbial populations. Antonie van
Leeuwenhoek. 39:1-13.
Richman, S. 2007. Ethanol and distillers grains: Situ-
ation and outlook In: Procs. 2007 International Dis-
tillers Grains Conference, Schaumburg, IL. 2008:
25-39.
Sargeant, J. M., M. R. Amezcua, A. Rajic, and L. Wad-
dell. 2007. Pre-harvest interventions to reduce the
shedding of E. coli O157 in the faeces of weaned
domestic ruminants: a systematic review. Zoonos.
Pub. Health. 54:260-277.
Scallan, E., R. M. Hoekstra, F. J. Angulo, R. V. Tauxe,
M.-A. Widdowson, S. L. Roy, J. L. Jones, and P. L.
Griffin. 2011. Foodborne illness acquired in the
United States—major pathogens. Emerg. Infect.
Dis. 17:7-15.
Scharff, R. L. 2010. Health-related costs from
foodborne illness in the United States. http://
www.producesafetyproject.org/admin/assets/
files/Health-Related-Foodborne-Illness-Costs-Re-
port.pdf-1.pdf. 3 May, Accessed 2010.
Tajima, K., R. I. Aminov, T. Nagamine, H. Matsui, M.
Nakamura, and Y. Benno. 2001. Diet-dependent
148 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
shifts in the bacterial population of the rumen re-
vealed with real-time PCR. Appl. Environ. Micro-
biol. 67:2766-2774.
Wells, J. E., S. D. Shackelford, E. D. Berry, N. Kal-
chayan, M. N. Guerini, V. H. Varel, T. M. Arthur, J.
M. Bosilevac, H. C. Freetly, T. L. Wheeler, C. L. Fer-
rell, and M. Koohmaraie. 2009. Prevalence and
level of Escherichia coli O157:H7 in feces and on
hides of feed lot steers fed diets with or without
wet distillers grains with solubles. J. Food Prot.
72:1624-1633.
Williams, W. L., L. O. Tedeschi, P. J. Kononoff, T. R.
Callaway, S. E. Dowd, K. Karges, and M. L. Gibson.
2010. Evaluation of in vitro gas production and ru-
men bacterial populations fermenting corn milling
(co)products. J. Dairy Sci. 93:4735-4743.
Yang, H. E., W. Z. Yang, J. J. McKinnon, T. W. Alexan-
der, Y. L. Li, and T. A. McAllister. 2010. Survival of
Escherichia coli O157:H7 in ruminal or fecal con-
tents incubated with corn or wheat dried distillers’
grains with solubles. Can. J. Microbiol. 56:890-
895.
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 149
MAnuSCRIPT SuBMISSIon
Authors must submit their papers electronically
([email protected]). According to instruc-
tions provided online at our site: www.afabjournal.
com. Authors who are unable to submit electroni-
cally should contact the editorial office for assistance
by email at [email protected].
INSTRUCTIONS TO AUTHORS
• Aerobic microbiology
• Aerobiology
• Anaerobic microbiology
• Analytical microbiology
• Animal microbiology
• Antibiotics
• Antimicrobials
• Bacteriophage
• Bioremediation
• Biotechnology
• Detection
• Environmental microbiology
• Feed microbiology
• Fermentation
• Food bacteriology
• Food control
• Food microbiology
• Food quality
• Food Safety
• Foodborne pathogens
• Gastrointestinal microbiology
• Microbial education
• Microbial genetics
• Microbial physiology
• Modeling and microbial kinetics
• Natural products
• Phytoceuticals
• Quantitative microbiology
• Plant microbiology
• Plant pathogens
• Prebiotics
• Probiotics
• Rumen microbiology
• Rapid methods
• Toxins
• Veterinary microbiology
• Waste microbiology
• Water microbiology
ConTenT of MAnuSCRIPT
We invite you to consider submitting your re-
search and review manuscripts to AFAB. The jour-
nal serves as a peer reviewed scientific forum for to
the latest advancements in bacteriology research
on Agricultural and Food Systems which includes
the following fields:
150 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
With an open access publication model of this
journal, all interested readers around the world can
freely access articles online. AFAB publishes origi-
nal papers including, but not limited to the types
of manuscripts described in the following sections.
Papers that have been, or are scheduled to be, pub-
lished elsewhere should not be submitted and will
not be reviewed. Opinions or views expressed in pa-
pers published by AFAB are those of the author(s)
and do not necessarily represent the opinion of the
AFAB or the editorial board.
MAnuSCRIPT TYPeS
Full-Length Research Manuscripts
AFAB accepts full-length research articles con-
taining four (4) figures and/or tables or more. AFAB
emphasizes the importance of sound scientific ex-
perimentation on any of the topics listed in the focus
areas followed by clear concise writing that describes
the research in its entirety. The results of experi-
ments published in AFAB must be replicated, with
appropriate statistical assessment of experimental
variation and assignment of significant difference.
Major headings to include are: Abstract, Introduc-tion, Materials and Methods, Results, Discussion (or Results and Discussion), Conclusion, Acknowl-edgements (optional), Appendix for abbreviations (optional), and References.
Manuscripts clearly lacking in language will be re-
turned to author without review, with a suggestion
that English editing be sought before the paper is
reconsidered. AFAB offers a fee based language
service upon request. Please contact [email protected] for more information about our fees
and services.
Rapid Communications
Under normal circumstances, AFAB aims for re-
ceipt-to-decision times of approximately one month or less. Accepted papers will have priority for publi-
cation in the next available issue of AFAB. However,
if an author chooses or requires a much more rapid
peer review, the journal editorial office has the capa-
bility to shorten the review timing to one week or less.
Any type of manuscript whether it be a full length
manuscript, brief communication or review paper can
be submitted as a rapid communication. There will be
additional costs for processing and page charges will
be double the normal rate. Authors who choose this
option must select Rapid Communications as the pa-
per type when submitting the paper and the editors
will judge whether a rapid review is possible and let
the author know immediately.
Brief Communications
Brief communications are short research notes giv-
ing the results of complete experiments but are con-
sidered less comprehensive than full-length articles
with three (3) figures and/or tables or less. Manuscripts
should be prepared with the same subheadings as full
length research papers. The running head above the
title of the paper is “Brief Communications.”
Unsolicited Review Papers
Review papers are welcome on any topic listed in
the focus section and have no page limits. Reviews
are assessed the same pages charges as all other
manuscripts. All AFAB guidelines for style and form
apply. Major headings to include are: Abstract, In-troduction, Main discussion topics and appropri-ate subheadings, Conclusions, Acknowledgements (optional) and References. Review papers shorter
than 20 pages of double spaced text and references
will be considered mini-reviews with the subhead-
ing above the title on the first page. The running
head above the title of the paper is either “Review”
or “Mini-review”.
Solicited Review Papers
Solicited reviews will have no page limits. The
editor-in-chief will send invitations to the authors
and then review these contributions when they are
submitted. Nominations or suggestions for potential
timely reviews are welcomed by the editors or edito-
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 151
rial board members and should be sent to submit@
afabjournal.com. There will be no page charges for
solicited review papers but the solicitation must origi-
nate from the editor-in-chief or one of the editors. Re-
quests from authors will automatically be classified as
unsolicited review papers. The running head above
the title of the paper will be “Invited Review.”
Conference and Special Issues Reviews
AFAB welcomes opportunities to publish papers
from symposia, scientific conference, and/or meet-
ings in their entirety. Conference organizers need
simply to contact AFAB at [email protected]
and a rapid decision is guaranteed. If in agreement,
the conference organizers must guarantee delivery
of a set number of peer reviewed manuscripts within
a specified time and submitted in the same format
as that described for unsolicited review papers. Con-
ference papers must be prepared in accordance with
the guidelines for review articles and are subject to
peer review. The conference chair must decide
whether or not they wish to serve as Special Issue
Editor and conduct the editorial review process. If
the conference chair/organizer chooses to serve as
special issue editor, this will involve review of the pa-
pers and, if necessary, returning them to the authors
for revision. The conference organizer then submits
the revised manuscripts to the journal editorial of-
fice for further editorial examination. Final revisions
by the author and recommendations for acceptance
or rejection by the chair must be completed by a
mutually agreed upon date between the editor and
the conference organizer. Manuscripts not meeting
this deadline will not be included in the published
symposium proceedings but if submitted later can
still be considered as unsolicited review papers. Al-
though offprints and costs of pages are the same
as for all other papers, the symposium chair may be
asked to guarantee an agreed upon number of hard
copies to be purchased by conference attendees. If
the decision is not to publish the symposium as a
special issue, the individual authors retain the right
to submit their papers for consideration for the jour-
nal as ordinary unsolicited review manuscripts.
Book Reviews
AFAB publishes reviews of books considered to
be of interest to the readers. The editor-in-chief ordi-
narily solicits reviews. Book reviews shall be prepared
in accordance to the style and form requirements of
the journal, and they are subject to editorial revision.
No page charges will be assessed solicited reviews
while unsolicited book reviews will be assigned the
regular page charge rate.
Opinions and Current Viewpoints
The purpose of this section will be to discuss, cri-
tique, or expand on scientific points made in articles
recently published in AFAB. Drafts must be received
within 6 months of an article’s publication. Opinions
and current perspectives do not have page limits.
They shall have a title followed by the body of the
text and references. Author name(s) and affiliation(s)
shall be placed between the end of the text and list
of references. If this document pertains to a par-
ticular manuscript then the author(s) of the original
paper(s) will be provided a copy of the letter and of-
fered the opportunity to submit for consideration a
reply within 30 days. Responses will have the same
page restrictions and format as the original opinion
and current viewpoint, and the titles shall end with
“Opinions.” They will be published together. Letters
and replies shall follow appropriate AFAB format
and may be edited by the editor-in-chief and a tech-
nical editor. If multiple letters on the same topic are
received, a representative set of opinions concern-
ing a specific article will be published. A disclaimer
will be added by the editorial staff that the opinion
expressed in this viewpoint is the authors alone and
does not necessarily represent the opinion of AFAB
or the editorial board.
CoPYRIghT AgReeMenT
The copyright form is published in AFAB as space
permits and is available online (www.afabjournal.com).
AFAB grants to the author the right of re-publication
152 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
in any book of which he or she is the author or edi-
tor, subject only to giving proper credit to the original
journal publication of the article by AFAB. AFAB re-
tains the copyright to all materials accepted for pub-
lication in the journal. If an author desires to reprint
a table or figure published from a non-AFAB source,
written evidence of copyright permission from an au-
thority representing that source must be obtained by
the author and forwarded to the AFAB editorial office.
PeeR ReVIew PRoCeSS
Authors will be requested to provide the names
and complete addresses including emails of five (5) potential reviewers who have expertise in the research
area and no conflict of interest with any of the authors.
Except for manuscripts designated as Rapid Commu-
nication each reviewer has two (2) weeks to review
the manuscript, and submit comments electronically
to the editorial office. Authors have three (3) weeks
to complete the revision, which shall be returned to
the editorial office within six (6) weeks after which the
authors risk having their manuscript removed from
AFAB files if they fail to ask the editorial office for
an extension by email. Deleted manuscripts will be
reconsidered, but they will have to be processed as
new manuscripts with an additional processing fee as-
sessed upon submission. Once reviewed, the author
will be notified of the outcome and advised accord-
ingly. Editors handle all initial correspondence with
authors during the review process. The editor-in chief
will notify the author of the final decision to accept or
reject. Rejected manuscripts can be resubmitted only
with an invitation from the editor or editor-in chief. Re-
vised versions of previously rejected manuscripts are
treated as new submissions.
PRoduCTIon of PRoofS
Accepted manuscripts are forwarded to the edito-
rial office for technical editing and layout. The manu-
script is then formatted, figures are reproduced, and
author proofs are prepared as PDFs. Author proofs
of all manuscripts will be provided to the correspond-
ing author. Author proofs should be read carefully and
checked against the typed manuscript, because the
responsibility for proofreading is with the author(s).
Corrections must be returned by e-mail. Changes
sent by e-mail to the technical editor must indicate
page, column, and line numbers for each correction
to be made on the proof. Corrections can also be
marked using “track changes” in Microsoft Word or
using e-annotation tools for electronic proof correc-
tion in Adobe Acrobat to indicate necessary chang-
es. Author alterations to proofs exceeding 5% of the
original proof content will be charged to the author. All
correspondence of proofs must be agreed to by the
editorial office and the author within 48 hours or proof
will be published as is and AFAB will assume no re-
sponsibility for errors that result in the final publication.
PuBlICATIon ChARgeS
AFAB has two publication charge options: conven-
tional page charges and rapid communication. The
current charge for conventional publication is $25 per printed page in the journal. There is no additional
charge for the publication of pages containing color
images, micrographs or pictures. For authors who
wish to have their papers processed as a rapid com-
munication, authors will pay the rapid communication
fee when proofs are returned to the editorial office
in addition to twice the conventional page charges.
Charges for rapid communications are $1000 per manuscript for guaranteed peer review within one
week and $100 per journal page.
hARd CoPY offPRInTS
If you are wishing to obtain a physical hard copy of
the AFAB journal, offprints are available in any quan-
tity at an additional charge: $100/page for black-white
and $150/page for color prints. You may order your
offprints at any time after publication on our website.
Scientific conference organizers may be expected to
agree to a set number of offprints as a part of their
agreement with AFAB.
MAnuSCRIPT ConTenT ReQuIReMenTS
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 153
Preparing the Manuscript File
Manuscripts must be written in grammatically
correct English. AFAB offers a fee based language
service upon request ([email protected]).
Manuscripts should be typed double-spaced, with
lines and pages numbered consecutively. All docu-
ments must be submitted in Microsoft Word (.doc or
.docx, PC or Mac). All special characters (e.g., Greek,
math, symbols) should be inserted using the sym-
bols palette available in this font. Tables and figures
should be placed in separate sections at the end of
the manuscript (not placed in the text). Failure to fol-
low these instructions will cause delays of the pro-
cessing and review of the manuscript.
Title Page
At the very top of the title page, include a title of
not more than 100 characters. Format the title with
the first letter of each word capitalized. No abbre-
viations should be used. Under the title, the authors
names are listed. Use the author’s initials for both first
and middle names with a period (full-stop) between
initials (e.g., W. A. Afab). Underneath the authors, a
list affiliations must be listed. Please use numerical
superscripts after the author’s names to designate
affiliation. If an authors address has changed since
the research was completed, this new information
must be designated as “Current address:”. The cor-
responding author should be indicated with an aster-
isk e.g., * Corresponding author. The title page shall
include the name and full address of the correspond-
ing author. Telephone and e-mail address must also
be provided for the corresponding author, and email-addresses must be provided for all authors.
Editing
Author-derived abbreviations should be defined
at first use in the abstract and again in the body of
the manuscript. If abbreviations are extensive au-
thors may need to provide a list of abbreviations
at the beginning of the manuscript. In vivo, in vitro
and bacterial names must be italicized (obligatory).
Authors must avoid single sentence paragraphs and
merge such paragraphs appropriately. Authors must
not begin sentences with “Figure or Table shows…”
as these are inanimate objects and cannot “show”
anything. When number are reported in text or in ta-
bles, always put a zero in front of decimal numbers:
“0.10” instead of “.10”.
MAnuSCRIPT SeCTIonS
Abstract
The abstract provides an abridged version of the
manuscript. Please submit your abstract on a sepa-
rate page after the title page. The abstract should
provide a justification of your work, objectives, meth-
ods, results, discussion and implications of study or
review findings . Your abstract must consist of com-
plete sentences without references to other work or
footnotes and must not exceed 250 words. On the
same page as your abstract, please provide at least ten (10) keywords to be used for linking and index-
ing. Ideally, these keywords should include signifi-
cant words from the title.
Introduction
The introduction should clearly present the foun-
dation of the manuscript topic and what makes the
research or the review unique. The introduction
should validate why this topic is important based on
previously published literature, and the relevance of
the current research. Overall goals and project ob-
jectives must be clearly stated in the final sentence
of the last paragraphs of the introduction.
Materials and Methods
Information on equipment and chemicals used
must include the full company name, city, and state
(country if outside the United States or Province if
in Canada) [i.e., (Model 123, ACME Inc., Afab, AR)].
Variability, Replication, and Statistical Analysis
To properly assess biological systems indepen-
154 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
dent replication of experiments and quantification
of variation among replicates is required by AFAB.
Reviewers and/or editors may request additional
statistical analysis depending on the nature of the
data and it will be the responsibility of the authors
to respond appropriately. Statistical methods com-
monly used in the bacteriology do not need to be
described in detail, but an adequate description
and/or appropriate references should be provided.
The statistical model and experimental unit must
be designated when appropriate. The experimen-
tal unit is the smallest unit to which an individual
treatment is imposed. For bacterial growth stud-
ies, the average of replicate tubes per single study
per treatment is the experimental unit; therefore,
individual studies must be replicated. Repeated
time analyses of the same sample usually do not
constitute independent experimental units. Mea-
surements on the same experimental unit over time
are also not independent and must not be consid-
ered as independent experimental units. For analy-
sis of time effects, assess as a rate of change over
time. Standard deviation refers to the variability
in the biological response being measured and is
presented as standard deviation or standard error
according to the definitions described in statistical
references or textbooks.
Results
Results represent the presentation of data in
words and all data should be described in same
fashion. No discussion of literature is included in
the results section.
DiscussionThe discussion section involves comparing the
current data outcomes with previously published
work in this area without repeating the text in the
results section. Critical and in-depth dialogue is
encouraged.
Results and Discussion
Results and discussion can be under combined or
separate headings.
Conclusions
State conclusions (not a summary) briefly in one
paragraph.
Acknowledgments
Acknowledgments of individuals should include
institution, city, and state; city and country if not U.S.;
and City or Province if in Canada. Copies being re-
viewed shall have authors’ institutions omitted to re-
tain anonymity.
References
a) Citing References In Text
Authors of cited papers in the text are to be pre-
sented as follows: Adams and Harry (1992) or Smith
and Jones (1990, 1992). If more than two authors of
one article, the first author’s name is followed by the
abbreviation et al. in italics. If the sentence structure
requires that the authors’ names be included in pa-
rentheses, the proper format is (Adams and Harry,
1982; Harry, 1988a,b; Harry et al., 1993). Citations to a
group of references should be listed first alphabeti-
cally then chronologically. Work that has not been
submitted or accepted for publication shall be listed
in the text as: “G.C. Jay (institution, city, and state,
personal communication).” The author’s own un-
published work should be listed in the text as “(J.
Adams, unpublished data).” Personal communica-
tions and unsubmitted unpublished data must not
be included in the References section. Two or more
publications by the same authors in the same year
must be made distinct with lowercase letters after
the year (2010a,b). Likewise when multiple author ci-
tations designated by et al. in the text have the same
first author, then even if the other authors are differ-
ent these references in the text and the references
section must be identified by a letter. For example
“(James et al., 2010a,b)” in text, refers to “James,
Smith, and Elliot. 2010a” and “James, West, and Ad-
Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012 155
ams. 2010b” in the reference section.
b) Citing References In Reference Section
In the References section, references are listed in
alphabetical order by authors’ last names, and then
chronologically. List only those references cited in the
text. Manuscripts submitted for publication, accepted
for publication or in press can be given in the refer-
ence section followed by the designation: “(submit-
ted)”, “(accepted)’, or “(In Press), respectively. If the
DOI number of unpublished references is available,
you must give the number. The year of publication fol-
lows the authors’ names. All authors’ names must be
included in the citation in the Reference section. Jour-
nals must be abbreviated. First and last page num-
bers must be provided. Sample references are given
below. Consult recent issues of AFAB for examples
not included in the following section.
Journal manuscript:
Examples:
Chase, G., and L. Erlandsen. 1976. Evidence for a
complex life cycle and endospore formation in the
attached, filamentous, segmented bacterium from
murine ileum. J. Bacteriol. 127:572-583.
Jiang, B., A.-M. Henstra, L. Paulo, M. Balk, W. van
Doesburg, and A. J. M. Stams. 2009. A typical
one-carbon metabolism of an acetogenic and
hydrogenogenic Moorella thermioacetica strain.
Arch. Microbiol. 191:123-131.
Book:
Examples:
Hungate, R. E. 1966. The rumen and its microbes.
Academic Press, Inc., New York, NY. 533 p.
Book Chapter:
Examples:
O’Bryan, C. A., P. G. Crandall, and C. Bruhn. 2010.
Assessing consumer concerns and perceptions
of food safety risks and practices: Methodologies
and outcomes. In: S. C. Ricke and F. T. Jones. Eds.
Perspectives on Food Safety Issues of Food Animal
Derived Foods. Univ. Arkansas Press, Fayetteville,
AR. p 273-288.
dissertation and thesis:
Maciorowski, K. G. 2000. Rapid detection of Salmo-
nella spp. and indicators of fecal contamination
in animal feed. Ph.D. Diss. Texas A&M University,
College Station, TX.
Donalson, L. M. 2005. The in vivo and in vitro effect
of a fructooligosacharide prebiotic combined with
alfalfa molt diets on egg production and Salmo-
nella in laying hens. M.S. thesis. Texas A&M Uni-
versity, College Station, TX.
Van Loo, E. 2009. Consumer perception of ready-to-
eat deli foods and organic meat. M.S. thesis. Uni-
versity of Arkansas, Fayetteville, AR. 202 p.
web sites, patents:
Examples:
Davis, C. 2010. Salmonella. Medicinenet.com.
http://www.medicinenet.com/salmonella /article.
htm. Accessed July, 2010.
Afab, F. 2010, Development of a novel process. U.S.
Patent #_____
Author(s). Year. Article title. Journal title [abbreviated].
Volume number:inclusive pages.
Author(s) [or editor(s)]. Year. Title. Edition or volume (if
relevant). Publisher name, Place of publication. Number
of pages.
Author(s) of the chapter. Year. Title of the chapter. In:
author(s) or editor(s). Title of the book. Edition or vol-
ume, if relevant. Publisher name, Place of publication.
Inclusive pages of chapter.
Author. Date of degree. Title. Type of publication, such
as Ph.D. Diss or M.S. thesis. Institution, Place of institu-
tion. Total number of pages.
156 Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012
Abstracts and Symposia Proceedings:
Fischer, J. R. 2007. Building a prosperous future in
which agriculture uses and produces energy effi-
ciently and effectively. NABC report 19, Agricultural
Biofuels: Tech., Sustainability, and Profitability. p.27
Musgrove, M. T., and M. E. Berrang. 2008. Presence
of aerobic microorganisms, Enterobacteriaceae and
Salmonella in the shell egg processing environment.
IAFP 95th Annual Meeting. p. 47 (Abstr. #T6-10)
Vianna, M. E., H. P. Horz, and G. Conrads. 2006. Op-
tions and risks by using diagnostic gene chips. Pro-
gram and abstracts book , The 8th Biennieal Con-
gress of the Anaerobe Society of the Americas. p.
86 (Abstr.)
Data Presentation in Tables and Figures
Figures and tables to be published in AFAB must
be constructed in such a fashion that they are able
to “stand alone” in the published manuscript. This
means that the reader should be able to look at
the figure or table independently of the rest of the
manuscript and be able to comprehend the experi-
mental approach sufficiently to interpret the data.
Consequently, all statistical analyses should be very
carefully presented along with variation estimates
and what constitutes an independent replication
and the number of replicates used to calculate the
averages presented in the table or figure.
Each table and figure must be on a separate
page in the submitted paper. In addition, you will
need to submit all data for charts, tables and
figures in native format when possible (e.g., Mi-
crosoft excel, Powerpoint). Photographs should
be submitted as high-resolution (600 dpi) .jpg or
tif. files. All figures should be clearly presented with
well defined axis and units of measurement. Sym-
bols, lines, and bars must be made distinct as “stand
alone” black and white presentations. Stippling,
dashed lines etc. are encouraged for multiple com-
parison but shades of gray are discouraged. Color
images, micrographs, pictures are recommended
and there is no additional fee for their submission.
AFAB Online Edition is Now Available!
www.AFABjournal.com
• Free Access
• Print PDFs
• Flip Through Issues
• Search Article Archives
• Order Reprints
• Submit a Paper