SUPPLEMENTAL MATERIAL FOR:

Activated Notch counteracts Ikaros tumor suppression in

mouse and human T cell acute lymphoblastic leukemia

Matthew T. Witkowski, Luisa Cimmino, Yifang Hu, Thomas Trimarchi, Hiromi Tagoh,

Mark D. McKenzie, Sarah A. Best, Laura Tuohey, Tracy A. Willson, Stephen L. Nutt,

Meinrad Busslinger, Iannis Aifantis, Gordon K. Smyth, and Ross A. Dickins

SUPPLEMENTAL METHODS

Transgenic mice

TRE-GFP-shRNA transgenes were detected by PCR using forward primers specific for each

shRNA (Ikaros.4056: 5’-GTATTAATCTCTGAATACCACTGG; Luc.1309: 5’-

GTATTAATCAGAGACTTCAGGCGG) and a common reverse primer

(GAAAGAACAATCAAGGGTCC) yielding a 210 bp product. The Vav-tTA transgene was

detected tTA specific forward (CCATACTCACTTTTGCCCTTTAG) and reverse

(CAGCGCTGAGTGCATATAATGCA) primers, yielding a 221 bp product.

Cell culture and western blotting

OP9-DL1 stromal feeder cells were cultured in IMDM supplemented with 10% FBS, 100µg/mL

streptomycin, 100U/mL penicillin, 100µM L-glutamine and 50µM β-mercaptoethanol and grown

at 37°C in 10% CO2. Wild type fetal liver cells were retrovirally co-infected with LMP-Cherry-

based shRNA vectors and MSCV-IRES-GFP vectors and cultured on an OP9-DL1 layer in

media conditioned with 1ng/µL IL-7 (Peprotech) and 5ng/µL Flt3L for 12 days to induce T

differentiation. 2Q T hybridoma cells were cultured similar to OP9-DL1 cells but with DME-

KELSO replacing IMDM. Cell lysates were western blotted with anti-Ikaros antibody E-20 (sc-

9861) (Santa Cruz Biotechnology, CA), anti-cleaved Notch1 (ICN1) antibody D3B8 (Cell

Signaling, Boston, MA), anti-acetyl-Histone H3 antibody 06-599 (Millipore, Billerica, MA) and

anti-actin antibody I-19 (sc-1616) (Santa Cruz Biotechnology).

Leukemia transplantation

Primary splenocytes from leukemic mice (predominantly leukemia cells) were transplanted by

tail vein injection into immunocompromised Rag1–/– recipient mice (2 x 106 cells/mouse).

Transplant recipients generally developed overt signs of leukemia after approximately 2 weeks.

For T-ALL transduction, 5 x 106 freshly harvested secondary leukemic spleen cells were spin-

infected at 1,200 rpm at 22°C onto a retrovirus-coated plate for 2 hours. Following centrifugation,

cells were incubated in medium for 6 h at 37°C in 10% CO2 and transplanted by tail vein

injection into recipient mice. Doxycycline treatment was commenced upon detection of GFP+

tumor cells in peripheral blood.

Flow cytometry and blood analysis

Mice were monitored for signs of leukemia (loss of activity or weight, breathing difficulty,

enlarged lymph nodes, palpable splenomegaly). Single cell suspensions were prepared from

bone marrow, thymus, and peripheral blood. Following red blood cell lysis, cells were stained

with APC-conjugated anti-B220 (BD553092) or anti-CD8 (eBioscience 17-0081-82), or PE-

conjugated anti-CD4 (BD553730) or anti-Mac1 (BD557397). Stained cells were analysed on a

fluorescence activated cell sorter (BD FACSCalibur, BD Biosciences, San Jose, CA). To assess

viability, cells were stained with AlexaFluor 647-conjugated AnnexinV (Invitrogen A23204) in

AnnexinV binding buffer (BD556454). Stained cells were analysed on a fluorescence activated

cell sorter (BD LSRII). For OP9-DL1 co-culture, cells were harvested and removed from the

stromal layer for antibody staining. Biotinylated antibodies were used for lineage exclusion

(Ter119-biotin Ly76, Gr1-biotin CR868C5, Mac1-biotin M1/70, B220-biotin RA36B2;

generated in the WEHI Monoclonal Antibody Facility), then stained for CD8-PECy7 (Biolegend

53-6.7), CD4-PE (WEHI GK1.5), CD44-APC (WEHI IM7.81) and CD25-PerCP.Cy5.5

(Biolegend PC621). Stained cells were analysed on a fluorescence activated cell sorter (BD

LSRII).

RNA-seq profiling of ALL65, ALL101, and ALL211

RNA samples were sequenced on an Illumina HiSeq 2000 to produce 100 bp reads, either single-

end (ALL65 and ALL101) or paired-end (ALL211). Reads were mapped to the mouse genome

(mm10, NCBI build 38.1) by the subread aligner (7). Read counts were obtained for RefSeq

Entrez genes using featureCounts (8). To cut down on variation not relevant to the current study,

sex-linked genes (those on the Y chromosome plus Xist,), mitochondrial genes and unannotated

genes without recognized gene symbols were excluded from the analysis. Remaining genes were

filtered as not expressed if they failed to show at least one count per million reads in at least 3

samples. TMM normalization (9) was applied using edgeR software (10).

The individual leukemias (ALL65, ALL101 and ALL211) were analyzed separately by

computing predictive log2 fold changes between treated and untreated samples using edgeR with

a prior count of 3. The predictive log folds are shrunk towards zero to avoid instability with

small counts in one or more samples. Both technical and biological replicates of ALL101 were

averaged for this purpose. Other statistical analyses were conducted using the limma software

package (11). Barcode plots for individual leukemias were ranked by predictive log fold changes

and gene set tests used mean-rank enrichment tests (2). For analysis of biological replicates, read

counts were transformed to log-counts-per-million and associated precision weights using the

voom method (12). Statistical significance was assessed using linear models and empirical Bayes

moderated t-statistics (13) controlling the false discovery rate at 5%. The analysis of the ALL101

biological replicates was a simple two group comparison. The combined analysis of all three

leukemias was a paired analysis with the individual leukemias as blocks. For the combined

analysis, the biological replicates of ALL101 were averaged by summing counts. Barcode plots

of combined data were ranked by moderated t statistic (14) and gene set tests used rotation gene

set testing (roast) (13, 15). Roast performs a hypothesis test that takes into account the

directionality (up or down) and strength (log2 fold change) of the genes in the set.

Mutation analysis

RNA-seq reads were searched for SNPs and other mutations using the exactSNP function of the

subread package (http://bioinf.wehi.edu.au/exactSNP). The ALL211 PEST domain sequence

variant was identified by Sanger sequencing of a PCR product amplified from genomic DNA

using forward (5’-CTACACAGCAGCCTCTCCAC) and reverse (5’-

TGACCAGGAAAATCAAGGCTCT) primers. To assess whether the ALL101 Notch1

mutations were in cis or trans, approximately 2.4 kb of the coding region (spanning sequences

encoding the HD and PEST domains) was PCR amplified from ALL101 cDNA using forward

(5’-GATCGGATCCATCAAGCGCTCTACAGTGG) and reverse (5’-

GATCGTCGACGCAGAATGGTGTGCACAGGC) primers and cloned into pBlueScript

(Stratagene) using BamHI/SalI. The HD and PEST regions of several individual clones were

sequenced using M13 forward (5’-TGTAAAACGACGGCCAGT) and reverse (5’-

CAGGAAACAGCTATGAC) primers flanking the insert.

Bio-ChIP-sequencing

DP thymocytes (~2 x 108), which were enriched by CD8 MACS sorting from the thymus of

Ikzf1ihCd2/ihCd2Rosa26BirA/BirA mice, were used for chromatin precipitation by streptavidin

pulldown (Bio-ChIP), as recently described in detail (16, 17). The precipitated genomic DNA

was quantified by real-time PCR, and about 5 ng of precipitated DNA was used as starting

material for generating single-end sequencing libraries selected for DNA fragments of 200–350

bp as described by Illumina’s ChIP Sequencing sample preparation protocol. Sequencing was

carried out using the Illumina/Solexa Genome Analyzer (GA) II systems according to

manufacturer’s guidelines. Sequence reads of 36 bp that passed the Illumina quality filtering

were aligned against the mouse genome assembly version of July 2007 (NCBI37/mm9) using the

Bowtie program version 12.5, allowing up to two mismatches and ignoring any read that would

map more than once in the genome. Peaks were called by the MACS program (version 1.3.6.1)

and filtered for P values of < 10-10, as previously described (18). The peak-to-gene assignment

was based on the RefSeq database, which was downloaded from UCSC on April 29th, 2010.

Peaks were assigned to genes in a stepwise manner by prioritizing genes containing peaks in

their promoter and/or gene body, as described (18). This procedure essentially assigned peaks to

a gene if they were located in a region spanning from 50 kb upstream of the TSS to 50 kb

downstream of the TES of a given gene.

Primary human primary samples

Primary T-ALL samples were provided by the Childrens Oncology Group with informed consent

and analyzed under the supervision of the New York University Langone Medical Center

Institutional Review Board. Total RNA was extracted from samples using the RNeasy Plus mini

kit (Life Technologies, Carlsbad, CA). Samples were subject to rRNA removal using the Ribo-

Zero kit (Epicentre, Madison, WI) according to manufacturer instructions. The resulting RNA

samples were then used as input for library construction using the dUTP method as described

(19). RNA libraries were sequenced on Illumina HiSeq 2000 and 2500 machines to produce

50bp paired-end reads. Reads were aligned to the human hg19 genome using TopHat (20) v1.4

with default parameters. FPKM (fragments per kilobase per million reads) expression values

were generated by Cufflinks (21) v1.3 using RefSeq gene annotation. Genes with reduced

expression in T-ALL relative to thymocytes were ranked by Students’s t test P value following

removal of genes that had zero FKPM values in at least one sample.

SUPPLEMENTAL REFERENCES

1. Weng AP, Millholland JM, Yashiro-Ohtani Y, Arcangeli ML, Lau A, Wai C, et al. c-Myc is an important direct target of Notch1 in T-cell acute lymphoblastic leukemia/lymphoma. Genes & Development 2006 Aug 1; 20(15): 2096-2109.

2. Michaud J, Simpson KM, Escher R, Buchet-Poyau K, Beissbarth T, Carmichael C, et al. Integrative analysis of RUNX1 downstream pathways and target genes. BMC Genomics 2008; 9: 363.

3. Zeller KI, Zhao X, Lee CWH, Chiu KP, Yao F, Yustein JT, et al. Global mapping of c-Myc binding sites and target gene networks in human B cells. Proc Natl Acad Sci USA 2006 Nov 21; 103(47): 17834-17839.

4. Mingueneau M, Kreslavsky T, Gray D, Heng T, Cruse R, Ericson J, et al. The transcriptional landscape of alphabeta T cell differentiation. Nat Immunol 2013 Jun; 14(6): 619-632.

5. Herranz D, Ambesi-Impiombato A, Palomero T, Schnell SA, Belver L, Wendorff AA, et al. A NOTCH1-driven MYC enhancer promotes T cell development, transformation and acute lymphoblastic leukemia. Nat Med 2014 Oct; 20(10): 1130-1137.

6. Yashiro-Ohtani Y, Wang H, Zang C, Arnett KL, Bailis W, Ho Y, et al. Long-range enhancer activity determines Myc sensitivity to Notch inhibitors in T cell leukemia. Proc Natl Acad Sci U S A 2014 Nov 18; 111(46): E4946-4953.

7. Liao Y, Smyth GK, Shi W. The Subread aligner: fast, accurate and scalable read mapping by seed-and-vote. Nucleic Acids Res 2013 May 1; 41(10): e108.

8. Liao Y, Smyth GK, Shi W. featureCounts: an efficient general-purpose program for assigning sequence reads to genomic features. Bioinformatics 2013 Nov 13.

9. Robinson MD, Oshlack A. A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol 2010 Jan 1; 11(3): R25.

10. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010 Jan 1; 26(1): 139-140.

11. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Research 2015; 43: in press.

12. Law CW, Chen Y, Shi W, Smyth GK. Voom: precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biol 2014; 15(2): R29.

13. Smyth GK. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Statistical Applications in Genetics and Molecular Biology 2004 Jan 1; 3: Article3.

14. Lim E, Vaillant F, Wu D, Forrest NC, Pal B, Hart AH, et al. Aberrant luminal progenitors as the candidate target population for basal tumor development in BRCA1 mutation carriers. Nature Medicine 2009 Aug 1; 15(8): 907-913.

15. Wu D, Lim E, Vaillant F, Asselin-Labat M-L, Visvader JE, Smyth GK. ROAST: rotation gene set tests for complex microarray experiments. Bioinformatics 2010 Sep 1; 26(17): 2176-2182.

16. Ebert A, McManus S, Tagoh H, Medvedovic J, Salvagiotto G, Novatchkova M, et al. The distal V(H) gene cluster of the Igh locus contains distinct regulatory elements with Pax5 transcription factor-dependent activity in pro-B cells. Immunity 2011 Feb 25; 34(2): 175-187.

17. Schwickert TA, Tagoh H, Gultekin S, Dakic A, Axelsson E, Minnich M, et al. Stage-specific control of early B cell development by the transcription factor Ikaros. Nat Immunol 2014; 15(3): 283-293.

18. Revilla-I-Domingo R, Bilic I, Vilagos B, Tagoh H, Ebert A, Tamir IM, et al. The B-cell identity factor Pax5 regulates distinct transcriptional programmes in early and late B lymphopoiesis. EMBO J 2012; 31(14): 3130-3146.

19. Parkhomchuk D, Borodina T, Amstislavskiy V, Banaru M, Hallen L, Krobitsch S, et al. Transcriptome analysis by strand-specific sequencing of complementary DNA. Nucleic Acids Res 2009 Oct; 37(18): e123.

20. Trapnell C, Pachter L, Salzberg SL. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 2009 May 1; 25(9): 1105-1111.

21. Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 2010 May; 28(5): 511-515.

 

Figure S1

1 23 4 5 6 7 8

Ik1

Ikaros.2709 Ikaros.4056

CDS

Exon

mRNAisoform

ATG STOP

500

2000 100age (days)

20

40

60

80

100

Ikaros.2709 (n=6)Ikaros.4056 (n=7)

surv

ival

(%

)

Ren.713 (n=10)

150

B

Ren.713

Ikaros.4056

spleen thymus

C

0 102 103 104 1050

100

200

300

400

82.9

0 102 103 104 105

0

102

103

104

105 2.5 77.9

16

CD

4

CD8GFP

cell

coun

t

D

A

Figure S2

shRNA on:Ikaros

knockdown

shRNA off: Ikaros

restoration

untreated + Dox

Vav-tTAX

VAV-tTA; TRE-GFP-shIkaros

leukemiatransplant

Vav-tTA;TRE-GFP-shIkaros

untreatedFACS sort

GFP+leukemia

cells

3 mice

Dox 3d

3 mice

A B

Ikzf1 Fignl1

untre

ated

3 da

ys D

ox

BA

Figure S3

0 101 102 1030

20

40

60

80

100

GFP

Freq

untreated d3 Dox C

−2 0 2 4 6 8 10 12

−6−4

−20

24

ALL101: RNA−Seq

Average log−expression

log−

fold

−cha

nge

●

●

●

●

●●

●

●

●

●

●●

●

●

●

●

●

●●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

● ●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●●

●●

●

●

●

●●

●

●

●

● ●

●

●

●

●●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●●

●●

●

●●

●

● ●

● ●

●

●

●

●

●

●

●

●

●●

●

●

●● ●

●●

●

●●

●

●

●●

●

●●●

● ●

●●●

●●

●

●

●

●●

●●

●

●

●

●

●●

●

●

●

●

●

●

●●

●●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●● ● ●

●

●

●●

●

●●

● ●●

●

●●

●

●

●

●

●

● ●

●

●

●

●

●

●

●●●

●●

●

●

●

●

●●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●●

●

●

● ●●

●

●

●

●

●

●

●

●

●

●●●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●●

●●

●

●

●

●●

●●●

●

●

●

●●

●

●

●●●

●●

●

●● ●

●

●

●

●

●

● ●

●

●●

●

●

●

●●●

●●

●●

● ●

● ●●

●●●

●●●

●

●

●

●

●

●

●●

●

●

●

●

●●

●●

●

●

●

●●

●

●

●

●

●●

● ●

●

●●●

●

●●

● ●

●

●●

● ● ●

●

●

●●

●

●●

●

●

●

●

●

●

● ●

● ●●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●●

●

●

● ●● ●

●

●

●

●

●

● ●

●

●

●

●

●● ●

●●

●●

●●

●

●

●

●

●●

●

●●

●

●

●

●

●

●

●●

●

●

●

●

●●

●

●

●

●

●

● ●

●● ●

●● ●

● ●

●

●

●

●

●

●●

●

●

●

●

●●

●●

●●●

●

●

● ●

●

●

●

●

●

●●

●

●

●●

●

●

●● ●

●

●

●

●

●

●

●●

●●●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●● ●

●

●

●

●●

●

●●

●●

●

●

●

● ●

●

●

●

●

●●

●

●

●

●

●

●

●●

●●

●

●

●

●

●●●

●●

●● ●

●

●

●

●

●

●

●●

●●

●

●

●●

●●

●●

●

●

●

●

●

●●●

●

●

●●●

●

●

●

● ●

●

●

●●

●●

●

●

●

●

●

●●

● ● ●●

●

●

●

●

●

●

●●

●●●● ●

●●

●●

●● ● ●●

●

●

●

●

●

●

●

●

●

●● ●

●

●

●

●

●

●

●●

●

●

●●

●

●

●

●

●●

●●

●

●

●

●

●

●

●●

●

●

●

●●

●

●

●

●●

●●

●

●●

●

●

●

●●

●●

●

●

● ●●●

●

●

●

●

●

●

●

●

●

● ●●

●●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

● ●●

●

●

●●

●

●

●●●

● ●● ●

●●

●●

●

●

●

●●

●

●●

●

●

●

●

●

●

●

●● ●

●

●

●

●

●

●

●

●

●

●

●

●●

●

● ●

●

●● ●

●

●

●

●●

●

●●

●

●

●

●

●

●

●

●●

●

●

●●

●

●

●

● ●●

●●

●

●●

●

●

●● ●

●●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●●

●

●●

●

●

●●

●

●

●

●

●

●

●

●●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●●

●

●

●●

●

●

●

●

● ●

●

●

●

●●

●●

●●

●●

●

●●

●●●

●● ●●

●

●●●

●

●

●●

●

●●

●

●

●

●

●●

●

●

●

●

●

●

●

●

● ●

●

●

●

●

●●

●

● ●

●

●

●

●

●●

●

●

●

● ●

●

●

●

●

●● ●●

●

●●

●●

●●

●

●

●●

●

●

●

●

●●

●●

●●

●

●

●

●

●

●●

●

●●

●

●●

●

●●●●

●

●●

●

●●

●

● ●

●●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●● ●

●

●

●

●

●

●

●

●●

●

●

●●

●

●●●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●●

●●

●

●

●

●

●

●

●

● ●●

●

●

●

●

●

●●

●●

●

●

●

●

●

●●

●

●●

●

●

●●

●●

●

●

●

●

●

●

●

●

●●

●

● ●

●

● ●

●

●

●● ●

●

●

●

●

●

●●

●

●

●●

●●

●

●● ●

●

●●

●

●

●

●●

●

●

●

● ●● ●

●

●●●

●

●

●

●

● ●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

● ●

●●

●

●● ●

●●

●●

●

●

●

●●

●

●

●

●

●● ●●

●

●

●

●●

●

●

●

●

●●●

●

●

●

●●

●

●● ●●

● ●

●

●●

●

●

●

●

● ●● ●

●

●●●

●

●●●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●●

●●

●

●

●

●

●

●

●

●●

●●

●

● ●

●

●

●

●●

●●

●

●

●

●

●

●

●

●

●●

●

●

● ●● ●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●●

●

●●

●

●

●

●

●

●

● ●●

●

●

●

●

●

●●●

●

●

● ●

●●

●● ●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●●●

●

●

●

●

●

●

●

●●

●● ●

●●

●

●

●

●

●

●

●

●

● ●

●●

● ●

●●

●

●

●

●●

●

●

●

●●

●●

●●

●●

●●

●

●

●

● ●

●●

●

● ●●

●

●

●

●

●

●

●●

●

●

●●

●

● ●

●

●●

●●●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●●●

●

●

●●

●

●

●

●

●

●●●

●

●

●

●● ●

●

●●

●●

●

●

●

●

●

●

●

●

●●

●

●

●

●●●

●

●● ●

●

●●

●●

● ●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●●

●

●

●

●●

●●

●

● ●

●

●

●

●

●● ●

●

●

●

●

●

●

●

● ●

●

●

●

●

●

●●

●

●

●

●

●

●

●●●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●● ●●

●

●●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●●

●●

●

●

● ●

●

●

●

●

●

●

●

●

●●●

●

●

●

●●

●●

●

●

●

●

●

●●

●

●

●

●

●

●

● ●

●●●

●

●●

●●

●●

●

●

●

●

●

●

●

● ●●

●

●●

●

●

●

●●

●

●

●

●

●●

●

●

●

●●● ●

●

●

●

●●●

●

● ●

●

●

●

●

●

●

●

●

● ●

●

●●

● ●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●●

●●

●

● ●

●

●

●

●●

●

●

●●

●

●

●

●

●

●

●

● ●

●

●●

●

●

●

●

●

●

●

●

●●

●

●

●

●

● ●

●

●●●

●●

●

●

●

●

●

●

●

●

●

●

● ●●

●

●

● ●

●

●

●

●●

●

●●

●

●

●

●●

●

●

●

●

●

●

●●

●●

●

●

●

●●

●●

●

●

●●

●●

● ●●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

● ●●

●

●

●

●

●●

●

●

●

●●

● ●

●

●●

●

●

●

●

●

●

●

●

●●

●

●

●

●●

●

●●●

●

● ●

● ●

●

●●

●●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●●●

●

●

●

●●

● ●

●

●

●●

●

●

●●

●

●

●

●

●

●

●

● ●

●

●

●

●●

●●

●

●

●●

●

●

●

●

●●

●

●

●

●

●

● ●

●

●●

●

●●

●

●●● ●

●

●●

●●

●

●

●

●

●

●

●

●

●

●

● ●●●

●

●

●●

●

●

●

●

●

●●●

●

●

●

●

●

●

●●

●

●

●●

●

●

●

●●

●

●

●

●

●●

●●

●

●

●

●●

●

●

●●

●

●

●●

●●

●

●

●●

●

●

●●

●

●

●

● ●●

●

●

●● ●

●

● ●

●

● ●●

●● ●

●●

●

●

●

●

●

●

●

●

●

●

●

●●

●

● ●●●

●

●

●

●

●

●●

●

●

●●

●

●

●

●

●

●

●●

●

●

●

● ●

●●

●

●●

●

●

●

●

●

●

●

●

● ●

●

●

●

●●

●●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●●

●

●

●

●●

●●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●●

●

●

●

●●

●

●

●

●

●

●

●

●

●●●

●

●

● ●

●●●

●

●

●●

●

●

● ●

●

●

●

●

●

●

●

●● ●●

●●

●●●

●

●● ●

●

●

●

●●

●

●

●

●●●

●●●

●

● ●

●

●

●

●●●●●●

●●

●

●

●

●

●●

●

●

●

● ●

●

●

●

● ●●

● ●●

● ●●

●●

●●

●

●

●●

●

●●

●

●●

●

●

●

●

● ●

●

●

●

●

●

●●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

● ●●

●●

●● ●

●

●

●●

●

●

●

●●

●

●●

●

●

●

●●

●

●● ●

●

●● ●

●

●

●●

●

●

●

●

●●● ●

●

●

●

●

●

●

● ●

●

●

●

●

●

●

●

●●

●

●

●●

●

●

●

● ●●

●●

●

●●

●

●

●

●

●

●●

●

●

●

●●● ●

●

●

●

●

●

● ●

● ●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

● ●●

● ●

●

●

●

●

●

●

●

●●

●● ●

●

●

●

●

●

●

●●

●

●

●●●

●●

●

●

●

●

●

●●

●

●●

●●●

●● ●

●

●

●

●● ●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

● ●

●●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

● ● ●

●

●● ●

●

●

●●

●

●●

●

●

●

●

●

●

●

●●

●

●

●●

● ●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●●

●

●

●

●

●●

●●

●

●●●

●

●● ●

●

●●

●

●●

●

●

●●●

●

●●●

●

●

●

●

●

●

●

●

●

● ●

● ●

●

● ●

●

●

●

●●

●

●●●

●

●

●

●

●

●

●

●

●

●●

●

●●

●

●●

●

●

●

● ●

●

●

●

●

●

●

●

●

●

● ●

●

●

●●

●

●

●

●

●

●

●●

●

●●

●

●

●●

●

●●

●

●●

●

●

●● ●

●

●

●

●●

●

●

●

●

● ●

●●

●

●

●

●

●

●

●●●

●●

●

●

●

●

● ●

●

●

●

●

●

●

●

● ●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●●

●

● ●●

●

●

●

●●●

●●●

●●

●

●● ●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●●

●● ●

●●

●

●

●●

●●●

●

●●

●

●

●

●

●

●

●● ●

●●

●

●

●●

●●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●●

●

●

●● ●

●●

●

●

●

●●

●

●

●

●●

●

●

●●●

●

●

●

●

●●

●

●

●

●

●●

● ●

●

●

●

●

●

●

●

●●●

●

●

●

●●

●

●

●

●

● ●

●

●

●

●

●

●

●●

●

●

●●

●

●

●

●

●●

●●

●

●

●

●●

●●

●

●●

●

●

●

●

●

●●

●

●

●●

●

●

●

●●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●●

●

●

●●

●●●

●●

● ●

●

●

●●

●

●

●●

●●

●

●

●

●

●

●

●

●●

●

●●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●●

●

●●●

●●

●●

●

●

●●

●●

●●●●

● ●●

●

●

●

●

●

●

●

● ●

●● ● ● ●

●

● ●

●

●●

●

●

●

● ●

●

●

●

●●

●

●●

●

●

●

●●

●

●●

●●

●

●

●

●●

●

●

●

● ●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

● ●

●●●

●

●

●●

●

●

●

●

●

●●

●

●

●●

●

●

●●

●

●

●

●

●●

●●

● ●●●

●

●●

●

●

●

●

●

●

● ●●

●

●

●

●

●

●●

●

●

●

●

●

●

● ●

●

●●

●

●●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●●

●

●

●

●

● ●●

●●

●

●

●●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●●

●

●

●●

●●

●

●

●●

●

●●

●●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●●

●

●●

●

●●

●●

●

●

●

●●

●

●

●

●

●

●

●

●

●●

●●

●

● ● ●

●● ●

●●

●

●

●●

● ●

● ●●●

●

●

●

●●

●●

●

●●● ●

● ●●

●●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●●●

●

●●

●

●

●

●

●

●

●

●

●

●●

●●

●●●

●●

●●

●

●

●●

●

●

●

●

●

●

●●●

●

●

●

●

●

●

●●

●

●

● ●

●

●

●

●

●

●

●●

● ●●

●

●

●

●●

●

●

●

●●

●

●●

●

●●

●●●

●

●

●

●●

●

●●

●

● ● ●

●●

●

●

●●

●●

●

●●

●●

●

●●

●●

●

●

●●

●

●

●

●

●●

●● ● ●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

● ● ●

●

●

●

●

●●

●

● ●

●

●

●●

●

●●

●

●

●

●

●●

●

●

●

●

●●

●

●

● ●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●●

●

●●

●

●

●

●

●

●

●

●●●

●

● ● ●

●●●

●●

●

●

●

●

●

●●

●

●

●

●●

●●

●

●

●

●

●

●●●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●●

●●

●●

●

●

●●

●

●

●

●●

●

●

●

●

●●

●

●

●

●● ●

●●●

●

●

●

● ●●

●

●

●

●

●●

●●

●

●

●●●

●

●

●

●

●● ●

●

● ●

●

● ●

●

●

●

●

●

●●

●

●●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●●●

●

● ●

●

●

●

●

●

●

●

●

●●

●

●

●

●●●

●

●●

●

●

●

●

●

● ●

●

●

●●●

●

● ●

●●

●●

●●

●

●

●

●

●

●

●

●●

●

●

●●

●●

●

●

●

●

●●

●

●

●

● ●

●

●

●

●

●

●●

●

●

●

●

●●●

●

●

●

●

●

●

●

●

● ●●

●

●●

●

●

●

●

●

●

●

●

● ●●

●

●

●●

●●

●

●

●

●●

●

●

●

●

●●

●●

●

●

●

●●

●

●

●●

●

●

●

●●

●

●

●

●

●

●●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●●

●

● ●

●●

●

●

● ●

●

●

●

●

● ●

●●

●

●

●

●

●

●●

●

●●

●

●

●

●

●

●

●

●

●●

●

●●

●

●

●●

●

●●

●

●

●

●

●●●

●

●

●

●

●

●

●

● ●

●

●

●

●

●

● ●

●

●

●

●●●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●●

●

●

●●

●

●

● ●●● ●

●

●

●

●

●

● ●

●●

●●

●

●

●

●

●

●●

●

●

●

● ●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

● ●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●●

●

●

●

●

●

●

●●

●●

●

●

●

●●

●●

●

●

●

●●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●●

●

●

●●

●

●

●

●

●

●

●

●

●

● ●

●

●●

●●

●

●

●

●● ●●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

● ●

●●

●

●

●

●

●

●

●

●●

●● ●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

● ●

●

●

●

●

●

●●●

●

●

● ●

●

●●

●

●

●

●●

●

●

●

●●

●

● ●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●●

●

●

●●

●

●●

●

●

●

●

●

●

●

●

●

● ●

●

●

●

●

●

●

●

●●●

●

●

●

●

●

●

●

●

●

●

●●

●

●●

●

●

●

●●

●

●

●

●

●

●●

●

●●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●●●

●

●

●

●

●

●

●

● ●

●

●

●

●

●

●

●

●

●●

●●

●

● ● ●● ●

●

●●

●

●● ● ●

●

●●

●●

●●

●

●

●●

● ●

●

●

●

●●

●

●●

●

●●

●

●●

●

●●

●

●

●

●

●

●

●●

●

●

●●●

●

●

●

●

●

●

●

●

●●●

●

●

●

●● ●

●

●●

●●●

●

●

●

●

●● ●●●

●

●●

●

●● ●

●

●

●

●

●

●

●●

●

●

●●

●

●

●

●

●●

●●

●

●●

●

● ●

●

●●●

●

●

●

●

● ●

●

●●

●

●● ●

●

●

●

●

●●

●

●

●

●

●

●

●●● ●

●

●●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●●

●

●

●

●●

●

●

●

●

●●

● ●

●●

● ●

●●

● ●●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●●

● ●

●

●●

●

●

●

●

●

●●

●

●

●

●●

●

●

●●●

●

●

●

●●

●

●

●

●●

●

●●

●

●●

●

●

●

●

●

●

●

● ●

●

●

●●

●

●

●

●

●

●

●

●

●●

●

●

●

● ●●

●

●

●

●

●

●

●●

● ●●

●

●

●

●

●

● ●

●

●

●

●

●

●

●

●●

●

●

●

●●

●

●

●

●

●

●●

●

●

●●

●

●

●●●

●

●

●

●

● ●

●

●

●

●

●●

●

●

●

●

●

●●

●●

●

●

●

●

●●

●

●

●

●

●

●●

●●

●

●

●

●●

●

●

●

●

●●

●

● ●

●

●

●

●

●●●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●●

●●

●

●●

● ●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●●

●

●

●

●

●

●

●

●

●

● ●

●

●

●

●●

●

●

●

● ●

●

●

●

●

●

●

●

● ●

●●

●

●●

●

●

● ●

●

●

●

●

●

●●

●

●●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●●

●●

●

●● ●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

● ●

●

●

●

●

●●

●

● ●

●

●●

●

●●

●

●

●

●●

●● ●

●

●

●

●●

●

●

●

●

●●●

●●

●

●●

●

●●●

●●

●

●

●

●

●

●

●

●

● ●

●

●●

●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●●●

●

●

●●

●

●

●

●

●

●

●

●●

●

●●

●

●

●

●● ●

●

●

●

●●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●●

●

●

●

●●

●

●

●

●

●

●

●

●

●●

●●

●●

●

●

● ●

●

●

●

●●●

●●●

●● ●

●

●

●

●●

●●

●

●

●

●

●

●

●

●

●

●

● ●

●

●

●

●

●●

●

●

●●●

●

●

●●

●

●●

●

●

●●

●

●●

●

● ●

●

●

● ● ●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●

●●

●

●

●●

●

●

●

●

●

●

●●

●●●

●

●

●●

●

●●

●

●

●

●

●

●

●

●

●

●●

●

● ●

●

●

●

●

●●

●

●

●●● ●

●

●

●

●

●

●

●

●

● ●●

●

●

●

●

●

●

● ●

●

●●

●●

● ●

●

●

●●

●●

●●

●

●

● ●●

●●

●

●

●

●

●

●

● ●

●

●

●

●

●

● ●●

●●

●

●

●

●●

●●●●

●●

●

●

●

●

●

●

●

●

●●

●

●

●

●

●●

●

●

●

●●

●●

●

●●●

●

●

●

●

●

●●

●

●

● ●●

●

●

●

●

●●

●

●

●

●

●

●

●

●

●●

●

● Ikzf1

3098 genes

2943 genes

2

-6

0

log2

fold

cha

nge

-4

-2

4

-2 0 2 4 6 8 10 12average expression (log2 counts per million)

ALL101: RNA-Seq

Figure S4

4.7

0

0

2.5

Enrichment

Enrichment

ALL65 RNA-SeqWeng Notch withdrawal genes

Mean-rank gene set test

increasedupon Ikarosrestoration

decreasedupon Ikaros restoration

Blue bars: genes decreased upon Notch withdrawal

Red bars: genes increased upon Notch withdrawal

4.5

0

0

3

Enrichment

Enrichment

decreasedupon Ikaros restoration

Blue bars: genes decreased upon Notch withdrawal

Red bars: genes increased upon Notch withdrawal

3.6

0

0

4.1

Enrichment

Enrichment

increasedupon Ikarosrestoration

decreasedupon Ikaros restoration

Blue bars: genes decreased upon Notch withdrawal

Red bars: genes increased upon Notch withdrawal

A B

C

increasedupon Ikarosrestoration

-5

-5

P<10

P<10

-4

-8

P<10

P<10

-6

-11

P<10

P<10

ALL211 RNA-SeqWeng Notch withdrawal genes

Mean-rank gene set test

ALL101 RNA-SeqWeng Notch withdrawal genes

Mean-rank gene set test

Figure S5

Ik1

Ik2

Actin

ALL65

d0 d3

ALL101

d0 d3

37 kDa –

50 kDa –

d7d3ut

ALL65

ALL101

ALL211

Transplant

-7d -3d ut

Diseaseonset

Harvestrecipients

Dox Dox

A

0 10 20 300

50

100

Days post dox

Perc

ent s

urvi

val

ALL211

untreatednegativeshIkarosICN1

Dox

0 10 20 300

50

100

Days post dox

Perc

ent s

urvi

val

ALL65untreatednegativeshIkarosICN1

Dox

0 10 20 300

50

100

Days post doxPe

rcen

t sur

viva

l

ALL101untreatednegativeshIkarosICN1

Dox

B

D

E

C

Ik1

Actin

Ik2*

*37 kDa –

50 kDa –

37 kDa –

d0 d3 #1 #2

relapsed29 Dox

d0 d3 Relapse0.0

0.2

0.4

0.6

0.8

1.0

Rel

ativ

e ex

pres

sion

to H

PR

T

d0 d3 Relapse0.0

0.5

1.0

1.5

Rel

ativ

e ex

pres

sion

to H

PR

T

d0 d3 Relapse0.000

0.005

0.010

0.015

Rel

ativ

e ex

pres

sion

to G

apdh

d0 d3 Relapse0.0

0.2

0.4

0.6

0.8

Rel

ativ

e ex

pres

sion

to H

PR

T

d0 d3 Relapse

0.0

0.5

1.0

1.5

Rel

ativ

e ex

pres

sion

to H

PR

T

d0 d3 Relapse

0.000

0.002

0.004

0.006

0.008

Rel

ativ

e ex

pres

sion

to G

apdh

d0 d3 Relapse0.0

0.2

0.4

0.6

0.8

1.0

Rel

ativ

e ex

pres

sion

to H

PR

T

d0 d3 Relapse0.0

0.5

1.0

1.5

Rel

ativ

e ex

pres

sion

to H

PR

T

d0 d3 Relapse0.000

0.005

0.010

0.015

Rel

ativ

e ex

pres

sion

to G

apdh

Ikaros Exons 3-4 Ikaros Exons 7-8 Hes1

ALL65

ALL211

ALL101

Figure S6

A B

Figure S7

B

Notch1

Exon 27 L1668P (HD domain)

ALL65

ALL211(Y1706S)

Sequence

46

0

65

0

ALL101

276

0

EEExon xonxon 2727277777777777L16LLL16LL 68P 68P (HD (HD domadomain)in)

Notch1 chr2:26466487 (Notch1 Exon 27)

Notch1

ALL65

ALL211

Sequence

64

0

83

0

0

Notch1 chr2:26459934 (Notch1 Exon 34)

Notch1

ALL65

ALL211

Sequence

42

0

66

0

ALL101(L1668P)

247

0

Notch1 chr2:26466601 (Notch1 Exon 27)

Notch1 chr2: (Notch1

Notch1

ALL65(P401S)

ALL211

Sequence

53

0

69

0

ALL101

410

0

Notch1 chr2:26480278 (Notch1 Exon 26)

Notch1

ALL211

Sequence

64

0

93

0

ALL101

534

0

Notch1 chr2:26459973 Notch1 Exon 34)A

C

ALL65(N2385T)

ALL101(S2398X)

ALL101 cDNA Notch1 Sanger Sequencing

Clone #1 wildtype

Clone #2c.5002T>C(L1668P)

ELYV I L

EPYV I L

HD DOMAIN

ALL101(wildtype)

ALL211(S2446fsX1)

ALL211 genomic DNA Notch1 Sanger Sequencing

AXSV A L

ASSV A L

Clone #2 wildtype

Clone #1c.7192C>A(S2398X)

PEST DOMAIN

D

E

P S S M V

P S

CG

M V

PEST DOMAIN

CA

XS

Combined T-ALLMyc cluster (Mingueneau) Enrichment (P=0.0547)

Red bars: genes induceddirectly by Myc

Combined T-ALLZeller Myc-regulated genes:

NEGATIVE correlation (P=0.0547)

Blue bars: genesrepressed directly by Myc

increasedupon Ikarosrestorationin leukemia

decreasedupon Ikaros restorationin leukemia

Myc cluster (Mingueneau) Enrichment (P=0.0547)

increasedupon Ikarosrestorationin leukemia

decreasedupon Ikaros restorationin leukemia

Figure S8

Enrichment

Enrichment

Enrichment

2.5

0

0

2.6

3.3

0

A

B

Black bars: genes where expression correlates with Myc expression

throught thymocyte development

100

5 kbMyc

ReadsC

D

100 kb

N-Me

Myc Pvt1

100

Reads

CUTLL1

Figure S9

0 24 48 GSI (hours)

IKZF1

-ACTIN

HPB-ALL

0 24 48

SUPPLEMENTAL FIGURE LEGENDS

Figure S1. (A) Schematic of murine Ikzf1/Ikaros full-length Ik1 isoform, showing sites targeted

by the Ikaros.2709 and Ikaros.4056 shRNAs. (B) Kaplan-Meier survival curves of recipient mice

reconstituted with fetal liver hematopoietic stem progenitor cells infected with LMP vectors

expressing Ikaros shRNAs or Ren.713 as indicated. (C) Enlarged thymus and spleen of a

representative leukemic Ikaros.4056 mouse compared with a healthy Ren.713 control. (D)

Representative flow cytometry of splenocytes isolated from a leukemic Ikaros.4056 mouse

showing accumulation of GFP+ CD4+CD8+ cells.

Figure S2. (A) Mating strategy to generate a mouse model of inducible Ikaros restoration in T-

ALL. (B) Strategy for tet-regulated Ikaros restoration in T-ALL in vivo.

Figure S3. (A) Histogram of GFP expression in cell suspensions from spleens of leukemic

recipient mice following transplant with Vav-tTA;TRE-GFP-shIkaros leukemia ALL101. Mouse

treatments and gates for sorting of GFP+ leukemia cells by FACS are indicated. (B) Scatter plot

of RNA-seq differential expression upon Ikaros restoration in ALL101 (comparing 3 days Dox

with untreated, averaged from 3 mice per condition). Genes with significant expression changes

(FDR<0.05) are highlighted, and Ikaros is indicated. (C) ALL101 RNA-seq tracks for

Ikzf1/Ikaros and neighbouring control gene Fignl1 for triplicate untreated and Dox treated mice.

Figure S4. Gene set analysis barcode plots of RNA-seq differential gene expression upon Ikaros

restoration in ALL65 (upper), ALL101 (middle), and ALL211 (lower), with genes horizontally

ranked by predictive log2 fold changes. Genes upregulated upon Ikaros restoration are shaded

pink (logFC > 1.2) and downregulated genes are shaded blue (logFC < –1.2). As for Figure 2E,

overlaid are a previously described set of genes induced (red bars) or repressed (blue bars) upon

Notch inhibition in a murine T-ALL cell line (1). Red and blue traces above and below the

barcode represent relative enrichment. P values for induced and repressed gene sets (indicating

significant positive correlation with genes upregulated or downregulated upon Ikaros restoration

respectively) are calculated separately using a mean-rank gene set test (2).

Figure S5. (A) Spleens isolated from representative leukemic recipient mice showing regression

of ALL65 and ALL211 following 7 days of Dox treatment, but progression of ALL101. Note

that the spleen from the ALL101 day 3 Dox treated mouse is unusually small and likely reflects

a lower leukemia burden at the start of Dox treatment for this particular mouse. (B-D) Kaplan-

Meier survival curves for leukemic recipient mice bearing ALL65 (B), ALL211 (C), and

ALL101 (D). Following disease establishment mice were either left untreated (black) or Dox

treated. ‘Negative’ (blue) indicates recipients of T-ALL cells that were either uninfected or

transduced with a negative control Cherry-expressing retroviral vector. Dox treatment

significantly extended survival of mice bearing ALL65 (median survival for untreated and Dox-

treated mice: 4 days vs 15 days respectively, P = 0.001, log rank test) and ALL211 (10 days vs

25 days, P = 0.01) but not ALL101 (7 days for both, P = 0.17). Recipients of T-ALL cells

previously transduced with ‘shIkaros’ (red) or ‘ICN1’ (green) vectors promoted relapse of

ALL65 and ALL211 as described in the text (transduced [shIkaros or ICN1] vs negative: P <

0.005 and P < 0.01 for ALL65 and ALL211 respectively). (E) Western blot analysis of Ikaros

expression in ALL65 and ALL101 cells isolated from representative leukemic mice that were

untreated or Dox treated for 3 days. The two panels are cropped from the same blot, indicating

similar Ikaros restoration in each leukemia.

Figure S6. (A) Western blot analysis of Ikaros isoform expression in ALL65 leukemia cells

isolated from independent leukemic mice that were either untreated (d0), treated with Dox for 3

days (d3), or upon relapse following Dox treatment. #1 and #2 are leukemias isolated from two

different relapsed mice after 29 days Dox. Asterisks indicate Ikaros species in relapsed

leukemias not detected in untreated leukemias. Actin is a loading control. (B) Average Ikaros

and Hes1 mRNA expression detected by RT-qPCR in ALL65, ALL101, and ALL211,

comparing mice that were untreated (d0), treated with Dox for 3 days (d3), or upon relapse

following Dox treatment. Datapoints represent leukemias isolated from independent mice. Hes1

expression in ALL65 is not significantly different in d0 vs relapse (P = 0.15, unpaired t test with

Welch’s correction).

Figure S7. (A-C) RNA-seq track comparison of ALL65, ALL101, and ALL211 showing reads

mapped to the Notch1 coding region altered by mutation in ALL65 (A), ALL101 (B), and

ALL211 (C). Read numbers for each region are indicated on the right. (D) Sanger sequence

electropherogram of a PCR product amplified from genomic DNA isolated from ALL211,

showing a heterozygous S2446fsX1 frameshift mutation that introduces a premature stop codon

in the Notch1 PEST domain. The same region amplified from ALL101 is shown as a wild type

control. (E) Representative Sanger sequence electropherogram of a PCR product amplified from

ALL101 cDNA showing Notch1 mutations in trans with amino acid substititions highlighted in

red.

Figure S8. (A,B) Gene set analysis barcode plots of differential gene expression upon Ikaros

restoration in T-ALL from a combined analysis of ALL65, ALL101, and ALL211. The barcode

format is as described for Figure 2E. The ‘Myc-regulated’ gene set in (A) comprises direct Myc-

induced genes (red bars) or direct Myc-repressed genes (blue bars) identified previously in a

human B cell line harboring a tet-regulated Myc construct (3). The ‘Myc cluster’ gene set in (B)

comprises 84 genes with mRNA expression closely correlated to Myc recently identified in

detailed gene expression profiling of multiple stages of thymic T cell development (4). (C)

Ikaros binding at the Myc locus in DP thymocytes. Grey bars below the Bio-ChIP-seq track

indicate significant Ikaros-binding (P < 10–10). The Y axis indicates the number of mapped

sequence reads. (D) Ikaros Bio-ChIP-seq track spanning the Myc locus and the Notch-driven

Myc enhancer (N-Me) regulatory element (5, 6) ~1.3 Mb 3’ of the Myc gene (arrowed), showing

no binding of Ikaros to the N-Me in DP thymocytes.

Figure S9. Western blot analysis of IKZF1 expression in the human T-ALL cell lines CUTLL1

and HPB-ALL following treatment with the GSI Compound E (CompE, 500 nM) for 24 and 48

h as indicated. ACTB (beta-ACTIN) is a loading control.

Table S1. Gene expression changes upon acute Ikaros restoration in ALL101 - Top 100 genesRNA-Seq expression analysis of Vav-tTA;TRE-GFP-shIkaros leukemia #101 isolated from transplant recipient mice.3 days doxycycline (GFPmid) vs. untreated (GFPhigh)

Rank Symbol logFC AveLogCPM t PValue FDR1 Ikzf1 3.29 8.88 55.46 1.91E-11 2.15E-072 Cd6 1.65 7.51 22.28 2.30E-08 5.18E-053 P2rx7 2.63 6.40 21.21 3.36E-08 5.74E-054 Trac 2.07 7.53 21.05 3.57E-08 5.74E-055 Dusp2 1.49 6.59 20.10 5.09E-08 5.81E-056 Limd2 1.16 8.62 19.82 5.68E-08 5.81E-057 Cmtm6 1.92 5.85 19.34 6.86E-08 5.81E-058 Shisa5 1.62 7.05 19.18 7.30E-08 5.81E-059 Gsn 2.46 5.74 18.63 9.13E-08 5.81E-05

10 Dgka 1.68 7.19 18.60 9.25E-08 5.81E-0511 Prr13 1.22 5.63 18.27 1.06E-07 5.96E-0512 Laptm5 1.30 9.33 18.24 1.07E-07 5.96E-0513 Kcnf1 2.19 6.05 18.16 1.11E-07 5.96E-0514 Igsf23 1.59 6.23 17.71 1.35E-07 6.51E-0515 Gpr146 2.49 3.18 17.64 1.39E-07 6.51E-0516 Jakmip1 1.56 6.10 17.15 1.72E-07 7.75E-0517 Stk4 1.03 8.88 16.97 1.87E-07 8.09E-0518 Tigit 4.86 -0.33 16.24 2.62E-07 9.10E-0519 Bzrap1 2.50 4.81 16.19 2.67E-07 9.10E-0520 Wdr1 1.38 8.11 16.05 2.85E-07 9.10E-0521 Egr1 2.72 6.42 15.99 2.94E-07 9.10E-0522 Lrp10 1.14 7.50 15.99 2.94E-07 9.10E-0523 Pld3 1.40 5.67 15.80 3.21E-07 9.10E-0524 Rab37 1.87 5.13 15.72 3.35E-07 9.10E-0525 Arid5a 1.28 5.25 15.71 3.36E-07 9.10E-0526 Akna 0.90 7.43 15.68 3.40E-07 9.10E-0527 Edem1 1.10 9.86 15.63 3.50E-07 9.10E-0528 Cd27 1.13 7.97 15.52 3.68E-07 9.10E-0529 Fam105a 1.18 5.34 15.52 3.69E-07 9.10E-0530 Sp100 1.79 6.70 15.33 4.04E-07 9.10E-0531 Zfand6 1.17 5.57 15.27 4.16E-07 9.10E-0532 Cdh24 2.22 4.52 15.16 4.42E-07 9.10E-0533 Prkcq 1.12 7.60 15.13 4.48E-07 9.10E-0534 Gem 1.46 4.21 15.11 4.52E-07 9.10E-0535 Stk11ip 1.14 5.28 15.09 4.57E-07 9.10E-0536 Itgam 2.16 4.36 15.01 4.74E-07 9.10E-0537 Plcxd2 1.71 5.03 14.97 4.85E-07 9.10E-0538 Foxo1 2.05 6.47 14.89 5.06E-07 9.34E-0539 Gramd1a 1.34 5.96 14.80 5.28E-07 9.60E-0540 Trav13n-4 2.14 4.68 14.68 5.63E-07 9.81E-0541 Tor2a 1.22 5.60 14.67 5.66E-07 9.81E-0542 Pstpip1 0.99 5.63 14.59 5.90E-07 1.00E-0443 Pdlim2 1.34 5.16 14.57 5.96E-07 1.00E-0444 Nlrc3 1.11 4.81 14.43 6.40E-07 1.06E-0445 Dennd1c 1.93 4.80 14.39 6.54E-07 1.06E-0446 Gadd45a 1.87 3.53 14.32 6.80E-07 1.06E-0447 Arhgap25 1.33 5.39 14.27 6.96E-07 1.06E-0448 5830411N06Rik 2.97 4.23 14.27 6.98E-07 1.06E-0449 Aff4 1.30 7.25 14.12 7.57E-07 1.11E-0450 Rbl2 1.24 6.63 13.93 8.39E-07 1.16E-0451 Trav13-2 2.20 3.26 13.77 9.15E-07 1.23E-0452 Arid5b 1.97 3.12 13.59 1.01E-06 1.30E-0453 Abhd8 0.77 7.15 13.42 1.11E-06 1.34E-0454 Nedd9 1.51 6.03 13.36 1.15E-06 1.34E-0455 Srp14 0.80 6.04 13.34 1.16E-06 1.34E-0456 Chmp1b 1.23 6.17 13.18 1.27E-06 1.36E-0457 Zfp821 1.91 3.85 13.17 1.28E-06 1.36E-0458 Nbeal2 0.97 7.13 13.16 1.28E-06 1.36E-0459 Il12rb1 1.44 6.02 13.11 1.33E-06 1.36E-0460 Rasal3 1.16 7.91 13.10 1.33E-06 1.36E-0461 Arhgap4 0.92 7.22 13.07 1.36E-06 1.38E-0462 Rab19 3.09 2.16 13.04 1.38E-06 1.38E-0463 Flna 0.99 9.18 13.02 1.39E-06 1.38E-0464 Pycard 1.03 6.74 12.88 1.51E-06 1.45E-0465 Ifngr1 1.12 7.39 12.75 1.63E-06 1.53E-0466 Extl3 1.05 6.00 12.75 1.63E-06 1.53E-0467 Jak2 1.17 6.86 12.74 1.64E-06 1.53E-0468 Cdc42se1 0.95 7.53 12.63 1.75E-06 1.59E-0469 Ehd3 1.61 5.08 12.63 1.75E-06 1.59E-04

INCREASED EXPRESSION

70 Plgrkt 1.00 5.61 12.62 1.76E-06 1.59E-0471 Hmha1 0.85 8.88 12.61 1.77E-06 1.59E-0472 Coro1a 0.78 10.05 12.56 1.83E-06 1.60E-0473 Evi2b 1.29 4.99 12.55 1.84E-06 1.60E-0474 Cd5 1.50 7.22 12.50 1.89E-06 1.60E-0475 Cd37 1.61 5.75 12.50 1.90E-06 1.60E-0476 Zbp1 2.53 4.70 12.49 1.90E-06 1.60E-0477 Rec8 1.65 3.87 12.49 1.90E-06 1.60E-0478 Fgd3 1.26 4.89 12.48 1.91E-06 1.60E-0479 Trpv6 2.04 2.37 12.40 2.01E-06 1.64E-0480 Cdyl2 2.03 4.88 12.32 2.11E-06 1.64E-0481 Fmnl1 0.71 8.26 12.31 2.13E-06 1.64E-0482 Nr4a1 2.32 5.96 12.30 2.14E-06 1.64E-0483 Trav13n-3 2.41 1.71 12.26 2.19E-06 1.64E-0484 Trbv5 1.11 7.13 12.25 2.21E-06 1.64E-0485 Cd8a 2.02 9.78 12.24 2.21E-06 1.64E-0486 Lcp2 1.13 7.29 12.22 2.24E-06 1.64E-0487 Xylt2 1.11 4.56 12.16 2.33E-06 1.68E-0488 Cd52 2.67 4.99 12.13 2.36E-06 1.68E-0489 Traj42 2.21 4.07 12.12 2.38E-06 1.68E-0490 P2ry10 0.82 5.93 12.12 2.38E-06 1.68E-0491 Celf2 1.21 8.55 12.10 2.42E-06 1.68E-0492 Gimap1 0.76 6.07 12.07 2.46E-06 1.70E-0493 Mtmr12 0.82 7.14 12.04 2.50E-06 1.72E-0494 Plekhg2 1.57 6.47 11.98 2.60E-06 1.76E-0495 Slc36a1 1.35 4.35 11.95 2.64E-06 1.76E-0496 Ephx1 2.13 3.27 11.92 2.70E-06 1.76E-0497 A430078G23Rik 1.25 4.18 11.92 2.71E-06 1.76E-0498 Txnip 1.80 6.82 11.91 2.71E-06 1.76E-0499 Adamts10 0.99 4.97 11.91 2.72E-06 1.76E-04

100 Aes 0.90 8.64 11.89 2.75E-06 1.77E-04

Probe rank Symbol logFC AveExpr t P.Value FDR1 Il9r -1.98 6.83 -29.85 2.39E-09 1.35E-052 Tns3 -2.32 5.75 -23.23 1.67E-08 5.18E-053 Maged1 -2.63 4.50 -22.47 2.16E-08 5.18E-054 Mpzl2 -3.90 4.42 -20.20 4.90E-08 5.81E-055 Slfn9 -1.67 6.76 -19.87 5.56E-08 5.81E-056 Tbc1d4 -2.47 4.38 -19.33 6.89E-08 5.81E-057 Dock1 -2.52 5.74 -18.94 8.05E-08 5.81E-058 Elfn2 -2.68 4.75 -18.59 9.28E-08 5.81E-059 Megf8 -3.77 2.53 -17.82 1.28E-07 6.51E-05

10 Maoa -1.93 4.45 -16.82 1.99E-07 8.32E-0511 Tmed5 -1.09 7.45 -16.16 2.71E-07 9.10E-0512 C1qtnf6 -1.45 4.80 -15.95 3.00E-07 9.10E-0513 Polr1b -1.27 6.60 -15.48 3.77E-07 9.10E-0514 Tmem55a -2.16 4.62 -15.44 3.83E-07 9.10E-0515 Klf3 -1.29 5.69 -15.34 4.03E-07 9.10E-0516 Kifap3 -1.47 4.41 -15.28 4.14E-07 9.10E-0517 Pdxk -1.26 5.96 -15.21 4.29E-07 9.10E-0518 Eif4ebp1 -1.78 4.18 -15.15 4.44E-07 9.10E-0519 Wls -1.79 4.18 -15.13 4.47E-07 9.10E-0520 Matn2 -2.90 3.61 -15.13 4.48E-07 9.10E-0521 Slc45a3 -2.38 4.28 -15.02 4.73E-07 9.10E-0522 Qsox2 -1.30 4.52 -14.99 4.81E-07 9.10E-0523 BC034090 -3.00 1.41 -14.98 4.83E-07 9.10E-0524 Spats2 -1.96 6.10 -14.70 5.57E-07 9.81E-0525 Wscd1 -1.28 5.21 -14.31 6.82E-07 1.06E-0426 Igfbpl1 -3.53 4.14 -14.27 6.99E-07 1.06E-0427 Myo5b -2.49 4.56 -14.23 7.11E-07 1.07E-0428 Myzap -2.48 3.26 -14.14 7.47E-07 1.11E-0429 Qser1 -1.13 6.81 -14.01 8.01E-07 1.16E-0430 Pkn3 -1.52 4.75 -13.97 8.19E-07 1.16E-0431 2010107G12Rik -2.27 3.04 -13.95 8.30E-07 1.16E-0432 Tspan2 -2.51 4.53 -13.91 8.45E-07 1.16E-0433 Igf1r -1.97 5.48 -13.90 8.52E-07 1.16E-0434 Hes1 -1.80 4.98 -13.69 9.55E-07 1.27E-0435 Irs1 -2.89 1.61 -13.60 1.00E-06 1.30E-0436 Uaca -4.06 5.96 -13.55 1.03E-06 1.30E-0437 C1qtnf1 -2.97 1.59 -13.55 1.03E-06 1.30E-0438 Vgll1 -1.32 5.86 -13.54 1.03E-06 1.30E-0439 Rsu1 -1.35 5.32 -13.51 1.05E-06 1.31E-0440 Rps6kl1 -1.72 3.46 -13.40 1.12E-06 1.34E-0441 Cluh -0.91 7.11 -13.40 1.12E-06 1.34E-04

DECREASED EXPRESSION

42 1700036A12Rik -4.65 -1.79 -13.38 1.14E-06 1.34E-0443 Tmem176b -2.18 3.00 -13.35 1.15E-06 1.34E-0444 Rab34 -3.09 2.52 -13.26 1.22E-06 1.36E-0445 Myh10 -1.39 7.52 -13.25 1.22E-06 1.36E-0446 Emp1 -1.93 3.70 -13.23 1.24E-06 1.36E-0447 Cdv3 -0.86 8.58 -13.21 1.25E-06 1.36E-0448 Arhgap5 -1.65 4.99 -13.14 1.30E-06 1.36E-0449 Gid4 -1.01 6.36 -13.13 1.31E-06 1.36E-0450 Carkd -0.97 5.74 -13.03 1.39E-06 1.38E-0451 Kdelc1 -1.16 5.18 -12.93 1.46E-06 1.44E-0452 Nadk2 -0.94 6.05 -12.89 1.50E-06 1.45E-0453 Klhl23 -1.07 4.63 -12.74 1.64E-06 1.53E-0454 Pdgfrb -2.91 5.58 -12.69 1.69E-06 1.56E-0455 Psrc1 -1.55 4.18 -12.51 1.88E-06 1.60E-0456 Vash1 -1.74 6.07 -12.47 1.93E-06 1.60E-0457 Mtf2 -0.82 7.99 -12.46 1.94E-06 1.60E-0458 Mrps25 -0.87 5.38 -12.41 1.99E-06 1.64E-0459 Itgb1 -0.93 8.16 -12.38 2.03E-06 1.64E-0460 Hivep3 -3.14 6.73 -12.37 2.04E-06 1.64E-0461 Epb4.1l5 -1.78 3.45 -12.36 2.06E-06 1.64E-0462 Mgat4b -1.59 3.26 -12.32 2.11E-06 1.64E-0463 Acvr1 -1.98 2.22 -12.31 2.13E-06 1.64E-0464 Ahctf1 -0.67 7.57 -12.30 2.14E-06 1.64E-0465 Frmd4a -1.89 4.66 -12.24 2.21E-06 1.64E-0466 Npr1 -2.47 1.81 -12.22 2.24E-06 1.64E-0467 D830031N03Rik -1.05 5.45 -12.21 2.25E-06 1.64E-0468 Tmem132a -1.49 5.21 -12.21 2.26E-06 1.64E-0469 Utp20 -0.79 7.39 -12.11 2.40E-06 1.68E-0470 Arhgap21 -1.43 4.88 -12.11 2.40E-06 1.68E-0471 Ctnnd1 -2.08 5.85 -12.03 2.52E-06 1.72E-0472 Ccdc18 -1.64 5.37 -11.97 2.62E-06 1.76E-0473 Nat10 -0.79 6.67 -11.95 2.65E-06 1.76E-0474 Bst2 -1.63 4.87 -11.92 2.70E-06 1.76E-0475 Rab44 -3.82 2.84 -11.80 2.91E-06 1.85E-0476 Fam188b -2.72 0.74 -11.79 2.92E-06 1.85E-0477 Josd1 -0.98 6.35 -11.74 3.02E-06 1.88E-0478 Aldh1b1 -2.82 7.39 -11.61 3.29E-06 1.93E-0479 Tfap4 -1.04 5.15 -11.58 3.35E-06 1.94E-0480 Anks1 -0.82 6.54 -11.57 3.38E-06 1.94E-0481 Zfp503 -2.78 2.26 -11.53 3.47E-06 1.95E-0482 Mettl13 -1.09 5.36 -11.52 3.48E-06 1.95E-0483 Nt5dc2 -1.02 7.31 -11.48 3.57E-06 1.96E-0484 Trip10 -1.21 3.46 -11.47 3.60E-06 1.96E-0485 Dpy19l1 -0.96 6.03 -11.41 3.73E-06 2.01E-0486 Jazf1 -2.12 3.90 -11.39 3.79E-06 2.01E-0487 Akap1 -0.75 6.24 -11.38 3.81E-06 2.01E-0488 Rnpep -0.71 6.07 -11.36 3.85E-06 2.02E-0489 Gphn -0.87 5.71 -11.27 4.10E-06 2.09E-0490 Wdr12 -0.79 5.77 -11.26 4.12E-06 2.09E-0491 Podnl1 -3.49 1.41 -11.21 4.27E-06 2.12E-0492 Tnfrsf8 -1.42 5.92 -11.20 4.30E-06 2.12E-0493 Vcl -0.96 5.91 -11.17 4.36E-06 2.14E-0494 Ccdc120 -3.25 -0.05 -11.17 4.39E-06 2.14E-0495 Bmp1 -4.64 0.66 -11.14 4.46E-06 2.15E-0496 Bsn -1.33 4.80 -11.14 4.47E-06 2.15E-0497 Vwa7 -2.22 2.95 -11.11 4.56E-06 2.17E-0498 Cpne3 -0.90 5.44 -11.11 4.56E-06 2.17E-0499 Tnfsf11 -4.09 0.99 -11.07 4.69E-06 2.18E-04

100 Smo -0.78 7.79 -10.99 4.95E-06 2.27E-04

Table S2. Ikaros activated genesActivated upon 3d Dox treatment in ALL65, ALL101and ALL211 - sorted by FDR

Rank GeneID Symbol Name ChIP logFC AveExpr t P.Value FDR1 83408 Gimap3 GTPase, IMAP family member 3 TRUE 3.08 4.58 19.99 1.83E-06 1.77E-022 107022 Gramd3 GRAM domain containing 3 TRUE 2.31 5.38 17.55 3.78E-06 1.77E-023 13601 Ecm1 extracellular matrix protein 1 FALSE 2.44 4.56 15.13 8.61E-06 1.77E-024 231931 Gimap6 GTPase, IMAP family member 6 TRUE 1.93 7.33 14.88 9.42E-06 1.77E-025 244234 5830411N06Rik RIKEN cDNA 5830411N06 gene FALSE 2.72 4.66 14.34 1.16E-05 1.77E-026 16421 Itgb7 integrin beta 7 FALSE 2.03 6.75 14.29 1.18E-05 1.77E-027 22778 Ikzf1 IKAROS family zinc finger 1 TRUE 3.07 8.92 14.41 1.22E-05 1.77E-028 236451 Phf11b PHD finger protein 11B FALSE 2.95 3.44 13.51 1.61E-05 1.83E-029 57440 Ehd3 EH-domain containing 3 TRUE 1.60 5.63 12.96 2.02E-05 1.83E-0210 12516 Cd7 CD7 antigen FALSE 2.48 4.22 12.67 2.29E-05 1.83E-0211 107526 Gimap4 GTPase, IMAP family member 4 FALSE 1.78 7.27 12.23 2.78E-05 1.83E-0212 18710 Pik3r3 phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 3 (p55) TRUE 1.99 5.27 11.92 3.19E-05 1.83E-0213 100043541 B630019A10Rik RIKEN cDNA B630019A10 gene FALSE 2.36 3.50 11.56 3.77E-05 1.83E-0214 58222 Rab37 RAB37, member of RAS oncogene family TRUE 1.74 5.04 11.53 3.84E-05 1.83E-0215 22329 Vcam1 vascular cell adhesion molecule 1 FALSE 2.54 1.99 11.48 3.92E-05 1.83E-0216 66940 Shisa5 shisa homolog 5 (Xenopus laevis) FALSE 1.52 8.09 11.32 4.24E-05 1.83E-0217 231932 Gimap7 GTPase, IMAP family member 7 FALSE 2.08 3.96 11.19 4.53E-05 1.83E-0218 13609 S1pr1 sphingosine-1-phosphate receptor 1 FALSE 2.71 4.42 11.28 4.64E-05 1.83E-0219 12493 Cd37 CD37 antigen FALSE 1.51 5.81 11.05 4.85E-05 1.83E-0220 16598 Klf2 Kruppel-like factor 2 (lung) TRUE 1.73 5.84 11.00 4.95E-05 1.83E-0221 13849 Ephx1 epoxide hydrolase 1, microsomal FALSE 1.95 3.79 10.91 5.18E-05 1.83E-0222 16416 Itgb3 integrin beta 3 FALSE 1.65 5.95 10.91 5.18E-05 1.83E-0223 74121 Acoxl acyl-Coenzyme A oxidase-like TRUE 2.08 3.95 10.88 5.25E-05 1.83E-0224 327978 Slfn5 schlafen 5 TRUE 2.58 5.76 10.85 5.71E-05 1.84E-0225 76933 Ifi27l2a interferon, alpha-inducible protein 27 like 2A FALSE 2.68 4.17 10.67 6.25E-05 1.90E-0226 22388 Wdr1 WD repeat domain 1 FALSE 1.26 8.19 10.24 7.30E-05 1.92E-0227 72828 Ubash3b ubiquitin associated and SH3 domain containing, B TRUE 1.84 3.33 10.21 7.43E-05 1.92E-0228 67213 Cmtm6 CKLF-like MARVEL transmembrane domain containing 6 FALSE 1.75 6.30 10.24 7.46E-05 1.92E-0229 243374 Gimap8 GTPase, IMAP family member 8 TRUE 2.29 6.01 10.31 7.52E-05 1.92E-0230 12508 Cd53 CD53 antigen FALSE 1.90 7.39 10.11 8.34E-05 1.97E-0231 68728 Trp53inp2 transformation related protein 53 inducible nuclear protein 2 FALSE 2.44 2.65 9.99 8.35E-05 1.97E-0232 229665 Ampd1 adenosine monophosphate deaminase 1 FALSE 3.15 3.43 10.07 8.53E-05 1.97E-0233 225600 Pde6a phosphodiesterase 6A, cGMP-specific, rod, alpha TRUE 2.79 1.52 9.81 9.19E-05 1.97E-0234 14256 Flt3l FMS-like tyrosine kinase 3 ligand TRUE 2.12 3.26 9.76 9.45E-05 1.97E-0235 13139 Dgka diacylglycerol kinase, alpha TRUE 1.44 8.00 9.75 9.52E-05 1.97E-0236 12505 Cd44 CD44 antigen TRUE 2.91 1.20 9.72 1.03E-04 2.07E-0237 15483 Hsd11b1 hydroxysteroid 11-beta dehydrogenase 1 TRUE 2.81 2.69 9.57 1.05E-04 2.07E-0238 14102 Fas Fas (TNF receptor superfamily member 6) TRUE 2.21 3.97 9.65 1.05E-04 2.07E-0239 22352 Vim vimentin TRUE 1.24 6.43 9.48 1.11E-04 2.09E-0240 192176 Flna filamin, alpha FALSE 1.05 9.61 9.42 1.15E-04 2.09E-0241 23969 Pacsin1 protein kinase C and casein kinase substrate in neurons 1 FALSE 3.59 0.22 9.38 1.17E-04 2.09E-0242 14133 Fcna ficolin A FALSE 2.63 0.61 9.36 1.19E-04 2.09E-0243 218294 Cdc14b CDC14 cell division cycle 14B FALSE 1.52 3.78 9.31 1.22E-04 2.09E-0244 14132 Fcgrt Fc receptor, IgG, alpha chain transporter FALSE 2.35 2.53 9.31 1.22E-04 2.09E-0245 100503797 Gm11738 predicted gene 11738 FALSE 1.90 2.20 9.28 1.24E-04 2.09E-0246 668139 Gm8995 predicted gene 8995 FALSE 1.90 5.44 9.33 1.28E-04 2.11E-0247 20533 Slc4a1 solute carrier family 4 (anion exchanger), member 1 FALSE 2.32 0.97 9.21 1.29E-04 2.11E-0248 67198 Spats2l spermatogenesis associated, serine-rich 2-like TRUE 2.22 1.76 9.15 1.33E-04 2.11E-0249 56458 Foxo1 forkhead box O1 TRUE 1.71 7.17 9.22 1.36E-04 2.11E-0250 215113 Slc43a2 solute carrier family 43, member 2 TRUE 1.51 6.09 9.12 1.37E-04 2.11E-0251 20351 Sema4a sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A FALSE 1.34 5.06 9.08 1.40E-04 2.11E-0252 16414 Itgb2 integrin beta 2 TRUE 1.02 7.76 9.05 1.42E-04 2.11E-0253 58203 Zbp1 Z-DNA binding protein 1 FALSE 2.63 5.56 9.11 1.45E-04 2.11E-0254 93736 Aff4 AF4/FMR2 family, member 4 TRUE 1.21 7.21 8.98 1.48E-04 2.11E-0255 18439 P2rx7 purinergic receptor P2X, ligand-gated ion channel, 7 TRUE 2.10 6.22 9.06 1.49E-04 2.11E-0256 330256 Gm20559 predicted gene, 20559 FALSE 1.90 4.14 8.90 1.55E-04 2.11E-0257 14007 Celf2 CUGBP, Elav-like family member 2 TRUE 1.07 8.44 8.83 1.62E-04 2.11E-0258 12877 Cpeb1 cytoplasmic polyadenylation element binding protein 1 FALSE 1.77 3.78 8.82 1.63E-04 2.11E-0259 18197 Nsg2 neuron specific gene family member 2 TRUE 1.15 6.70 8.80 1.65E-04 2.11E-0260 170772 Glcci1 glucocorticoid induced transcript 1 TRUE 1.42 7.02 8.79 1.66E-04 2.11E-0261 21897 Tlr1 toll-like receptor 1 FALSE 1.79 3.24 8.77 1.68E-04 2.11E-0262 30794 Pdlim4 PDZ and LIM domain 4 FALSE 1.07 6.03 8.74 1.71E-04 2.11E-0263 236312 Pyhin1 pyrin and HIN domain family, member 1 FALSE 2.02 6.36 8.81 1.73E-04 2.11E-0264 319493 A430078G23Rik RIKEN cDNA A430078G23 gene TRUE 1.28 4.64 8.61 1.85E-04 2.20E-0265 71371 Arid5b AT rich interactive domain 5B (MRF1-like) TRUE 1.76 3.61 8.60 1.87E-04 2.20E-0266 227929 Cytip cytohesin 1 interacting protein TRUE 1.48 7.78 8.66 1.89E-04 2.20E-0267 14579 Gem GTP binding protein (gene overexpressed in skeletal muscle) FALSE 1.38 3.37 8.49 1.99E-04 2.20E-0268 80859 Nfkbiz nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta TRUE 1.56 3.60 8.49 1.99E-04 2.20E-0269 12775 Ccr7 chemokine (C-C motif) receptor 7 TRUE 1.52 5.55 8.47 2.02E-04 2.20E-0270 16409 Itgam integrin alpha M TRUE 1.82 4.86 8.56 2.02E-04 2.20E-0271 56437 Rrad Ras-related associated with diabetes FALSE 1.39 3.64 8.47 2.02E-04 2.20E-0272 329154 Ankrd44 ankyrin repeat domain 44 TRUE 0.99 7.55 8.45 2.04E-04 2.20E-0273 269346 Slc28a2 solute carrier family 28 (sodium-coupled nucleoside transporter), member 2 FALSE 1.21 4.76 8.45 2.05E-04 2.20E-0274 338523 Kdm7a lysine (K)-specific demethylase 7A FALSE 1.47 4.96 8.43 2.07E-04 2.20E-0275 70086 Cysltr2 cysteinyl leukotriene receptor 2 TRUE 2.68 0.46 8.36 2.17E-04 2.20E-0276 15139 Hc hemolytic complement FALSE 1.66 3.76 8.35 2.18E-04 2.20E-0277 30933 Tor2a torsin family 2, member A FALSE 1.12 5.49 8.34 2.19E-04 2.20E-0278 227753 Gsn gelsolin FALSE 2.06 6.46 8.40 2.23E-04 2.20E-0279 238871 Pde4d phosphodiesterase 4D, cAMP specific TRUE 1.16 5.42 8.29 2.26E-04 2.20E-0280 239647 Pced1b PC-esterase domain containing 1B TRUE 1.44 4.67 8.28 2.28E-04 2.20E-0281 18003 Nedd9 neural precursor cell expressed, developmentally down-regulated gene 9 TRUE 1.31 6.14 8.27 2.30E-04 2.20E-0282 18761 Prkcq protein kinase C, theta TRUE 1.34 8.20 8.29 2.30E-04 2.20E-0283 57912 Cdc42se1 CDC42 small effector 1 TRUE 1.06 8.00 8.26 2.31E-04 2.20E-0284 64933 Ap3m2 adaptor-related protein complex 3, mu 2 subunit TRUE 2.68 2.21 8.24 2.34E-04 2.20E-0285 73690 Glipr1 GLI pathogenesis-related 1 (glioma) FALSE 2.04 1.85 8.30 2.34E-04 2.20E-0286 320007 Sidt1 SID1 transmembrane family, member 1 FALSE 2.39 4.68 8.29 2.38E-04 2.20E-0287 69926 Dnah17 dynein, axonemal, heavy chain 17 FALSE 1.58 3.59 8.20 2.39E-04 2.20E-0288 66270 Fam134b family with sequence similarity 134, member B FALSE 1.68 4.81 8.26 2.41E-04 2.20E-0289 67803 Limd2 LIM domain containing 2 TRUE 1.07 9.05 8.18 2.43E-04 2.20E-0290 60504 Il21r interleukin 21 receptor TRUE 1.06 6.48 8.14 2.49E-04 2.23E-0291 20684 Sp100 nuclear antigen Sp100 FALSE 1.77 7.44 8.17 2.57E-04 2.25E-0292 214639 4930486L24Rik RIKEN cDNA 4930486L24 gene TRUE 1.73 1.57 8.09 2.58E-04 2.25E-0293 320982 Arl4c ADP-ribosylation factor-like 4C TRUE 1.39 5.90 8.05 2.68E-04 2.30E-0294 210757 Themis thymocyte selection associated TRUE 0.93 8.30 8.03 2.68E-04 2.30E-0295 19240 Tmsb10 thymosin, beta 10 TRUE 1.20 7.26 7.98 2.77E-04 2.32E-0296 100503605 Hbb-bs hemoglobin, beta adult s chain FALSE 1.99 2.26 7.97 2.78E-04 2.32E-0297 628705 Phf11c PHD finger protein 11C FALSE 2.54 4.04 8.02 2.83E-04 2.33E-0298 12051 Bcl3 B cell leukemia/lymphoma 3 FALSE 2.15 2.56 7.93 2.85E-04 2.33E-0299 69769 Tnfaip8l2 tumor necrosis factor, alpha-induced protein 8-like 2 TRUE 1.35 4.53 7.87 2.97E-04 2.36E-02100 22423 Wnt8b wingless related MMTV integration site 8b FALSE 1.75 2.00 7.87 2.98E-04 2.36E-02101 209086 Samd9l sterile alpha motif domain containing 9-like FALSE 1.77 5.85 7.94 2.99E-04 2.36E-02102 56878 Rbms1 RNA binding motif, single stranded interacting protein 1 FALSE 1.24 5.57 7.84 3.04E-04 2.36E-02103 27360 Add3 adducin 3 (gamma) FALSE 2.31 5.81 7.91 3.06E-04 2.36E-02104 22695 Zfp36 zinc finger protein 36 TRUE 2.04 5.87 7.88 3.10E-04 2.36E-02105 22779 Ikzf2 IKAROS family zinc finger 2 TRUE 0.90 7.74 7.81 3.10E-04 2.36E-02106 16792 Laptm5 lysosomal-associated protein transmembrane 5 TRUE 1.10 9.71 7.81 3.10E-04 2.36E-02107 100126460 Trav13n-4 T cell receptor alpha variable 13N-4 FALSE 2.01 1.41 7.79 3.16E-04 2.36E-02108 74747 Ddit4 DNA-damage-inducible transcript 4 FALSE 1.47 7.61 7.83 3.21E-04 2.36E-02109 80901 Cxcr6 chemokine (C-X-C motif) receptor 6 FALSE 2.13 1.69 7.75 3.23E-04 2.36E-02110 23833 Cd52 CD52 antigen TRUE 1.96 6.33 7.82 3.24E-04 2.36E-02

111 12511 Cd6 CD6 antigen TRUE 1.40 7.18 7.81 3.25E-04 2.36E-02112 105841 Dennd3 DENN/MADD domain containing 3 FALSE 1.13 4.97 7.70 3.32E-04 2.36E-02113 18807 Pld3 phospholipase D family, member 3 TRUE 1.52 5.68 7.76 3.37E-04 2.36E-02114 317757 Gimap5 GTPase, IMAP family member 5 TRUE 1.17 4.98 7.68 3.37E-04 2.36E-02115 56489 Ikbke inhibitor of kappaB kinase epsilon TRUE 1.18 6.61 7.68 3.38E-04 2.36E-02116 12227 Btg2 B cell translocation gene 2, anti-proliferative TRUE 0.98 7.60 7.67 3.39E-04 2.36E-02117 545384 BC094916 cDNA sequence BC094916 FALSE 2.28 3.13 7.75 3.39E-04 2.36E-02118 20444 St3gal2 ST3 beta-galactoside alpha-2,3-sialyltransferase 2 TRUE 1.60 5.37 7.75 3.40E-04 2.36E-02119 67168 Lpar6 lysophosphatidic acid receptor 6 TRUE 1.26 5.46 7.64 3.47E-04 2.37E-02120 57757 Pglyrp2 peptidoglycan recognition protein 2 TRUE 1.02 5.94 7.52 3.76E-04 2.50E-02121 66151 Prr13 proline rich 13 TRUE 1.44 5.53 7.56 3.82E-04 2.50E-02122 235493 Fam214a family with sequence similarity 214, member A FALSE 1.87 4.41 7.50 4.01E-04 2.59E-02123 16194 Il6ra interleukin 6 receptor, alpha TRUE 2.29 4.70 7.46 4.12E-04 2.62E-02124 216984 Evi2b ecotropic viral integration site 2b FALSE 1.30 5.32 7.35 4.25E-04 2.66E-02125 21809 Tgfb3 transforming growth factor, beta 3 FALSE 2.79 2.83 7.41 4.28E-04 2.66E-02126 56460 Pkp3 plakophilin 3 FALSE 1.08 4.02 7.33 4.32E-04 2.66E-02127 23912 Rhof ras homolog gene family, member f TRUE 1.87 4.44 7.39 4.32E-04 2.66E-02128 16190 Il4ra interleukin 4 receptor, alpha TRUE 1.99 4.35 7.39 4.33E-04 2.66E-02129 11489 Adam12 a disintegrin and metallopeptidase domain 12 (meltrin alpha) FALSE 2.44 1.01 7.38 4.35E-04 2.66E-02130 14744 Gpr65 G-protein coupled receptor 65 FALSE 1.01 5.12 7.29 4.43E-04 2.66E-02131 15002 H2-Ob histocompatibility 2, O region beta locus FALSE 2.39 1.62 7.29 4.43E-04 2.66E-02132 12262 C1qc complement component 1, q subcomponent, C chain FALSE 2.06 -0.12 7.28 4.45E-04 2.66E-02133 72042 Cotl1 coactosin-like 1 (Dictyostelium) TRUE 1.07 8.26 7.28 4.45E-04 2.66E-02134 20440 St6gal1 beta galactoside alpha 2,6 sialyltransferase 1 TRUE 1.08 7.12 7.27 4.50E-04 2.67E-02135 225825 Cd226 CD226 antigen TRUE 1.81 4.51 7.33 4.51E-04 2.67E-02136 71706 Slc46a3 solute carrier family 46, member 3 FALSE 2.04 1.03 7.25 4.55E-04 2.68E-02137 53314 Batf basic leucine zipper transcription factor, ATF-like TRUE 1.30 3.86 7.21 4.69E-04 2.70E-02138 242584 Wdr78 WD repeat domain 78 TRUE 1.48 2.71 7.20 4.73E-04 2.70E-02139 19419 Rasgrp1 RAS guanyl releasing protein 1 FALSE 0.88 9.02 7.18 4.78E-04 2.70E-02140 72404 Wdr44 WD repeat domain 44 TRUE 1.09 4.83 7.18 4.79E-04 2.70E-02141 27218 Slamf1 signaling lymphocytic activation molecule family member 1 TRUE 1.06 4.35 7.18 4.81E-04 2.70E-02142 11801 Cd5l CD5 antigen-like FALSE 2.13 0.21 7.17 4.83E-04 2.70E-02143 665113 Tnik TRAF2 and NCK interacting kinase TRUE 0.94 5.96 7.17 4.84E-04 2.70E-02144 76469 Cmya5 cardiomyopathy associated 5 TRUE 1.63 1.76 7.15 4.90E-04 2.72E-02145 22142 Tuba1a tubulin, alpha 1A TRUE 1.12 3.61 7.12 4.99E-04 2.75E-02146 20364 Sepw1 selenoprotein W, muscle 1 FALSE 0.97 5.14 7.10 5.06E-04 2.76E-02147 16161 Il12rb1 interleukin 12 receptor, beta 1 TRUE 1.18 5.61 7.10 5.07E-04 2.76E-02148 13197 Gadd45a growth arrest and DNA-damage-inducible 45 alpha TRUE 1.61 3.89 7.11 5.09E-04 2.76E-02149 16205 Gimap1 GTPase, IMAP family member 1 TRUE 0.94 6.30 7.07 5.18E-04 2.76E-02150 12452 Ccng2 cyclin G2 TRUE 1.13 7.19 7.06 5.25E-04 2.76E-02151 67064 Chmp1b charged multivesicular body protein 1B FALSE 1.09 6.23 7.03 5.33E-04 2.76E-02152 11931 Atp1b1 ATPase, Na+/K+ transporting, beta 1 polypeptide TRUE 1.19 3.98 7.02 5.37E-04 2.76E-02153 76681 Trim12a tripartite motif-containing 12A FALSE 1.55 4.24 7.07 5.37E-04 2.76E-02154 76024 Gm11346 predicted gene 11346 TRUE 2.28 2.11 7.01 5.42E-04 2.76E-02155 223827 Gxylt1 glucoside xylosyltransferase 1 FALSE 0.86 5.90 7.01 5.42E-04 2.76E-02156 29812 Ndrg3 N-myc downstream regulated gene 3 TRUE 1.45 6.61 7.07 5.42E-04 2.76E-02157 51791 Rgs14 regulator of G-protein signaling 14 FALSE 1.15 5.24 6.99 5.49E-04 2.76E-02158 15368 Hmox1 heme oxygenase (decycling) 1 TRUE 1.30 3.28 6.99 5.52E-04 2.76E-02159 12581 Cdkn2d cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) FALSE 1.43 6.09 7.04 5.54E-04 2.76E-02160 13732 Emp3 epithelial membrane protein 3 TRUE 0.83 6.18 6.98 5.54E-04 2.76E-02161 223433 Fam105a family with sequence similarity 105, member A TRUE 1.48 6.35 7.03 5.59E-04 2.76E-02162 20555 Slfn1 schlafen 1 FALSE 2.92 4.60 7.02 5.63E-04 2.76E-02163 18708 Pik3r1 phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha) TRUE 1.06 7.58 6.95 5.66E-04 2.76E-02164 66090 Ypel3 yippee-like 3 (Drosophila) FALSE 1.56 4.34 7.00 5.70E-04 2.76E-02165 16994 Ltb lymphotoxin B FALSE 1.62 6.00 7.00 5.71E-04 2.76E-02166 17122 Mxd4 Max dimerization protein 4 FALSE 1.69 5.88 6.98 5.78E-04 2.76E-02167 107607 Nod1 nucleotide-binding oligomerization domain containing 1 TRUE 1.64 4.14 6.98 5.81E-04 2.76E-02168 217356 Tmc8 transmembrane channel-like gene family 8 TRUE 1.12 5.71 6.91 5.84E-04 2.76E-02169 269180 Inpp4a inositol polyphosphate-4-phosphatase, type I FALSE 1.77 1.45 6.91 5.85E-04 2.76E-02170 232201 Arhgap25 Rho GTPase activating protein 25 TRUE 1.30 5.77 6.96 5.89E-04 2.76E-02171 328833 Treml2 triggering receptor expressed on myeloid cells-like 2 TRUE 0.90 5.93 6.89 5.92E-04 2.76E-02172 223453 Dap death-associated protein TRUE 1.31 6.73 6.95 5.92E-04 2.76E-02173 13549 Dyrk1b dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b FALSE 1.50 4.39 6.93 5.94E-04 2.76E-02174 80289 Lysmd3 LysM, putative peptidoglycan-binding, domain containing 3 FALSE 1.09 4.99 6.89 5.94E-04 2.76E-02175 23943 Esyt1 extended synaptotagmin-like protein 1 TRUE 0.81 8.72 6.89 5.95E-04 2.76E-02176 19261 Sirpa signal-regulatory protein alpha FALSE 2.25 0.86 6.87 6.04E-04 2.79E-02177 72144 Slc37a3 solute carrier family 37 (glycerol-3-phosphate transporter), member 3 TRUE 0.96 4.60 6.86 6.09E-04 2.79E-02178 213438 A630033H20Rik RIKEN cDNA A630033H20 gene FALSE 1.13 3.84 6.85 6.12E-04 2.79E-02179 12802 Cnr2 cannabinoid receptor 2 (macrophage) TRUE 1.37 4.78 6.86 6.17E-04 2.81E-02180 235627 Nbeal2 neurobeachin-like 2 TRUE 1.07 7.00 6.82 6.24E-04 2.81E-02181 667373 Gm14446 predicted gene 14446 FALSE 2.62 3.57 6.88 6.25E-04 2.81E-02182 16480 Jup junction plakoglobin FALSE 1.76 5.61 6.87 6.28E-04 2.81E-02183 19260 Ptpn22 protein tyrosine phosphatase, non-receptor type 22 (lymphoid) TRUE 1.13 6.80 6.80 6.36E-04 2.81E-02184 98952 Fam102a family with sequence similarity 102, member A TRUE 2.38 5.59 6.85 6.40E-04 2.81E-02185 20813 Srp14 signal recognition particle 14 TRUE 0.78 6.32 6.78 6.45E-04 2.81E-02186 12945 Dmbt1 deleted in malignant brain tumors 1 FALSE 1.32 2.05 6.77 6.50E-04 2.81E-02187 19200 Pstpip1 proline-serine-threonine phosphatase-interacting protein 1 TRUE 1.05 5.89 6.76 6.55E-04 2.81E-02188 109226 A930002I21Rik RIKEN cDNA A930002I21 gene FALSE 1.12 3.52 6.75 6.59E-04 2.81E-02189 213019 Pdlim2 PDZ and LIM domain 2 FALSE 1.13 5.43 6.75 6.60E-04 2.81E-02190 52857 Gramd1a GRAM domain containing 1A TRUE 1.27 6.20 6.80 6.65E-04 2.81E-02191 75747 Sesn3 sestrin 3 FALSE 1.00 5.21 6.74 6.66E-04 2.81E-02192 98267 Stk17b serine/threonine kinase 17b (apoptosis-inducing) TRUE 1.34 7.87 6.79 6.66E-04 2.81E-02193 16822 Lcp2 lymphocyte cytosolic protein 2 TRUE 1.05 7.78 6.73 6.69E-04 2.81E-02194 60599 Trp53inp1 transformation related protein 53 inducible nuclear protein 1 TRUE 1.43 9.02 6.78 6.73E-04 2.81E-02195 320435 Rinl Ras and Rab interactor-like FALSE 1.00 6.54 6.71 6.77E-04 2.81E-02196 60361 Ms4a4b membrane-spanning 4-domains, subfamily A, member 4B FALSE 2.27 5.53 6.76 6.82E-04 2.81E-02197 16889 Lipa lysosomal acid lipase A TRUE 1.67 7.06 6.76 6.84E-04 2.81E-02198 100502842 Gm14718 predicted gene 14718 FALSE 3.67 0.63 6.75 6.87E-04 2.81E-02199 71520 Grap GRB2-related adaptor protein TRUE 1.02 6.63 6.69 6.89E-04 2.81E-02200 78473 Skap1 src family associated phosphoprotein 1 FALSE 0.86 7.64 6.68 6.97E-04 2.83E-02201 17155 Man1a mannosidase 1, alpha TRUE 1.01 6.19 6.67 7.01E-04 2.83E-02202 18646 Prf1 perforin 1 (pore forming protein) FALSE 4.20 -0.35 6.71 7.08E-04 2.83E-02203 12721 Coro1a coronin, actin binding protein 1A TRUE 0.88 10.40 6.65 7.11E-04 2.83E-02204 13521 Slc26a2 solute carrier family 26 (sulfate transporter), member 2 FALSE 1.07 5.59 6.64 7.14E-04 2.83E-02205 75665 Ccdc64 coiled-coil domain containing 64 TRUE 1.91 3.10 6.69 7.17E-04 2.83E-02206 70082 Lysmd2 LysM, putative peptidoglycan-binding, domain containing 2 FALSE 2.62 -0.29 6.64 7.18E-04 2.83E-02207 67759 Plgrkt plasminogen receptor, C-terminal lysine transmembrane protein FALSE 0.96 5.80 6.63 7.20E-04 2.83E-02208 241062 Pgap1 post-GPI attachment to proteins 1 TRUE 1.59 3.97 6.69 7.22E-04 2.83E-02209 20970 Sdc3 syndecan 3 FALSE 2.18 2.72 6.68 7.26E-04 2.83E-02210 15370 Nr4a1 nuclear receptor subfamily 4, group A, member 1 TRUE 1.70 6.01 6.67 7.29E-04 2.83E-02211 102098 Arhgef18 rho/rac guanine nucleotide exchange factor (GEF) 18 FALSE 1.00 6.77 6.61 7.30E-04 2.83E-02212 668253 Dleu2 deleted in lymphocytic leukemia, 2 TRUE 1.11 3.69 6.61 7.35E-04 2.84E-02213 215449 Rap1b RAS related protein 1b TRUE 0.75 6.94 6.60 7.40E-04 2.84E-02214 211389 Suox sulfite oxidase FALSE 0.97 4.78 6.59 7.46E-04 2.85E-02215 12335 Capn3 calpain 3 TRUE 0.93 4.55 6.59 7.46E-04 2.85E-02216 16170 Il16 interleukin 16 TRUE 0.90 7.73 6.58 7.49E-04 2.85E-02217 66109 Tspan13 tetraspanin 13 TRUE 0.82 6.45 6.55 7.65E-04 2.88E-02218 12393 Runx2 runt related transcription factor 2 TRUE 3.19 0.48 6.54 7.72E-04 2.89E-02219 383295 Ypel5 yippee-like 5 (Drosophila) TRUE 1.45 5.06 6.59 7.79E-04 2.89E-02220 99696 Ankrd50 ankyrin repeat domain 50 TRUE 1.04 4.03 6.53 7.82E-04 2.89E-02221 67579 Cpeb4 cytoplasmic polyadenylation element binding protein 4 TRUE 1.60 2.99 6.52 7.83E-04 2.89E-02222 77799 Sla2 Src-like-adaptor 2 TRUE 0.83 6.24 6.51 7.89E-04 2.89E-02223 20238 Atxn1 ataxin 1 TRUE 1.58 2.52 6.51 7.92E-04 2.89E-02224 230979 Tnfrsf14 tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) TRUE 1.40 2.93 6.51 7.93E-04 2.89E-02

225 110257 Hba-a2 hemoglobin alpha, adult chain 2 FALSE 1.96 2.52 6.56 7.96E-04 2.89E-02226 73656 Ms4a6c membrane-spanning 4-domains, subfamily A, member 6C FALSE 1.19 3.65 6.50 7.99E-04 2.89E-02227 230073 Ddx58 DEAD (Asp-Glu-Ala-Asp) box polypeptide 58 FALSE 1.78 5.93 6.54 8.09E-04 2.90E-02228 66824 Pycard PYD and CARD domain containing TRUE 0.86 6.83 6.46 8.21E-04 2.91E-02229 56323 Dnajb5 DnaJ (Hsp40) homolog, subfamily B, member 5 FALSE 1.93 1.54 6.46 8.22E-04 2.91E-02230 11630 Aim1 absent in melanoma 1 FALSE 2.31 5.43 6.51 8.22E-04 2.91E-02231 12492 Scarb2 scavenger receptor class B, member 2 TRUE 0.76 6.76 6.45 8.27E-04 2.91E-02232 78286 Nav2 neuron navigator 2 TRUE 1.40 5.63 6.49 8.39E-04 2.94E-02233 16452 Jak2 Janus kinase 2 TRUE 1.31 7.02 6.45 8.63E-04 3.01E-02234 70574 Cpm carboxypeptidase M TRUE 1.33 4.45 6.43 8.66E-04 3.01E-02235 17533 Mrc1 mannose receptor, C type 1 FALSE 2.49 0.42 6.43 8.79E-04 3.03E-02236 217151 Arl5c ADP-ribosylation factor-like 5C TRUE 1.73 5.18 6.43 8.82E-04 3.03E-02237 74552 Nipal3 NIPA-like domain containing 3 FALSE 1.19 5.55 6.42 8.83E-04 3.03E-02238 13449 Dok2 docking protein 2 FALSE 0.78 6.61 6.34 9.02E-04 3.07E-02239 619313 I730030J21Rik RIKEN cDNA I730030J21 gene FALSE 1.06 3.60 6.32 9.18E-04 3.07E-02240 107321 Lpxn leupaxin TRUE 1.27 5.02 6.37 9.19E-04 3.07E-02241 69206 2010016I18Rik RIKEN cDNA 2010016I18 gene FALSE 2.91 2.10 6.37 9.19E-04 3.07E-02242 29811 Ndrg2 N-myc downstream regulated gene 2 FALSE 1.17 2.83 6.32 9.20E-04 3.07E-02243 57738 Slc15a2 solute carrier family 15 (H+/peptide transporter), member 2 FALSE 1.51 5.27 6.36 9.26E-04 3.08E-02244 207777 Bzrap1 benzodiazepine receptor associated protein 1 TRUE 2.12 3.92 6.34 9.43E-04 3.08E-02245 320365 Fry furry homolog (Drosophila) FALSE 1.06 4.97 6.29 9.44E-04 3.08E-02246 108012 Ap1s2 adaptor-related protein complex 1, sigma 2 subunit FALSE 1.12 3.41 6.29 9.44E-04 3.08E-02247 171166 Mcoln3 mucolipin 3 TRUE 1.42 4.01 6.30 9.46E-04 3.08E-02248 320404 Itpkb inositol 1,4,5-trisphosphate 3-kinase B TRUE 0.98 7.18 6.27 9.54E-04 3.08E-02249 18574 Pde1b phosphodiesterase 1B, Ca2+-calmodulin dependent FALSE 2.12 2.61 6.32 9.55E-04 3.08E-02250 13417 Dnah8 dynein, axonemal, heavy chain 8 FALSE 0.95 7.43 6.22 1.00E-03 3.20E-02251 105827 Amigo2 adhesion molecule with Ig like domain 2 FALSE 2.64 1.00 6.22 1.00E-03 3.20E-02252 278507 Wfikkn2 WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 FALSE 1.58 1.13 6.20 1.01E-03 3.22E-02253 98388 Chst10 carbohydrate sulfotransferase 10 TRUE 1.28 5.48 6.25 1.02E-03 3.22E-02254 64296 Abhd8 abhydrolase domain containing 8 TRUE 0.72 6.92 6.19 1.02E-03 3.22E-02255 11433 Acp5 acid phosphatase 5, tartrate resistant TRUE 1.00 6.88 6.17 1.04E-03 3.23E-02256 12769 Ccr9 chemokine (C-C motif) receptor 9 TRUE 2.00 8.82 6.21 1.05E-03 3.23E-02257 12978 Csf1r colony stimulating factor 1 receptor FALSE 1.86 1.36 6.19 1.05E-03 3.23E-02258 67488 Calcoco1 calcium binding and coiled coil domain 1 FALSE 1.68 5.25 6.20 1.05E-03 3.23E-02259 229003 Helz2 helicase with zinc finger 2, transcriptional coactivator FALSE 1.48 7.08 6.20 1.05E-03 3.23E-02260 65098 Zfand6 zinc finger, AN1-type domain 6 FALSE 1.35 6.32 6.19 1.06E-03 3.23E-02261 60525 Acss2 acyl-CoA synthetase short-chain family member 2 TRUE 0.96 4.60 6.14 1.06E-03 3.23E-02262 15122 Hba-a1 hemoglobin alpha, adult chain 1 FALSE 2.23 1.60 6.18 1.07E-03 3.23E-02263 269717 Orai2 ORAI calcium release-activated calcium modulator 2 TRUE 1.33 5.89 6.18 1.07E-03 3.23E-02264 30938 Fgd3 FYVE, RhoGEF and PH domain containing 3 FALSE 1.23 4.99 6.17 1.08E-03 3.23E-02265 12526 Cd8b1 CD8 antigen, beta chain 1 TRUE 1.54 8.21 6.17 1.08E-03 3.25E-02266 65107 Lrp10 low-density lipoprotein receptor-related protein 10 FALSE 0.87 7.48 6.11 1.09E-03 3.25E-02267 12349 Car2 carbonic anhydrase 2 TRUE 1.34 0.91 6.11 1.09E-03 3.25E-02268 12226 Btg1 B cell translocation gene 1, anti-proliferative TRUE 1.46 8.05 6.15 1.09E-03 3.25E-02269 71722 Cic capicua homolog (Drosophila) TRUE 0.99 6.95 6.11 1.10E-03 3.25E-02270 381417 Gm14085 predicted gene 14085 FALSE 1.54 3.40 6.10 1.10E-03 3.25E-02271 140577 Ankrd6 ankyrin repeat domain 6 TRUE 1.32 3.51 6.10 1.10E-03 3.25E-02272 13709 Elf1 E74-like factor 1 TRUE 0.78 8.57 6.10 1.10E-03 3.25E-02273 59043 Wsb2 WD repeat and SOCS box-containing 2 TRUE 0.79 5.25 6.09 1.11E-03 3.25E-02274 224008 Spidr scaffolding protein involved i DNA repair FALSE 0.98 4.49 6.08 1.12E-03 3.25E-02275 241041 Gm4956 predicted gene 4956 FALSE 3.48 -1.46 6.08 1.12E-03 3.25E-02276 66689 Klhl28 kelch-like 28 FALSE 1.02 3.56 6.07 1.12E-03 3.25E-02277 54123 Irf7 interferon regulatory factor 7 FALSE 2.25 5.01 6.11 1.13E-03 3.26E-02278 19265 Ptprcap protein tyrosine phosphatase, receptor type, C polypeptide-associated protein FALSE 0.77 8.29 6.06 1.13E-03 3.26E-02279 16992 Lta lymphotoxin A TRUE 1.86 1.92 6.05 1.15E-03 3.26E-02280 100041450 Gimap1os GTPase, IMAP family member 1, opposite strand FALSE 1.41 3.77 6.07 1.15E-03 3.26E-02281 26941 Slc9a3r1 solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 TRUE 0.72 8.00 6.04 1.16E-03 3.26E-02282 268752 Wdfy2 WD repeat and FYVE domain containing 2 TRUE 1.24 3.26 6.03 1.17E-03 3.26E-02283 23900 Hcst hematopoietic cell signal transducer TRUE 1.30 2.59 6.02 1.17E-03 3.26E-02284 208154 Btla B and T lymphocyte associated TRUE 1.38 4.29 6.06 1.18E-03 3.26E-02285 100040018 Gm9835 predicted pseudogene 9835 FALSE 1.01 6.12 6.01 1.18E-03 3.26E-02286 75796 Cdyl2 chromodomain protein, Y chromosome-like 2 TRUE 1.66 5.28 6.06 1.18E-03 3.26E-02287 235461 Fam63b family with sequence similarity 63, member B TRUE 1.29 6.00 6.05 1.19E-03 3.26E-02288 64931 Folr4 folate receptor 4 (delta) TRUE 1.25 5.62 6.04 1.20E-03 3.26E-02289 268783 Mtmr12 myotubularin related protein 12 TRUE 0.85 7.00 6.00 1.20E-03 3.26E-02290 75580 Zbtb4 zinc finger and BTB domain containing 4 FALSE 1.86 1.78 6.00 1.20E-03 3.26E-02291 12523 Cd84 CD84 antigen FALSE 1.16 6.21 6.03 1.21E-03 3.26E-02292 71728 Stk11ip serine/threonine kinase 11 interacting protein TRUE 1.15 5.27 6.01 1.21E-03 3.26E-02293 19248 Ptpn12 protein tyrosine phosphatase, non-receptor type 12 TRUE 1.14 4.20 5.98 1.21E-03 3.26E-02294 242705 E2f2 E2F transcription factor 2 TRUE 0.68 8.09 5.98 1.22E-03 3.26E-02295 63828 Fn3k fructosamine 3 kinase TRUE 2.12 1.56 5.97 1.22E-03 3.26E-02296 245536 Gm614 predicted gene 614 FALSE 1.93 0.95 5.97 1.22E-03 3.26E-02297 100182 Akna AT-hook transcription factor TRUE 1.05 7.59 6.01 1.23E-03 3.26E-02298 230806 Aim1l absent in melanoma 1-like FALSE 1.51 2.35 5.96 1.23E-03 3.26E-02299 58205 Pdcd1lg2 programmed cell death 1 ligand 2 TRUE 1.30 2.18 5.96 1.24E-03 3.26E-02300 76071 Jakmip1 janus kinase and microtubule interacting protein 1 TRUE 1.30 6.33 5.99 1.25E-03 3.29E-02301 16391 Irf9 interferon regulatory factor 9 FALSE 1.28 6.10 5.97 1.27E-03 3.31E-02302 20192 Ryr3 ryanodine receptor 3 FALSE 2.15 1.73 5.92 1.27E-03 3.31E-02303 81913 Bambi-ps1 BMP and activin membrane-bound inhibitor, pseudogene (Xenopus laevis) TRUE 1.57 4.38 5.96 1.28E-03 3.31E-02304 231125 Zfyve28 zinc finger, FYVE domain containing 28 TRUE 2.16 2.23 5.96 1.28E-03 3.31E-02305 215632 Psd4 pleckstrin and Sec7 domain containing 4 TRUE 0.71 7.44 5.92 1.28E-03 3.31E-02306 14667 Gm2a GM2 ganglioside activator protein TRUE 1.02 5.44 5.91 1.29E-03 3.31E-02307 100101484 Trac T cell receptor alpha constant FALSE 1.37 8.46 5.95 1.29E-03 3.31E-02308 319262 Fchsd1 FCH and double SH3 domains 1 FALSE 1.09 3.30 5.91 1.29E-03 3.31E-02309 58231 Stk4 serine/threonine kinase 4 TRUE 1.10 9.07 5.93 1.31E-03 3.34E-02310 16658 Mafb v-maf musculoaponeurotic fibrosarcoma oncogene family, protein B (avian) FALSE 1.78 1.08 5.89 1.31E-03 3.34E-02311 630146 Cd101 CD101 antigen TRUE 1.63 1.79 5.88 1.32E-03 3.36E-02312 12257 Tspo translocator protein TRUE 1.14 5.82 5.91 1.34E-03 3.39E-02313 22724 Zbtb7b zinc finger and BTB domain containing 7B TRUE 1.16 5.46 5.90 1.34E-03 3.39E-02314 77318 Ankrd55 ankyrin repeat domain 55 TRUE 2.80 1.21 5.90 1.35E-03 3.39E-02315 11857 Arhgdib Rho, GDP dissociation inhibitor (GDI) beta TRUE 0.72 9.68 5.84 1.37E-03 3.40E-02316 67742 Samsn1 SAM domain, SH3 domain and nuclear localization signals, 1 FALSE 0.94 5.04 5.84 1.37E-03 3.40E-02317 17472 Gbp4 guanylate binding protein 4 FALSE 1.71 5.98 5.88 1.37E-03 3.40E-02318 22057 Tob1 transducer of ErbB-2.1 FALSE 1.75 4.92 5.87 1.38E-03 3.40E-02319 17698 Msn moesin TRUE 0.84 9.62 5.83 1.38E-03 3.40E-02320 66892 Eif4e3 eukaryotic translation initiation factor 4E member 3 TRUE 0.89 4.49 5.82 1.39E-03 3.40E-02321 59033 Slc4a8 solute carrier family 4 (anion exchanger), member 8 FALSE 1.75 0.65 5.82 1.39E-03 3.40E-02322 17085 Ly9 lymphocyte antigen 9 FALSE 0.68 6.70 5.82 1.39E-03 3.40E-02323 64051 Sv2a synaptic vesicle glycoprotein 2 a FALSE 1.62 2.47 5.82 1.39E-03 3.40E-02324 20393 Sgk1 serum/glucocorticoid regulated kinase 1 TRUE 0.89 6.40 5.81 1.40E-03 3.41E-02325 215280 Wipf1 WAS/WASL interacting protein family, member 1 TRUE 0.80 7.81 5.80 1.41E-03 3.42E-02326 209011 Sirt7 sirtuin 7 TRUE 0.76 6.28 5.77 1.45E-03 3.48E-02327 93694 Clec2d C-type lectin domain family 2, member d TRUE 1.96 4.39 5.81 1.46E-03 3.48E-02328 214855 Arid5a AT rich interactive domain 5A (MRF1-like) TRUE 1.22 5.67 5.80 1.46E-03 3.48E-02329 16490 Kcna2 potassium voltage-gated channel, shaker-related subfamily, member 2 TRUE 1.28 3.63 5.76 1.47E-03 3.48E-02330 26412 Map4k2 mitogen-activated protein kinase kinase kinase kinase 2 FALSE 0.91 6.08 5.75 1.47E-03 3.48E-02331 108723 Card11 caspase recruitment domain family, member 11 TRUE 0.98 6.25 5.77 1.47E-03 3.48E-02332 101497 Plekhg2 pleckstrin homology domain containing, family G (with RhoGef domain) member 2 TRUE 1.11 6.53 5.79 1.47E-03 3.48E-02333 20491 Sla src-like adaptor TRUE 0.82 9.21 5.75 1.48E-03 3.49E-02334 75860 Tex26 testis expressed 26 FALSE 1.67 2.10 5.74 1.49E-03 3.50E-02335 217410 Trib2 tribbles homolog 2 (Drosophila) TRUE 0.89 8.20 5.74 1.49E-03 3.50E-02336 59090 Midn midnolin TRUE 0.65 7.39 5.73 1.50E-03 3.50E-02337 22368 Trpv2 transient receptor potential cation channel, subfamily V, member 2 TRUE 0.88 5.86 5.73 1.50E-03 3.50E-02338 80290 Gpr146 G protein-coupled receptor 146 TRUE 1.77 4.49 5.77 1.50E-03 3.50E-02

339 12259 C1qa complement component 1, q subcomponent, alpha polypeptide FALSE 2.21 0.17 5.74 1.50E-03 3.50E-02340 19275 Ptprn protein tyrosine phosphatase, receptor type, N FALSE 3.33 -0.56 5.76 1.51E-03 3.50E-02341 72128 2610008E11Rik RIKEN cDNA 2610008E11 gene FALSE 1.17 3.86 5.72 1.52E-03 3.50E-02342 26401 Map3k1 mitogen-activated protein kinase kinase kinase 1 TRUE 0.79 6.74 5.71 1.52E-03 3.50E-02343 407786 Taf9b TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor FALSE 1.03 3.48 5.71 1.53E-03 3.50E-02344 16186 Il2rg interleukin 2 receptor, gamma chain FALSE 0.87 7.91 5.70 1.53E-03 3.52E-02345 246177 Myo1g myosin IG FALSE 0.82 7.34 5.69 1.55E-03 3.54E-02346 12479 Cd1d1 CD1d1 antigen FALSE 1.03 4.98 5.68 1.57E-03 3.54E-02347 19645 Rb1 retinoblastoma 1 TRUE 0.75 6.91 5.67 1.57E-03 3.54E-02348 331004 Slc9a9 solute carrier family 9 (sodium/hydrogen exchanger), member 9 TRUE 0.97 6.29 5.70 1.58E-03 3.55E-02349 78830 Slc25a12 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 FALSE 0.76 6.48 5.66 1.60E-03 3.57E-02350 66573 Dzip1 DAZ interacting protein 1 TRUE 1.19 6.27 5.70 1.60E-03 3.57E-02351 434147 D930028M14Rik RIKEN cDNA D930028M14 gene FALSE 2.17 -0.50 5.64 1.62E-03 3.59E-02352 268297 Scml4 sex comb on midleg-like 4 (Drosophila) TRUE 0.70 6.71 5.64 1.62E-03 3.59E-02353 66790 Grtp1 GH regulated TBC protein 1 FALSE 2.08 1.56 5.64 1.62E-03 3.59E-02354 244237 Tnfrsf26 tumor necrosis factor receptor superfamily, member 26 FALSE 1.38 4.66 5.67 1.64E-03 3.60E-02355 21899 Tlr6 toll-like receptor 6 FALSE 1.08 3.13 5.63 1.64E-03 3.60E-02356 667823 Trim5 tripartite motif-containing 5 FALSE 1.65 1.34 5.62 1.65E-03 3.60E-02357 12323 Camk2b calcium/calmodulin-dependent protein kinase II, beta FALSE 2.52 1.60 5.65 1.66E-03 3.62E-02358 101602 AI467606 expressed sequence AI467606 TRUE 0.87 6.39 5.61 1.67E-03 3.62E-02359 19354 Rac2 RAS-related C3 botulinum substrate 2 TRUE 0.69 9.92 5.61 1.67E-03 3.62E-02360 66443 Tnfaip8l1 tumor necrosis factor, alpha-induced protein 8-like 1 FALSE 0.79 4.28 5.61 1.67E-03 3.62E-02361 73737 1110008P14Rik RIKEN cDNA 1110008P14 gene FALSE 1.06 3.48 5.60 1.68E-03 3.63E-02362 19229 Ptk2b PTK2 protein tyrosine kinase 2 beta TRUE 1.01 7.44 5.63 1.69E-03 3.63E-02363 64380 Ms4a4c membrane-spanning 4-domains, subfamily A, member 4C FALSE 2.51 1.24 5.63 1.70E-03 3.64E-02364 140742 Sesn1 sestrin 1 FALSE 1.16 6.95 5.61 1.72E-03 3.66E-02365 53313 Atp2a3 ATPase, Ca++ transporting, ubiquitous TRUE 0.77 8.71 5.57 1.73E-03 3.66E-02366 108797 Mex3b mex3 homolog B (C. elegans) TRUE 0.78 5.03 5.56 1.74E-03 3.68E-02367 105171 Arrdc3 arrestin domain containing 3 TRUE 1.23 3.23 5.55 1.75E-03 3.71E-02368 16155 Il10rb interleukin 10 receptor, beta TRUE 0.99 3.87 5.54 1.76E-03 3.72E-02369 60533 Cd274 CD274 antigen TRUE 1.51 3.35 5.58 1.77E-03 3.72E-02370 14466 Gba glucosidase, beta, acid FALSE 0.88 4.97 5.53 1.78E-03 3.74E-02371 71817 Tmem50a transmembrane protein 50A FALSE 0.91 6.75 5.54 1.79E-03 3.74E-02372 18576 Pde3b phosphodiesterase 3B, cGMP-inhibited TRUE 0.95 7.38 5.56 1.80E-03 3.74E-02373 21940 Cd27 CD27 antigen TRUE 1.14 8.18 5.56 1.80E-03 3.74E-02374 75871 Zfp821 zinc finger protein 821 TRUE 1.47 3.94 5.56 1.80E-03 3.74E-02375 18671 Abcb1a ATP-binding cassette, sub-family B (MDR/TAP), member 1A FALSE 2.55 1.15 5.55 1.82E-03 3.75E-02376 215418 Csrnp1 cysteine-serine-rich nuclear protein 1 TRUE 0.79 5.39 5.51 1.82E-03 3.75E-02377 54721 Tyk2 tyrosine kinase 2 TRUE 0.71 5.68 5.51 1.83E-03 3.75E-02378 57778 Fmnl1 formin-like 1 TRUE 0.91 8.64 5.54 1.83E-03 3.75E-02379 213439 Gpr174 G protein-coupled receptor 174 FALSE 2.88 4.19 5.53 1.84E-03 3.77E-02380 233040 Fbxo27 F-box protein 27 TRUE 2.38 0.15 5.49 1.85E-03 3.77E-02381 11426 Macf1 microtubule-actin crosslinking factor 1 TRUE 0.83 8.79 5.49 1.85E-03 3.77E-02382 56338 Txnip thioredoxin interacting protein TRUE 1.50 7.15 5.52 1.86E-03 3.77E-02383 381924 Itgad integrin, alpha D FALSE 1.51 -0.28 5.48 1.87E-03 3.79E-02384 216439 Agap2 ArfGAP with GTPase domain, ankyrin repeat and PH domain 2 TRUE 0.87 6.28 5.47 1.89E-03 3.80E-02385 103724 Tbc1d10a TBC1 domain family, member 10a FALSE 0.70 5.50 5.46 1.89E-03 3.80E-02386 240921 Gm4955 predicted gene 4955 FALSE 2.33 4.31 5.50 1.90E-03 3.80E-02387 76088 Dock8 dedicator of cytokinesis 8 TRUE 0.64 8.43 5.45 1.91E-03 3.80E-02388 12503 Cd247 CD247 antigen TRUE 0.80 8.48 5.45 1.91E-03 3.80E-02389 100503190 Gm19585 predicted gene, 19585 FALSE 1.59 1.73 5.45 1.91E-03 3.80E-02390 57444 Isg20 interferon-stimulated protein TRUE 1.45 3.33 5.49 1.92E-03 3.80E-02391 27405 Abcg3 ATP-binding cassette, sub-family G (WHITE), member 3 FALSE 0.79 4.10 5.45 1.92E-03 3.80E-02392 16408 Itgal integrin alpha L TRUE 0.88 9.05 5.45 1.92E-03 3.80E-02393 20689 Sall3 sal-like 3 (Drosophila) FALSE 1.06 2.26 5.45 1.92E-03 3.80E-02394 11883 Arsa arylsulfatase A FALSE 1.01 3.20 5.45 1.92E-03 3.80E-02395 320099 BC106179 cDNA sequence BC106179 FALSE 2.00 1.43 5.44 1.93E-03 3.80E-02396 12633 Cflar CASP8 and FADD-like apoptosis regulator TRUE 0.75 5.76 5.43 1.95E-03 3.82E-02397 12515 Cd69 CD69 antigen TRUE 2.48 3.27 5.46 1.96E-03 3.84E-02398 67603 Dusp6 dual specificity phosphatase 6 TRUE 1.12 3.66 5.42 1.97E-03 3.84E-02399 266632 Irak4 interleukin-1 receptor-associated kinase 4 FALSE 0.80 4.27 5.42 1.97E-03 3.84E-02400 252967 Ropn1l ropporin 1-like FALSE 1.62 0.90 5.41 1.99E-03 3.85E-02401 24058 Sigirr single immunoglobulin and toll-interleukin 1 receptor (TIR) domain FALSE 0.94 4.92 5.41 1.99E-03 3.85E-02402 56089 Ramp3 receptor (calcitonin) activity modifying protein 3 FALSE 2.21 4.00 5.44 2.00E-03 3.86E-02403 53945 Slc40a1 solute carrier family 40 (iron-regulated transporter), member 1 FALSE 1.68 1.52 5.42 2.00E-03 3.86E-02404 56736 Rnf14 ring finger protein 14 TRUE 1.00 6.20 5.44 2.01E-03 3.86E-02405 70785 Dennd1c DENN/MADD domain containing 1C TRUE 1.46 5.16 5.43 2.01E-03 3.87E-02406 13723 Emb embigin TRUE 0.80 7.74 5.39 2.02E-03 3.87E-02407 241303 Fam78a family with sequence similarity 78, member A TRUE 0.97 7.24 5.43 2.02E-03 3.87E-02408 21813 Tgfbr2 transforming growth factor, beta receptor II TRUE 0.93 6.65 5.42 2.04E-03 3.87E-02409 240672 Dusp5 dual specificity phosphatase 5 TRUE 1.05 4.11 5.38 2.05E-03 3.87E-02410 22317 Vamp1 vesicle-associated membrane protein 1 TRUE 1.44 4.21 5.41 2.06E-03 3.87E-02411 56048 Lgals8 lectin, galactose binding, soluble 8 TRUE 0.89 5.44 5.37 2.06E-03 3.87E-02412 18035 Nfkbia nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha TRUE 0.65 6.64 5.37 2.07E-03 3.87E-02413 70028 Dopey2 dopey family member 2 TRUE 0.99 4.37 5.36 2.07E-03 3.87E-02414 228602 4930402H24Rik RIKEN cDNA 4930402H24 gene FALSE 1.32 2.61 5.36 2.07E-03 3.87E-02415 14245 Lpin1 lipin 1 TRUE 0.94 4.69 5.36 2.08E-03 3.87E-02416 217684 4933426M11Rik RIKEN cDNA 4933426M11 gene TRUE 0.65 6.27 5.35 2.09E-03 3.87E-02417 228852 Ppp1r16b protein phosphatase 1, regulatory (inhibitor) subunit 16B TRUE 0.87 7.28 5.36 2.10E-03 3.87E-02418 13848 Ephb6 Eph receptor B6 TRUE 1.24 6.80 5.39 2.10E-03 3.87E-02419 12695 Inadl InaD-like (Drosophila) TRUE 1.72 3.72 5.38 2.10E-03 3.87E-02420 19141 Lgmn legumain FALSE 1.19 4.39 5.37 2.12E-03 3.89E-02421 76051 Ganc glucosidase, alpha; neutral C TRUE 0.89 4.24 5.33 2.13E-03 3.90E-02422 13034 Ctse cathepsin E TRUE 0.82 7.36 5.33 2.14E-03 3.91E-02423 332579 Card9 caspase recruitment domain family, member 9 TRUE 1.27 3.35 5.32 2.16E-03 3.93E-02424 70080 Igsf23 immunoglobulin superfamily, member 23 TRUE 1.17 5.57 5.34 2.18E-03 3.93E-02425 16801 Arhgef1 Rho guanine nucleotide exchange factor (GEF) 1 TRUE 0.82 9.20 5.31 2.18E-03 3.93E-02426 64177 Trpv6 transient receptor potential cation channel, subfamily V, member 6 FALSE 1.68 2.32 5.34 2.19E-03 3.93E-02427 433938 Mn1 meningioma 1 FALSE 1.69 2.73 5.34 2.19E-03 3.93E-02428 74315 Rnf145 ring finger protein 145 TRUE 0.79 7.58 5.30 2.19E-03 3.93E-02429 99382 Abtb2 ankyrin repeat and BTB (POZ) domain containing 2 TRUE 1.08 6.53 5.34 2.19E-03 3.93E-02430 239570 Ttc38 tetratricopeptide repeat domain 38 FALSE 1.23 5.17 5.33 2.20E-03 3.93E-02431 13654 Egr2 early growth response 2 TRUE 1.98 1.48 5.29 2.22E-03 3.94E-02432 54598 Calcrl calcitonin receptor-like FALSE 0.86 3.86 5.29 2.22E-03 3.94E-02433 239096 Cdh24 cadherin-like 24 FALSE 1.64 4.55 5.32 2.23E-03 3.94E-02434 381990 Zbtb2 zinc finger and BTB domain containing 2 FALSE 0.73 5.60 5.28 2.24E-03 3.95E-02435 216198 Tcp11l2 t-complex 11 (mouse) like 2 TRUE 1.68 4.97 5.31 2.24E-03 3.96E-02436 106059 A430088P11Rik RIKEN cDNA A430088P11 gene FALSE 1.72 1.57 5.27 2.25E-03 3.97E-02437 74775 Lmbr1l limb region 1 like TRUE 1.19 5.38 5.30 2.26E-03 3.97E-02438 101187 Parp11 poly (ADP-ribose) polymerase family, member 11 TRUE 0.65 5.77 5.26 2.27E-03 3.99E-02439 381353 Gm996 predicted gene 996 FALSE 2.11 0.70 5.26 2.28E-03 4.00E-02440 269389 Tox2 TOX high mobility group box family member 2 FALSE 1.46 5.86 5.29 2.29E-03 4.01E-02441 21803 Tgfb1 transforming growth factor, beta 1 TRUE 0.68 6.26 5.25 2.29E-03 4.01E-02442 11656 Alas2 aminolevulinic acid synthase 2, erythroid FALSE 1.58 0.62 5.25 2.30E-03 4.01E-02443 22165 Txk TXK tyrosine kinase TRUE 2.00 5.78 5.28 2.31E-03 4.01E-02444 208228 Mob3a MOB kinase activator 3A TRUE 0.65 6.95 5.24 2.32E-03 4.01E-02445 276905 Armc7 armadillo repeat containing 7 TRUE 0.76 4.60 5.24 2.33E-03 4.02E-02446 19264 Ptprc protein tyrosine phosphatase, receptor type, C TRUE 0.75 10.16 5.23 2.33E-03 4.02E-02447 14595 B4galt1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 TRUE 1.00 7.10 5.26 2.34E-03 4.03E-02448 12326 Camk4 calcium/calmodulin-dependent protein kinase IV TRUE 0.75 9.14 5.23 2.35E-03 4.03E-02449 20868 Stk10 serine/threonine kinase 10 TRUE 1.02 7.33 5.23 2.41E-03 4.09E-02450 16428 Itk IL2 inducible T cell kinase TRUE 1.15 8.11 5.23 2.41E-03 4.09E-02451 20229 Sat1 spermidine/spermine N1-acetyl transferase 1 FALSE 1.20 4.52 5.23 2.41E-03 4.09E-02452 67608 Narf nuclear prelamin A recognition factor TRUE 0.84 6.18 5.19 2.42E-03 4.09E-02

453 100604 Lrrc8c leucine rich repeat containing 8 family, member C TRUE 0.67 5.70 5.19 2.42E-03 4.09E-02454 216848 Chd3 chromodomain helicase DNA binding protein 3 TRUE 0.70 8.53 5.19 2.42E-03 4.09E-02455 330319 Wipf3 WAS/WASL interacting protein family, member 3 FALSE 0.96 3.59 5.18 2.45E-03 4.10E-02456 171580 Mical1 microtubule associated monooxygenase, calponin and LIM domain containing 1 TRUE 0.91 6.49 5.21 2.46E-03 4.12E-02457 83429 Ctns cystinosis, nephropathic FALSE 0.99 3.88 5.17 2.47E-03 4.12E-02458 66503 1810034E14Rik RIKEN cDNA 1810034E14 gene FALSE 1.32 2.12 5.16 2.49E-03 4.14E-02459 52668 Ifi27 interferon, alpha-inducible protein 27 FALSE 0.79 6.63 5.16 2.49E-03 4.14E-02460 71900 Tmem106b transmembrane protein 106B FALSE 0.90 6.11 5.16 2.53E-03 4.18E-02461 330189 Tmem120b transmembrane protein 120B TRUE 0.81 4.80 5.14 2.54E-03 4.20E-02462 215243 Traf3ip3 TRAF3 interacting protein 3 TRUE 1.10 6.65 5.17 2.55E-03 4.20E-02463 230674 Kdm4a lysine (K)-specific demethylase 4A FALSE 0.68 7.34 5.13 2.57E-03 4.22E-02464 216527 Ccm2 cerebral cavernous malformation 2 TRUE 0.75 7.01 5.13 2.57E-03 4.22E-02465 18605 Enpp1 ectonucleotide pyrophosphatase/phosphodiesterase 1 FALSE 0.98 2.79 5.13 2.57E-03 4.22E-02466 12333 Capn1 calpain 1 FALSE 1.10 6.89 5.16 2.57E-03 4.22E-02467 93692 Glrx glutaredoxin FALSE 0.68 5.14 5.12 2.59E-03 4.24E-02468 80911 Acox3 acyl-Coenzyme A oxidase 3, pristanoyl FALSE 0.90 4.71 5.12 2.60E-03 4.24E-02469 100504516 Gm20262 predicted gene, 20262 FALSE 1.59 2.51 5.15 2.61E-03 4.24E-02470 85030 Tnfrsf25 tumor necrosis factor receptor superfamily, member 25 FALSE 1.30 2.38 5.11 2.62E-03 4.26E-02471 207728 Pde2a phosphodiesterase 2A, cGMP-stimulated TRUE 1.04 5.92 5.14 2.63E-03 4.27E-02472 63953 Dusp10 dual specificity phosphatase 10 TRUE 0.79 7.03 5.10 2.65E-03 4.29E-02473 68235 Mturn maturin, neural progenitor differentiation regulator homolog (Xenopus) TRUE 2.11 1.80 5.13 2.66E-03 4.29E-02474 73723 Sh3bgrl3 SH3 domain binding glutamic acid-rich protein-like 3 FALSE 0.81 7.49 5.10 2.66E-03 4.29E-02475 11796 Birc3 baculoviral IAP repeat-containing 3 TRUE 1.01 4.45 5.09 2.66E-03 4.29E-02476 22214 Ube2h ubiquitin-conjugating enzyme E2H TRUE 1.30 6.84 5.12 2.67E-03 4.30E-02477 100037283 Rnaset2a ribonuclease T2A FALSE 0.73 5.22 5.08 2.68E-03 4.30E-02478 100503460 Gm19705 predicted gene, 19705 FALSE 1.35 1.97 5.08 2.69E-03 4.31E-02479 213484 Nudt18 nudix (nucleoside diphosphate linked moiety X)-type motif 18 FALSE 0.84 3.28 5.07 2.70E-03 4.32E-02480 66480 Rpl15 ribosomal protein L15 TRUE 0.88 5.22 5.07 2.71E-03 4.32E-02481 19651 Rbl2 retinoblastoma-like 2 FALSE 1.15 6.65 5.10 2.72E-03 4.34E-02482 320484 Rasal3 RAS protein activator like 3 TRUE 0.81 7.88 5.07 2.73E-03 4.35E-02483 102566 Ano10 anoctamin 10 TRUE 0.67 6.16 5.06 2.74E-03 4.35E-02484 13611 S1pr4 sphingosine-1-phosphate receptor 4 FALSE 1.42 4.67 5.09 2.74E-03 4.35E-02485 14252 Flot2 flotillin 2 FALSE 0.61 6.24 5.06 2.75E-03 4.36E-02486 70661 Sik3 SIK family kinase 3 TRUE 0.76 6.00 5.05 2.77E-03 4.37E-02487 13356 Dgcr2 DiGeorge syndrome critical region gene 2 FALSE 0.59 6.93 5.05 2.77E-03 4.38E-02488 434223 Gm1966 predicted gene 1966 FALSE 2.06 2.32 5.07 2.79E-03 4.39E-02489 27212 Snord35b small nucleolar RNA, C/D box 35B FALSE 2.97 0.33 5.07 2.80E-03 4.41E-02490 71673 Rnf215 ring finger protein 215 FALSE 1.04 3.35 5.03 2.82E-03 4.43E-02491 433022 Plcxd2 phosphatidylinositol-specific phospholipase C, X domain containing 2 TRUE 1.23 5.28 5.06 2.83E-03 4.43E-02492 52570 Ccdc69 coiled-coil domain containing 69 TRUE 0.75 5.08 5.03 2.83E-03 4.43E-02493 623121 Pydc4 pyrin domain containing 4 FALSE 3.12 0.69 5.05 2.84E-03 4.43E-02494 58802 Kcnmb4 potassium large conductance calcium-activated channel, subfamily M, beta member 4 TRUE 1.21 2.87 5.01 2.87E-03 4.45E-02495 11826 Aqp1 aquaporin 1 FALSE 1.39 0.19 5.01 2.87E-03 4.45E-02496 17159 Man2b1 mannosidase 2, alpha B1 FALSE 0.80 6.94 5.02 2.87E-03 4.45E-02497 331524 Xkrx X Kell blood group precursor related X linked FALSE 1.94 1.50 5.04 2.89E-03 4.46E-02498 76338 Rab2b RAB2B, member RAS oncogene family TRUE 0.91 4.23 5.00 2.90E-03 4.46E-02499 17119 Mxd1 MAX dimerization protein 1 TRUE 1.01 4.43 5.00 2.90E-03 4.46E-02500 24127 Xrn1 5'-3' exoribonuclease 1 TRUE 0.97 6.46 5.03 2.92E-03 4.48E-02501 13733 Emr1 EGF-like module containing, mucin-like, hormone receptor-like sequence 1 FALSE 1.96 0.15 5.00 2.93E-03 4.48E-02502 67171 Dram2 DNA-damage regulated autophagy modulator 2 FALSE 0.74 4.40 4.99 2.93E-03 4.48E-02503 54390 Sit1 suppression inducing transmembrane adaptor 1 TRUE 1.10 5.02 5.02 2.93E-03 4.48E-02504 14628 Ostm1 osteopetrosis associated transmembrane protein 1 TRUE 0.74 6.58 4.99 2.94E-03 4.49E-02505 108116 Slco3a1 solute carrier organic anion transporter family, member 3a1 TRUE 0.73 5.38 4.98 2.95E-03 4.49E-02506 74901 Kbtbd11 kelch repeat and BTB (POZ) domain containing 11 TRUE 0.70 6.73 4.98 2.96E-03 4.49E-02507 84544 Cd96 CD96 antigen TRUE 1.00 6.55 5.01 2.96E-03 4.49E-02508 100043757 Zfp831 zinc finger protein 831 FALSE 2.38 3.34 5.01 2.97E-03 4.49E-02509 100125252 Trbj1-5 T cell receptor beta joining 1-5 FALSE 1.65 -0.05 5.00 2.98E-03 4.49E-02510 67978 Tctn2 tectonic family member 2 TRUE 0.99 2.75 4.97 2.98E-03 4.49E-02511 93730 Lztfl1 leucine zipper transcription factor-like 1 TRUE 1.17 6.20 5.00 2.99E-03 4.50E-02512 23999 Twf2 twinfilin, actin-binding protein, homolog 2 (Drosophila) FALSE 0.62 6.65 4.97 3.00E-03 4.52E-02513 14788 Gpr162 G protein-coupled receptor 162 TRUE 1.64 2.50 5.00 3.00E-03 4.52E-02514 100042498 Mir22hg Mir22 host gene (non-protein coding) FALSE 4.11 -1.28 4.99 3.01E-03 4.52E-02515 109711 Actn1 actinin, alpha 1 TRUE 0.76 9.01 4.96 3.03E-03 4.53E-02516 54484 Mkrn1 makorin, ring finger protein, 1 FALSE 0.81 5.75 4.96 3.03E-03 4.53E-02517 56857 Slc37a2 solute carrier family 37 (glycerol-3-phosphate transporter), member 2 TRUE 1.76 1.63 4.98 3.05E-03 4.54E-02518 73834 Atp6v1d ATPase, H+ transporting, lysosomal V1 subunit D FALSE 0.73 6.36 4.94 3.09E-03 4.58E-02519 13496 Arid3a AT rich interactive domain 3A (BRIGHT-like) TRUE 0.73 4.81 4.93 3.09E-03 4.58E-02520 237542 Osbpl8 oxysterol binding protein-like 8 TRUE 0.58 7.99 4.93 3.10E-03 4.58E-02521 12331 Cap1 CAP, adenylate cyclase-associated protein 1 (yeast) TRUE 0.80 8.69 4.94 3.11E-03 4.58E-02522 13040 Ctss cathepsin S FALSE 2.59 2.87 4.96 3.11E-03 4.58E-02523 63986 Gmfg glia maturation factor, gamma TRUE 0.86 4.66 4.92 3.13E-03 4.59E-02524 20111 Rps6ka1 ribosomal protein S6 kinase polypeptide 1 TRUE 0.73 7.49 4.92 3.13E-03 4.59E-02525 68616 Gdpd3 glycerophosphodiester phosphodiesterase domain containing 3 FALSE 1.28 4.58 4.95 3.14E-03 4.60E-02526 70701 Nipal1 NIPA-like domain containing 1 FALSE 1.59 2.99 4.93 3.19E-03 4.64E-02527 13030 Ctsb cathepsin B FALSE 0.68 8.36 4.90 3.20E-03 4.64E-02528 12507 Cd5 CD5 antigen TRUE 1.37 6.50 4.93 3.20E-03 4.64E-02529 78779 Spata2l spermatogenesis associated 2-like FALSE 1.10 2.90 4.89 3.21E-03 4.65E-02530 14605 Tsc22d3 TSC22 domain family, member 3 TRUE 1.02 6.24 4.92 3.21E-03 4.65E-02531 67912 1600012H06Rik RIKEN cDNA 1600012H06 gene TRUE 0.98 3.97 4.88 3.24E-03 4.67E-02532 12334 Capn2 calpain 2 FALSE 0.70 6.76 4.88 3.24E-03 4.67E-02533 69674 Mif4gd MIF4G domain containing FALSE 0.73 5.16 4.88 3.27E-03 4.68E-02534 20452 St8sia4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 TRUE 0.80 6.22 4.87 3.28E-03 4.68E-02535 105855 Nckap1l NCK associated protein 1 like FALSE 0.70 8.54 4.87 3.29E-03 4.68E-02536 234582 Ccdc102a coiled-coil domain containing 102A FALSE 1.24 2.84 4.87 3.30E-03 4.68E-02537 67542 Cog6 component of oligomeric golgi complex 6 FALSE 0.63 5.80 4.86 3.30E-03 4.68E-02538 232288 Frmd4b FERM domain containing 4B TRUE 1.14 4.13 4.89 3.31E-03 4.68E-02539 64009 Syne1 spectrin repeat containing, nuclear envelope 1 TRUE 0.91 5.70 4.87 3.32E-03 4.68E-02540 218442 Serinc5 serine incorporator 5 TRUE 1.32 6.66 4.89 3.33E-03 4.68E-02541 238377 Gpr68 G protein-coupled receptor 68 FALSE 1.96 0.23 4.86 3.33E-03 4.68E-02542 101476 Plekha1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 FALSE 0.91 5.01 4.86 3.33E-03 4.68E-02543 50708 Hist1h1c histone cluster 1, H1c TRUE 1.06 3.38 4.84 3.37E-03 4.71E-02544 11461 Actb actin, beta TRUE 0.55 11.34 4.84 3.38E-03 4.71E-02545 17916 Myo1f myosin IF FALSE 2.73 2.99 4.86 3.42E-03 4.75E-02546 55948 Sfn stratifin FALSE 0.98 2.54 4.83 3.42E-03 4.75E-02547 21848 Trim24 tripartite motif-containing 24 TRUE 0.61 6.07 4.82 3.44E-03 4.77E-02548 20568 Slpi secretory leukocyte peptidase inhibitor FALSE 2.88 0.15 4.85 3.44E-03 4.77E-02549 19157 Cyth1 cytohesin 1 FALSE 0.94 7.05 4.85 3.45E-03 4.77E-02550 209488 Hsh2d hematopoietic SH2 domain containing FALSE 1.13 3.08 4.82 3.45E-03 4.77E-02551 18406 Orm2 orosomucoid 2 FALSE 1.38 1.77 4.82 3.45E-03 4.77E-02552 17948 Naip2 NLR family, apoptosis inhibitory protein 2 FALSE 1.51 1.89 4.82 3.46E-03 4.77E-02553 229687 Chil5 chitinase-like 5 FALSE 2.86 -0.68 4.82 3.47E-03 4.77E-02554 14797 Aes amino-terminal enhancer of split TRUE 0.65 9.12 4.78 3.57E-03 4.87E-02555 171207 Arhgap4 Rho GTPase activating protein 4 TRUE 0.91 7.42 4.81 3.58E-03 4.87E-02556 15040 H2-T23 histocompatibility 2, T region locus 23 FALSE 1.27 6.24 4.81 3.58E-03 4.87E-02557 15259 Hipk3 homeodomain interacting protein kinase 3 FALSE 0.54 6.68 4.77 3.61E-03 4.90E-02558 12934 Dpysl2 dihydropyrimidinase-like 2 TRUE 0.75 4.24 4.77 3.62E-03 4.91E-02559 432530 Adcy1 adenylate cyclase 1 FALSE 1.74 3.09 4.79 3.64E-03 4.93E-02560 17101 Lyst lysosomal trafficking regulator TRUE 0.67 7.28 4.76 3.65E-03 4.94E-02561 232975 Atp1a3 ATPase, Na+/K+ transporting, alpha 3 polypeptide FALSE 1.81 3.34 4.79 3.66E-03 4.94E-02562 100124363 Traj26 T cell receptor alpha joining 26 FALSE 1.41 0.78 4.76 3.67E-03 4.94E-02563 20733 Spint2 serine protease inhibitor, Kunitz type 2 FALSE 0.60 7.52 4.75 3.70E-03 4.98E-02

Table S3. Ikaros repressed genesRepressed upon 3d Dox treatment in ALL65, ALL101and ALL211 - sorted by FDR

Rank GeneID Symbol Name ChIP logFC AveExpr t P.Value FDR1 72565 Uaca uveal autoantigen with coiled-coil domains and ankyrin repeats TRUE -3.84 4.31 -14.54 1.17E-05 1.77E-022 14012 Mpzl2 myelin protein zero-like 2 TRUE -3.63 3.61 -13.87 1.51E-05 1.83E-023 442827 Rab44 RAB44, member RAS oncogene family FALSE -4.01 -0.68 -13.19 1.83E-05 1.83E-024 102371 Myzap myocardial zonula adherens protein TRUE -2.34 2.93 -12.13 2.91E-05 1.83E-025 237886 Slfn9 schlafen 9 TRUE -1.70 6.16 -11.74 3.47E-05 1.83E-026 209630 Frmd4a FERM domain containing 4A TRUE -1.76 4.70 -11.64 3.65E-05 1.83E-027 56473 Fads2 fatty acid desaturase 2 TRUE -2.54 3.67 -11.62 3.67E-05 1.83E-028 56707 Zfp111 zinc finger protein 111 FALSE -2.63 2.90 -11.27 4.35E-05 1.83E-029 66355 Gmpr guanosine monophosphate reductase FALSE -1.97 3.22 -11.02 4.91E-05 1.83E-02

10 52670 Cpsf4l cleavage and polyadenylation specific factor 4-like TRUE -2.75 0.97 -10.95 5.08E-05 1.83E-0211 27053 Asns asparagine synthetase FALSE -2.14 1.05 -10.80 5.48E-05 1.83E-0212 17181 Matn2 matrilin 2 FALSE -2.68 2.75 -10.78 5.53E-05 1.83E-0213 75590 Dusp9 dual specificity phosphatase 9 TRUE -1.78 3.82 -10.59 6.11E-05 1.90E-0214 21807 Tsc22d1 TSC22 domain family, member 1 TRUE -1.74 5.01 -10.43 6.63E-05 1.90E-0215 23963 Tenm1 teneurin transmembrane protein 1 FALSE -3.82 0.18 -10.41 6.69E-05 1.90E-0216 56742 Psrc1 proline/serine-rich coiled-coil 1 TRUE -1.62 4.30 -10.40 6.72E-05 1.90E-0217 18186 Nrp1 neuropilin 1 TRUE -1.69 5.59 -10.17 7.60E-05 1.92E-0218 240058 Cpne5 copine V TRUE -2.33 0.81 -10.05 8.08E-05 1.97E-0219 73254 Ccdc18 coiled-coil domain containing 18 TRUE -1.87 5.30 -9.91 8.90E-05 1.97E-0220 15530 Hspg2 perlecan (heparan sulfate proteoglycan 2) FALSE -1.75 1.59 -9.80 9.27E-05 1.97E-0221 75600 Calml4 calmodulin-like 4 FALSE -5.71 -1.14 -9.77 9.42E-05 1.97E-0222 230612 Slc5a9 solute carrier family 5 (sodium/glucose cotransporter), member 9 FALSE -2.00 2.96 -9.50 1.09E-04 2.09E-0223 263803 Pkn3 protein kinase N3 TRUE -1.48 3.72 -9.44 1.13E-04 2.09E-0224 94275 Maged1 melanoma antigen, family D, 1 FALSE -2.43 4.82 -9.49 1.17E-04 2.09E-0225 17161 Maoa monoamine oxidase A FALSE -1.85 4.53 -9.05 1.43E-04 2.11E-0226 19716 Bex1 brain expressed gene 1 FALSE -3.73 2.42 -9.13 1.43E-04 2.11E-0227 269878 Megf8 multiple EGF-like-domains 8 TRUE -3.53 2.29 -9.06 1.50E-04 2.11E-0228 50722 Dkkl1 dickkopf-like 1 FALSE -3.46 0.44 -8.89 1.56E-04 2.11E-0229 20855 Stc1 stanniocalcin 1 FALSE -2.23 3.61 -8.90 1.63E-04 2.11E-0230 14369 Fzd7 frizzled homolog 7 (Drosophila) TRUE -1.42 3.97 -8.80 1.64E-04 2.11E-0231 70101 Cyp4f16 cytochrome P450, family 4, subfamily f, polypeptide 16 TRUE -2.06 1.32 -8.76 1.69E-04 2.11E-0232 18596 Pdgfrb platelet derived growth factor receptor, beta polypeptide FALSE -2.73 3.23 -8.83 1.71E-04 2.11E-0233 12388 Ctnnd1 catenin (cadherin associated protein), delta 1 TRUE -2.66 5.76 -8.61 1.95E-04 2.20E-0234 55963 Slc1a4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 TRUE -2.35 1.50 -8.49 1.99E-04 2.20E-0235 76257 Slc38a3 solute carrier family 38, member 3 FALSE -3.21 0.31 -8.49 2.00E-04 2.20E-0236 13685 Eif4ebp1 eukaryotic translation initiation factor 4E binding protein 1 FALSE -1.62 2.08 -8.29 2.27E-04 2.20E-0237 12322 Camk2a calcium/calmodulin-dependent protein kinase II alpha TRUE -1.37 4.10 -8.25 2.33E-04 2.20E-0238 18160 Npr1 natriuretic peptide receptor 1 FALSE -2.32 1.06 -8.22 2.36E-04 2.20E-0239 399603 Fam84b family with sequence similarity 84, member B TRUE -2.56 1.09 -8.23 2.41E-04 2.20E-0240 73130 Tmed5 transmembrane emp24 protein transport domain containing 5 TRUE -1.23 7.48 -8.13 2.50E-04 2.23E-0241 18128 Notch1 notch 1 TRUE -1.26 8.84 -8.09 2.57E-04 2.25E-0242 243753 2010107G12Rik RIKEN cDNA 2010107G12 gene TRUE -1.99 3.13 -8.01 2.72E-04 2.31E-0243 11565 Adssl1 adenylosuccinate synthetase like 1 TRUE -1.68 2.16 -8.00 2.73E-04 2.31E-0244 19208 Ptcra pre T cell antigen receptor alpha TRUE -2.24 0.56 -8.01 2.85E-04 2.33E-0245 16779 Lamb2 laminin, beta 2 FALSE -1.43 4.47 -7.88 2.96E-04 2.36E-0246 16579 Kifap3 kinesin-associated protein 3 TRUE -1.35 4.23 -7.85 3.01E-04 2.36E-0247 71768 Vwce von Willebrand factor C and EGF domains TRUE -1.84 1.69 -7.78 3.17E-04 2.36E-0248 54648 Ccdc120 coiled-coil domain containing 120 FALSE -2.96 0.15 -7.76 3.21E-04 2.36E-0249 72519 Tmem55a transmembrane protein 55A TRUE -1.83 4.46 -7.78 3.31E-04 2.36E-0250 17765 Mtf2 metal response element binding transcription factor 2 TRUE -0.87 8.01 -7.66 3.43E-04 2.37E-0251 244550 Podnl1 podocan-like 1 TRUE -2.92 2.07 -7.72 3.46E-04 2.37E-0252 13797 Emx2 empty spiracles homeobox 2 FALSE -1.68 4.64 -7.64 3.64E-04 2.47E-0253 442834 D830031N03Rik RIKEN cDNA D830031N03 gene FALSE -1.04 4.90 -7.56 3.67E-04 2.47E-0254 73106 Prss57 protease, serine 57 FALSE -2.52 2.15 -7.59 3.77E-04 2.50E-0255 15200 Hbegf heparin-binding EGF-like growth factor FALSE -3.78 -0.72 -7.52 3.77E-04 2.50E-0256 217166 Nr1d1 nuclear receptor subfamily 1, group D, member 1 TRUE -1.46 2.81 -7.50 3.83E-04 2.50E-0257 77579 Myh10 myosin, heavy polypeptide 10, non-muscle FALSE -1.36 6.33 -7.52 3.83E-04 2.50E-0258 319207 Pgbd1 piggyBac transposable element derived 1 TRUE -1.84 1.25 -7.46 3.94E-04 2.55E-0259 68428 Steap3 STEAP family member 3 FALSE -1.91 3.57 -7.49 4.04E-04 2.59E-0260 100340 Smpdl3b sphingomyelin phosphodiesterase, acid-like 3B TRUE -2.65 0.61 -7.37 4.17E-04 2.65E-0261 442801 Arhgef15 Rho guanine nucleotide exchange factor (GEF) 15 FALSE -2.11 1.31 -7.36 4.21E-04 2.65E-0262 71435 Arhgap21 Rho GTPase activating protein 21 TRUE -1.21 4.89 -7.22 4.66E-04 2.70E-0263 320609 Strip2 striatin interacting protein 2 TRUE -1.51 4.32 -7.21 4.72E-04 2.70E-0264 72709 C1qtnf6 C1q and tumor necrosis factor related protein 6 TRUE -1.20 5.49 -7.19 4.77E-04 2.70E-0265 75146 Tmem180 transmembrane protein 180 FALSE -1.82 1.75 -7.18 4.79E-04 2.70E-0266 17240 Mdfi MyoD family inhibitor TRUE -2.25 1.88 -7.12 5.01E-04 2.75E-0267 11855 Arhgap5 Rho GTPase activating protein 5 TRUE -1.44 4.08 -7.09 5.13E-04 2.76E-0268 83767 Wasf1 WAS protein family, member 1 TRUE -4.16 -0.65 -7.15 5.13E-04 2.76E-0269 228357 Lrp4 low density lipoprotein receptor-related protein 4 FALSE -1.75 1.91 -7.03 5.35E-04 2.76E-0270 19125 Prodh proline dehydrogenase TRUE -1.36 2.21 -7.01 5.41E-04 2.76E-0271 238323 Rps6kl1 ribosomal protein S6 kinase-like 1 FALSE -1.53 2.80 -7.01 5.42E-04 2.76E-0272 399548 Scn4b sodium channel, type IV, beta TRUE -3.54 1.11 -7.02 5.65E-04 2.76E-0273 319939 Tns3 tensin 3 TRUE -2.14 5.66 -7.01 5.67E-04 2.76E-0274 235604 Camkv CaM kinase-like vesicle-associated FALSE -1.88 1.16 -6.93 5.75E-04 2.76E-0275 329679 Fnip2 folliculin interacting protein 2 FALSE -1.39 1.05 -6.93 5.75E-04 2.76E-0276 380732 Milr1 mast cell immunoglobulin like receptor 1 TRUE -1.34 4.21 -6.86 6.07E-04 2.79E-0277 78926 Gas2l1 growth arrest-specific 2 like 1 FALSE -2.23 1.30 -6.80 6.32E-04 2.81E-0278 207212 Arhgef17 Rho guanine nucleotide exchange factor (GEF) 17 FALSE -1.47 3.90 -6.77 6.48E-04 2.81E-0279 22658 Pcgf2 polycomb group ring finger 2 TRUE -1.56 2.97 -6.76 6.52E-04 2.81E-0280 207792 BC034090 cDNA sequence BC034090 FALSE -2.85 1.09 -6.81 6.55E-04 2.81E-0281 76937 2810429I04Rik RIKEN cDNA 2810429I04 gene TRUE -2.63 0.25 -6.73 6.71E-04 2.81E-0282 76429 Lhpp phospholysine phosphohistidine inorganic pyrophosphate phosphatase FALSE -1.48 3.40 -6.72 6.74E-04 2.81E-0283 20751 Spr sepiapterin reductase TRUE -1.09 4.96 -6.71 6.77E-04 2.81E-0284 64658 Mrps25 mitochondrial ribosomal protein S25 TRUE -0.87 5.64 -6.70 6.82E-04 2.81E-0285 216238 Eea1 early endosome antigen 1 FALSE -1.21 1.03 -6.70 6.85E-04 2.81E-0286 72821 Scn2b sodium channel, voltage-gated, type II, beta TRUE -1.27 5.01 -6.65 7.11E-04 2.83E-0287 75311 4930550C14Rik RIKEN cDNA 4930550C14 gene FALSE -3.07 0.98 -6.68 7.22E-04 2.83E-0288 207393 Elfn2 leucine rich repeat and fibronectin type III, extracellular 2 FALSE -2.56 4.70 -6.68 7.24E-04 2.83E-0289 68644 Abhd14a abhydrolase domain containing 14A FALSE -1.50 3.19 -6.60 7.38E-04 2.84E-0290 20166 Rtkn rhotekin TRUE -1.54 2.91 -6.57 7.56E-04 2.86E-0291 227638 Qsox2 quiescin Q6 sulfhydryl oxidase 2 FALSE -1.31 4.28 -6.56 7.60E-04 2.87E-0292 21673 Dntt deoxynucleotidyltransferase, terminal TRUE -1.72 8.56 -6.60 7.71E-04 2.89E-0293 50884 Nckap1 NCK-associated protein 1 FALSE -0.91 4.69 -6.53 7.78E-04 2.89E-0294 66597 Trim13 tripartite motif-containing 13 FALSE -1.82 4.39 -6.57 7.86E-04 2.89E-0295 102693 Phldb1 pleckstrin homology-like domain, family B, member 1 TRUE -1.49 4.11 -6.56 7.94E-04 2.89E-0296 231986 Jazf1 JAZF zinc finger 1 TRUE -2.29 3.52 -6.54 8.07E-04 2.90E-0297 54377 Cacng4 calcium channel, voltage-dependent, gamma subunit 4 FALSE -1.16 1.76 -6.49 8.07E-04 2.90E-0298 16891 Lipg lipase, endothelial TRUE -2.60 2.75 -6.52 8.20E-04 2.91E-0299 65970 Lima1 LIM domain and actin binding 1 FALSE -1.26 3.55 -6.45 8.29E-04 2.91E-02

100 58859 Efemp2 epidermal growth factor-containing fibulin-like extracellular matrix protein 2 TRUE -1.13 3.07 -6.40 8.64E-04 3.01E-02101 100042198 Gm3716 predicted gene 3716 FALSE -1.25 3.53 -6.38 8.74E-04 3.03E-02102 53885 Nphp1 nephronophthisis 1 (juvenile) homolog (human) FALSE -1.25 2.25 -6.34 9.03E-04 3.07E-02103 19212 Pter phosphotriesterase related TRUE -1.80 -0.35 -6.34 9.08E-04 3.07E-02104 264134 Ttc26 tetratricopeptide repeat domain 26 FALSE -1.72 1.38 -6.33 9.10E-04 3.07E-02105 16548 Khk ketohexokinase FALSE -1.13 4.28 -6.33 9.10E-04 3.07E-02106 99003 Qser1 glutamine and serine rich 1 TRUE -1.18 6.30 -6.37 9.23E-04 3.08E-02107 98733 Obsl1 obscurin-like 1 FALSE -4.30 -1.15 -6.36 9.31E-04 3.08E-02108 22673 Zfp185 zinc finger protein 185 FALSE -2.30 0.73 -6.28 9.48E-04 3.08E-02109 15982 Ifrd1 interferon-related developmental regulator 1 FALSE -0.83 5.72 -6.28 9.50E-04 3.08E-02

110 68176 Fam212a family with sequence similarity 212, member A TRUE -2.10 2.23 -6.33 9.53E-04 3.08E-02111 20163 Rsu1 Ras suppressor protein 1 TRUE -1.03 5.59 -6.27 9.56E-04 3.08E-02112 13371 Dio2 deiodinase, iodothyronine, type II FALSE -2.92 1.68 -6.28 9.85E-04 3.16E-02113 233781 Xylt1 xylosyltransferase 1 TRUE -1.09 4.17 -6.21 1.01E-03 3.21E-02114 14739 S1pr2 sphingosine-1-phosphate receptor 2 TRUE -1.07 3.88 -6.19 1.02E-03 3.22E-02115 75723 Amotl1 angiomotin-like 1 TRUE -2.35 2.82 -6.22 1.03E-03 3.23E-02116 93732 Acox2 acyl-Coenzyme A oxidase 2, branched chain FALSE -2.30 0.28 -6.17 1.04E-03 3.23E-02117 103534 Mgat4b mannoside acetylglucosaminyltransferase 4, isoenzyme B FALSE -1.31 3.34 -6.17 1.04E-03 3.23E-02118 56745 C1qtnf1 C1q and tumor necrosis factor related protein 1 TRUE -2.93 2.43 -6.21 1.04E-03 3.23E-02119 14027 Evpl envoplakin FALSE -1.17 3.09 -6.16 1.05E-03 3.23E-02120 24064 Spry2 sprouty homolog 2 (Drosophila) FALSE -2.53 1.16 -6.19 1.06E-03 3.23E-02121 71835 Lancl2 LanC (bacterial lantibiotic synthetase component C)-like 2 FALSE -0.82 5.54 -6.14 1.07E-03 3.23E-02122 74158 Josd1 Josephin domain containing 1 TRUE -0.91 6.03 -6.13 1.07E-03 3.23E-02123 209032 Zc3hav1l zinc finger CCCH-type, antiviral 1-like FALSE -0.92 4.76 -6.08 1.11E-03 3.25E-02124 246229 Bivm basic, immunoglobulin-like variable motif containing TRUE -1.05 4.54 -6.08 1.12E-03 3.25E-02125 109212 Fam64a family with sequence similarity 64, member A FALSE -0.88 5.25 -6.08 1.12E-03 3.25E-02126 668212 Efr3b EFR3 homolog B (S. cerevisiae) FALSE -1.04 4.78 -6.06 1.14E-03 3.26E-02127 18641 Pfkl phosphofructokinase, liver, B-type TRUE -0.75 6.67 -6.04 1.15E-03 3.26E-02128 18591 Pdgfb platelet derived growth factor, B polypeptide FALSE -1.71 1.41 -6.04 1.16E-03 3.26E-02129 68151 Wls wntless homolog (Drosophila) TRUE -1.31 5.02 -6.08 1.16E-03 3.26E-02130 19376 Rab34 RAB34, member of RAS oncogene family FALSE -2.78 2.56 -6.08 1.16E-03 3.26E-02131 381101 Dnph1 2'-deoxynucleoside 5'-phosphate N-hydrolase 1 FALSE -2.22 3.04 -6.08 1.17E-03 3.26E-02132 230126 Shb src homology 2 domain-containing transforming protein B FALSE -1.61 1.29 -6.03 1.17E-03 3.26E-02133 15205 Hes1 hairy and enhancer of split 1 (Drosophila) TRUE -1.40 5.20 -6.04 1.20E-03 3.26E-02134 13631 Eef2k eukaryotic elongation factor-2 kinase TRUE -0.77 6.48 -6.00 1.20E-03 3.26E-02135 218820 Zfp503 zinc finger protein 503 FALSE -2.25 0.57 -6.04 1.20E-03 3.26E-02136 12577 Cdkn1c cyclin-dependent kinase inhibitor 1C (P57) FALSE -2.06 2.32 -6.02 1.22E-03 3.26E-02137 27973 Vkorc1 vitamin K epoxide reductase complex, subunit 1 TRUE -1.08 3.09 -5.98 1.22E-03 3.26E-02138 12217 Bsn bassoon TRUE -1.45 3.91 -6.02 1.22E-03 3.26E-02139 58996 Arhgap23 Rho GTPase activating protein 23 TRUE -1.40 3.19 -5.96 1.23E-03 3.26E-02140 14958 H1f0 H1 histone family, member 0 TRUE -1.15 8.10 -6.00 1.24E-03 3.26E-02141 224648 Uhrf1bp1 UHRF1 (ICBP90) binding protein 1 FALSE -1.50 4.05 -6.00 1.24E-03 3.26E-02142 214424 Parp16 poly (ADP-ribose) polymerase family, member 16 TRUE -1.28 3.91 -5.94 1.25E-03 3.29E-02143 11477 Acvr1 activin A receptor, type 1 FALSE -1.71 1.71 -5.94 1.26E-03 3.29E-02144 100504361 Gm14230 predicted gene 14230 FALSE -1.17 2.62 -5.91 1.28E-03 3.31E-02145 72388 Ripk4 receptor-interacting serine-threonine kinase 4 FALSE -2.13 -0.36 -5.94 1.30E-03 3.32E-02146 404710 Iqgap3 IQ motif containing GTPase activating protein 3 FALSE -1.04 5.94 -5.88 1.33E-03 3.38E-02147 17035 Lxn latexin TRUE -0.93 4.71 -5.86 1.34E-03 3.39E-02148 321022 Cdv3 carnitine deficiency-associated gene expressed in ventricle 3 FALSE -0.89 8.16 -5.85 1.35E-03 3.39E-02149 223864 Rapgef3 Rap guanine nucleotide exchange factor (GEF) 3 TRUE -1.08 5.26 -5.85 1.35E-03 3.39E-02150 114664 Hsd17b11 hydroxysteroid (17-beta) dehydrogenase 11 TRUE -0.74 5.54 -5.83 1.38E-03 3.40E-02151 71592 Pogk pogo transposable element with KRAB domain FALSE -1.67 0.73 -5.83 1.38E-03 3.40E-02152 54672 Gpr97 G protein-coupled receptor 97 TRUE -1.59 1.64 -5.83 1.38E-03 3.40E-02153 29856 Smtn smoothelin TRUE -0.89 4.39 -5.82 1.39E-03 3.40E-02154 65972 Ifi30 interferon gamma inducible protein 30 FALSE -0.81 4.34 -5.80 1.41E-03 3.42E-02155 97998 Deptor DEP domain containing MTOR-interacting protein TRUE -1.36 0.73 -5.79 1.42E-03 3.43E-02156 235472 Prtg protogenin homolog (Gallus gallus) FALSE -1.75 2.06 -5.82 1.43E-03 3.45E-02157 239759 Liph lipase, member H FALSE -1.17 2.91 -5.78 1.44E-03 3.47E-02158 67460 Decr1 2,4-dienoyl CoA reductase 1, mitochondrial FALSE -0.91 4.81 -5.76 1.46E-03 3.48E-02159 16199 Il9r interleukin 9 receptor FALSE -1.80 6.35 -5.79 1.47E-03 3.48E-02160 20973 Syngr2 synaptogyrin 2 TRUE -0.75 6.14 -5.72 1.51E-03 3.50E-02161 16412 Itgb1 integrin beta 1 (fibronectin receptor beta) TRUE -0.99 8.12 -5.76 1.52E-03 3.50E-02162 27217 Mixl1 Mix1 homeobox-like 1 (Xenopus laevis) FALSE -3.22 -0.78 -5.75 1.53E-03 3.50E-02163 14782 Gsr glutathione reductase TRUE -0.76 6.80 -5.69 1.56E-03 3.54E-02164 80880 Kank3 KN motif and ankyrin repeat domains 3 FALSE -1.36 1.58 -5.69 1.56E-03 3.54E-02165 26388 Ifi202b interferon activated gene 202B FALSE -4.02 0.28 -5.72 1.56E-03 3.54E-02166 353187 Nr1d2 nuclear receptor subfamily 1, group D, member 2 TRUE -0.84 4.00 -5.68 1.57E-03 3.54E-02167 11989 Slc7a3 solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 FALSE -2.71 -0.67 -5.68 1.57E-03 3.54E-02168 14065 F2rl3 coagulation factor II (thrombin) receptor-like 3 TRUE -1.35 3.38 -5.68 1.57E-03 3.54E-02169 26357 Abcg2 ATP-binding cassette, sub-family G (WHITE), member 2 FALSE -2.44 0.17 -5.70 1.59E-03 3.57E-02170 16438 Itpr1 inositol 1,4,5-trisphosphate receptor 1 TRUE -0.74 6.26 -5.66 1.60E-03 3.57E-02171 16475 Ajuba ajuba LIM protein FALSE -1.99 2.34 -5.69 1.61E-03 3.59E-02172 107503 Atf5 activating transcription factor 5 TRUE -0.79 4.50 -5.65 1.61E-03 3.59E-02173 104099 Itga9 integrin alpha 9 TRUE -1.12 4.51 -5.64 1.63E-03 3.59E-02174 67534 Ttll4 tubulin tyrosine ligase-like family, member 4 FALSE -0.73 5.58 -5.63 1.63E-03 3.59E-02175 216134 Pdxk pyridoxal (pyridoxine, vitamin B6) kinase TRUE -1.26 5.40 -5.65 1.67E-03 3.62E-02176 68636 Fahd1 fumarylacetoacetate hydrolase domain containing 1 FALSE -1.25 1.70 -5.60 1.67E-03 3.62E-02177 108682 Gpt2 glutamic pyruvate transaminase (alanine aminotransferase) 2 FALSE -1.02 2.85 -5.60 1.69E-03 3.63E-02178 13664 Eif1a eukaryotic translation initiation factor 1A FALSE -0.94 6.86 -5.62 1.70E-03 3.64E-02179 14013 Mecom MDS1 and EVI1 complex locus FALSE -2.94 2.36 -5.62 1.71E-03 3.65E-02180 19296 Pvt1 plasmacytoma variant translocation 1 TRUE -1.36 3.12 -5.58 1.71E-03 3.66E-02181 544696 Tbc1d32 TBC1 domain family, member 32 TRUE -0.99 2.81 -5.57 1.72E-03 3.66E-02182 347722 Agap1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 FALSE -1.54 1.10 -5.55 1.76E-03 3.71E-02183 16656 Hivep3 human immunodeficiency virus type I enhancer binding protein 3 TRUE -2.25 5.38 -5.57 1.79E-03 3.74E-02184 72572 Spats2 spermatogenesis associated, serine-rich 2 TRUE -1.53 5.99 -5.56 1.80E-03 3.74E-02185 67313 5730559C18Rik RIKEN cDNA 5730559C18 gene FALSE -1.34 4.33 -5.56 1.80E-03 3.74E-02186 100041106 Gm3141 predicted gene 3141 FALSE -0.88 5.51 -5.51 1.82E-03 3.75E-02187 72504 Taf4b TAF4B RNA polymerase II, TATA box binding protein (TBP)-associated factor TRUE -0.87 4.79 -5.51 1.82E-03 3.75E-02188 170768 Pfkfb3 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 TRUE -0.76 5.47 -5.50 1.83E-03 3.75E-02189 100503884 Ccdc149 coiled-coil domain containing 149 FALSE -1.90 1.75 -5.52 1.85E-03 3.77E-02190 53422 Ybx2 Y box protein 2 FALSE -1.58 0.83 -5.48 1.87E-03 3.79E-02191 269037 Ctif CBP80/20-dependent translation initiation factor TRUE -1.21 3.06 -5.47 1.89E-03 3.80E-02192 98170 Tmem132a transmembrane protein 132A FALSE -1.66 4.96 -5.50 1.89E-03 3.80E-02193 100043272 5430417L22Rik RIKEN cDNA 5430417L22 gene TRUE -0.78 5.28 -5.46 1.89E-03 3.80E-02194 52538 Acaa2 acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) TRUE -0.75 7.74 -5.44 1.93E-03 3.81E-02195 226747 Ahctf1 AT hook containing transcription factor 1 TRUE -0.61 7.33 -5.43 1.94E-03 3.82E-02196 17254 Slc3a2 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 TRUE -0.80 7.10 -5.43 1.96E-03 3.84E-02197 18015 Nf1 neurofibromatosis 1 TRUE -0.76 5.12 -5.42 1.97E-03 3.84E-02198 67795 Rnls renalase, FAD-dependent amine oxidase TRUE -1.69 0.46 -5.40 2.00E-03 3.86E-02199 19731 Rgl1 ral guanine nucleotide dissociation stimulator,-like 1 TRUE -2.46 2.11 -5.43 2.02E-03 3.87E-02200 20448 St6galnac4 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 FALSE -0.88 5.17 -5.39 2.03E-03 3.87E-02201 72050 Kdelc1 KDEL (Lys-Asp-Glu-Leu) containing 1 TRUE -1.44 4.82 -5.41 2.05E-03 3.87E-02202 64540 Tspan4 tetraspanin 4 FALSE -1.99 1.68 -5.41 2.05E-03 3.87E-02203 381067 Zfp229 zinc finger protein 229 TRUE -1.99 0.83 -5.38 2.05E-03 3.87E-02204 214575 Tdrd5 tudor domain containing 5 TRUE -1.36 2.39 -5.37 2.06E-03 3.87E-02205 633640 Gm7120 predicted gene 7120 FALSE -1.06 3.90 -5.37 2.06E-03 3.87E-02206 23992 Prkra protein kinase, interferon inducible double stranded RNA dependent activator FALSE -0.85 3.62 -5.37 2.07E-03 3.87E-02207 71323 Rassf8 Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 FALSE -1.95 1.45 -5.36 2.07E-03 3.87E-02208 235041 Kank2 KN motif and ankyrin repeat domains 2 FALSE -2.26 1.80 -5.39 2.09E-03 3.87E-02209 330662 Dock1 dedicator of cytokinesis 1 TRUE -2.61 4.94 -5.39 2.10E-03 3.87E-02210 20856 Stc2 stanniocalcin 2 FALSE -1.04 3.23 -5.35 2.10E-03 3.87E-02211 14686 Gnat2 guanine nucleotide binding protein, alpha transducing 2 FALSE -2.59 -0.32 -5.35 2.10E-03 3.87E-02212 107271 Yars tyrosyl-tRNA synthetase FALSE -0.79 6.97 -5.34 2.12E-03 3.89E-02213 71918 Zcchc24 zinc finger, CCHC domain containing 24 TRUE -0.87 5.12 -5.33 2.14E-03 3.91E-02214 58235 Pvrl1 poliovirus receptor-related 1 FALSE -1.40 3.71 -5.36 2.15E-03 3.91E-02215 73390 Msl3l2 male-specific lethal 3-like 2 (Drosophila) TRUE -0.91 4.22 -5.32 2.15E-03 3.91E-02216 100038735 Gm10384 predicted gene 10384 FALSE -1.56 4.05 -5.35 2.17E-03 3.93E-02217 100043771 Gm10651 predicted pseudogene 10651 FALSE -1.04 3.00 -5.30 2.19E-03 3.93E-02218 14873 Gsto1 glutathione S-transferase omega 1 FALSE -2.77 1.35 -5.33 2.20E-03 3.93E-02219 80889 Mesdc1 mesoderm development candidate 1 TRUE -0.81 5.10 -5.30 2.20E-03 3.93E-02220 56278 Gkap1 G kinase anchoring protein 1 FALSE -2.33 0.04 -5.33 2.20E-03 3.93E-02221 14163 Fgd1 FYVE, RhoGEF and PH domain containing 1 FALSE -1.49 3.18 -5.33 2.20E-03 3.93E-02222 102747 Lrrc49 leucine rich repeat containing 49 TRUE -1.31 1.48 -5.29 2.21E-03 3.93E-02223 72599 Pdia5 protein disulfide isomerase associated 5 FALSE -1.75 1.74 -5.28 2.23E-03 3.94E-02

224 109349 Fam163b family with sequence similarity 163, member B TRUE -3.24 2.09 -5.28 2.30E-03 4.01E-02225 102857 Slc6a8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 FALSE -1.14 2.62 -5.24 2.31E-03 4.01E-02226 99151 Cercam cerebral endothelial cell adhesion molecule FALSE -1.17 2.24 -5.24 2.32E-03 4.01E-02227 26360 Angptl2 angiopoietin-like 2 FALSE -0.66 6.68 -5.24 2.32E-03 4.01E-02228 277396 Klhl23 kelch-like 23 FALSE -1.20 4.78 -5.26 2.35E-03 4.03E-02229 232969 Zfp428 zinc finger protein 428 FALSE -1.20 3.28 -5.22 2.36E-03 4.04E-02230 11658 Alcam activated leukocyte cell adhesion molecule TRUE -1.28 0.78 -5.22 2.36E-03 4.04E-02231 68070 Pdzd2 PDZ domain containing 2 TRUE -1.20 1.10 -5.22 2.37E-03 4.05E-02232 67103 Ptgr1 prostaglandin reductase 1 FALSE -0.68 5.40 -5.21 2.38E-03 4.06E-02233 67054 Paics phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase TRUE -0.86 8.42 -5.24 2.40E-03 4.09E-02234 65963 Tmem176b transmembrane protein 176B FALSE -1.92 1.79 -5.22 2.44E-03 4.10E-02235 67122 Nrarp Notch-regulated ankyrin repeat protein FALSE -1.23 2.05 -5.19 2.44E-03 4.10E-02236 213948 Atg9b autophagy related 9B TRUE -1.28 3.22 -5.19 2.44E-03 4.10E-02237 74682 Wdr35 WD repeat domain 35 FALSE -0.75 4.29 -5.18 2.46E-03 4.12E-02238 224650 Anks1 ankyrin repeat and SAM domain containing 1 TRUE -0.66 6.31 -5.17 2.47E-03 4.12E-02239 58994 Smpd3 sphingomyelin phosphodiesterase 3, neutral FALSE -1.21 2.62 -5.17 2.48E-03 4.13E-02240 244745 Dpy19l1 dpy-19-like 1 (C. elegans) FALSE -0.77 6.00 -5.15 2.51E-03 4.17E-02241 214804 Syde2 synapse defective 1, Rho GTPase, homolog 2 (C. elegans) FALSE -1.04 4.00 -5.15 2.52E-03 4.18E-02242 12972 Cryz crystallin, zeta FALSE -0.96 3.40 -5.12 2.59E-03 4.24E-02243 66674 Spryd7 SPRY domain containing 7 FALSE -1.48 1.62 -5.12 2.60E-03 4.24E-02244 56520 Nme4 NME/NM23 nucleoside diphosphate kinase 4 FALSE -1.15 2.99 -5.10 2.65E-03 4.29E-02245 12571 Cdk6 cyclin-dependent kinase 6 TRUE -1.74 5.28 -5.12 2.67E-03 4.30E-02246 140721 Caskin2 CASK-interacting protein 2 TRUE -0.78 4.21 -5.08 2.68E-03 4.30E-02247 30059 Timm10 translocase of inner mitochondrial membrane 10 FALSE -1.06 3.41 -5.07 2.72E-03 4.34E-02248 17988 Ndrg1 N-myc downstream regulated gene 1 FALSE -1.41 4.71 -5.09 2.75E-03 4.36E-02249 214572 Prmt7 protein arginine N-methyltransferase 7 FALSE -0.86 7.60 -5.06 2.81E-03 4.42E-02250 73668 Ttc21b tetratricopeptide repeat domain 21B TRUE -0.65 5.03 -5.03 2.83E-03 4.43E-02251 54369 Nme6 NME/NM23 nucleoside diphosphate kinase 6 FALSE -0.89 3.33 -5.02 2.85E-03 4.45E-02252 68328 Rab13 RAB13, member RAS oncogene family FALSE -1.86 0.20 -5.01 2.87E-03 4.45E-02253 170828 Vgll1 vestigial like 1 homolog (Drosophila) FALSE -1.40 1.56 -5.04 2.87E-03 4.45E-02254 223666 Arhgap39 Rho GTPase activating protein 39 FALSE -1.01 3.36 -5.01 2.88E-03 4.45E-02255 18769 Pkig protein kinase inhibitor, gamma FALSE -1.06 4.05 -5.00 2.89E-03 4.46E-02256 216856 Nlgn2 neuroligin 2 FALSE -1.28 2.35 -5.03 2.92E-03 4.48E-02257 69101 Ydjc YdjC homolog (bacterial) FALSE -1.62 3.19 -5.01 2.96E-03 4.49E-02258 65962 Slc9a3r2 solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 2 FALSE -2.32 0.79 -5.01 2.97E-03 4.49E-02259 268566 Gphn gephyrin FALSE -0.82 5.44 -4.96 3.01E-03 4.52E-02260 68170 B230118H07Rik RIKEN cDNA B230118H07 gene TRUE -1.10 2.58 -4.95 3.04E-03 4.54E-02261 224170 Dzip3 DAZ interacting protein 3, zinc finger FALSE -0.68 5.43 -4.95 3.04E-03 4.54E-02262 109652 Acy1 aminoacylase 1 FALSE -0.77 3.84 -4.95 3.04E-03 4.54E-02263 71449 Mettl13 methyltransferase like 13 FALSE -1.13 5.11 -4.98 3.06E-03 4.55E-02264 66566 Ntpcr nucleoside-triphosphatase, cancer-related FALSE -0.77 3.63 -4.93 3.09E-03 4.58E-02265 69065 Chac1 ChaC, cation transport regulator 1 FALSE -2.61 -0.20 -4.96 3.10E-03 4.58E-02266 13436 Dnmt3b DNA methyltransferase 3B FALSE -1.09 4.58 -4.96 3.11E-03 4.58E-02267 14020 Evi5 ecotropic viral integration site 5 TRUE -0.78 3.88 -4.93 3.12E-03 4.58E-02268 244216 Zfp771 zinc finger protein 771 FALSE -0.84 3.80 -4.92 3.13E-03 4.59E-02269 20514 Slc1a5 solute carrier family 1 (neutral amino acid transporter), member 5 FALSE -0.65 6.69 -4.91 3.16E-03 4.61E-02270 75416 Nop14 NOP14 nucleolar protein FALSE -0.69 6.37 -4.91 3.17E-03 4.62E-02271 12398 Cbfa2t3 core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human) TRUE -0.69 5.28 -4.90 3.18E-03 4.64E-02272 54651 Usp27x ubiquitin specific peptidase 27, X chromosome TRUE -1.82 0.31 -4.90 3.20E-03 4.64E-02273 227683 Coq4 coenzyme Q4 homolog (yeast) FALSE -1.07 3.54 -4.89 3.24E-03 4.67E-02274 50935 St6galnac6 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 TRUE -0.82 3.91 -4.88 3.26E-03 4.68E-02275 74104 Abcb6 ATP-binding cassette, sub-family B (MDR/TAP), member 6 FALSE -0.81 4.14 -4.87 3.28E-03 4.68E-02276 67442 Retsat retinol saturase (all trans retinol 13,14 reductase) TRUE -1.00 3.81 -4.87 3.29E-03 4.68E-02277 69185 Dtwd1 DTW domain containing 1 TRUE -0.90 3.55 -4.87 3.29E-03 4.68E-02278 73158 Larp1 La ribonucleoprotein domain family, member 1 TRUE -0.78 8.65 -4.88 3.30E-03 4.68E-02279 72535 Aldh1b1 aldehyde dehydrogenase 1 family, member B1 FALSE -2.02 4.79 -4.89 3.30E-03 4.68E-02280 238722 Zfp72 zinc finger protein 72 FALSE -1.37 1.44 -4.86 3.31E-03 4.68E-02281 100039062 Gm2027 predicted gene 2027 FALSE -1.31 2.95 -4.88 3.32E-03 4.68E-02282 14455 Gas5 growth arrest specific 5 TRUE -0.66 7.54 -4.86 3.32E-03 4.68E-02283 74149 Zfp946 zinc finger protein 946 TRUE -0.98 2.45 -4.86 3.32E-03 4.68E-02284 240185 9430020K01Rik RIKEN cDNA 9430020K01 gene FALSE -0.92 4.17 -4.86 3.33E-03 4.68E-02285 70223 Nars asparaginyl-tRNA synthetase FALSE -0.54 7.88 -4.85 3.34E-03 4.68E-02286 27998 Exosc5 exosome component 5 FALSE -0.68 5.65 -4.85 3.35E-03 4.69E-02287 66771 Gid4 GID complex subunit 4, VID24 homolog (S. cerevisiae) FALSE -0.74 6.08 -4.85 3.35E-03 4.69E-02288 67164 Lipt2 lipoyl(octanoyl) transferase 2 (putative) FALSE -1.62 1.43 -4.85 3.35E-03 4.69E-02289 100503380 Snhg4 small nucleolar RNA host gene 4 (non-protein coding) FALSE -0.99 4.31 -4.84 3.41E-03 4.75E-02290 226352 Epb4.1l5 erythrocyte protein band 4.1-like 5 FALSE -1.57 1.74 -4.84 3.47E-03 4.77E-02291 106248 Qtrtd1 queuine tRNA-ribosyltransferase domain containing 1 TRUE -0.78 4.68 -4.80 3.50E-03 4.81E-02292 73192 Xpot exportin, tRNA (nuclear export receptor for tRNAs) FALSE -0.84 6.57 -4.83 3.51E-03 4.81E-02293 15043 H2-T3 histocompatibility 2, T region locus 3 FALSE -1.78 6.95 -4.83 3.51E-03 4.81E-02294 22158 Tulp3 tubby-like protein 3 TRUE -0.64 5.00 -4.80 3.52E-03 4.82E-02295 67533 Ppfibp1 PTPRF interacting protein, binding protein 1 (liprin beta 1) FALSE -1.03 3.33 -4.80 3.53E-03 4.83E-02296 68691 Kansl1l KAT8 regulatory NSL complex subunit 1-like TRUE -0.68 5.64 -4.79 3.57E-03 4.87E-02297 20899 Stra8 stimulated by retinoic acid gene 8 FALSE -1.84 0.64 -4.78 3.58E-03 4.87E-02298 56397 Morf4l2 mortality factor 4 like 2 TRUE -0.72 7.09 -4.78 3.60E-03 4.89E-02299 99543 Olfml3 olfactomedin-like 3 FALSE -1.57 4.66 -4.78 3.70E-03 4.98E-02