A Single Amino Acid Substitution in HIV-1 Reverse Transcriptase

1

A Single Amino Acid Substitution in HIV-1 Reverse Transcriptase Significantly 1

Reduces Virion Release 2

3

Chien-Cheng Chiang, Shiu-Mei Wang, Yen-Yu Pan, Kuo-Jung Huang and Chin-Tien 4

Wang* 5

6

Department of Medical Research and Education, Taipei Veterans General Hospital; 7

Institute of Clinical Medicine, National Yang-Ming University School of Medicine, 8

Taipei, Taiwan 9

10

11

12

13

14

15

Running title: HIV-1 RT mutation reduces virion release 16

17

18

19

20

There are a total 231 words in the Abstract and 2882 in the main Text. 21

22

23

24

25

26

*Corresponding author 27

Mailing address 28

Department of Medical Research and Education 29

Taipei Veterans General Hospital 30

201, Sec. 2, Shih-Pai Road 31

Taipei 11217 32

Taiwan 33

E-mail: [email protected] 34

Phone: 886-2-28712121 ext.2655 35

Fax: 886-2-28742279 36

37

38

Copyright © 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Virol. doi:10.1128/JVI.01532-09 JVI Accepts, published online ahead of print on 4 November 2009

on February 9, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

2

ABSTRACT 1

HIV-1 protease (PR) mediates the proteolytic processing of virus particles during or 2

after virus budding. PR activation is thought to be triggered by appropriate 3

Gag-Pol/Gag-Pol interaction; factors affecting this interaction either enhance or 4

reduce PR-mediated cleavage efficiency, resulting in markedly reduced virion 5

production or the release of inadequately processed virions. We previously showed 6

that a Gag-Pol deletion mutation involving the reverse transcriptase tryptophan (Trp) 7

repeat motif markedly impairs PR-mediated virus maturation, and that an alanine 8

substitution at W401 (W401A) or at both W401 and W402 (W401A/W402A) partially 9

or almost completely negates the enhancement effect of efavirenz (a non-nucleoside 10

reverse transcriptase inhibitor) on PR-mediated virus processing efficiency. These 11

data suggest that the Trp repeat motif may contribute to the PR activation process. 12

Here we demonstrate that due to enhanced Gag cleavage efficiency, W402 alanine or 13

leucine substitution significantly reduces virus production. However, W402 14

replacement with phenylalanine does not significantly affect virus particle assembly 15

or processing, but it does markedly impair viral infectivity in a single-cycle infection 16

assay. Our results demonstrate that a single amino acid substitution at HIV-1 RT can 17

radically affect virus assembly by enhancing Gag cleavage efficiency, suggesting that 18

in addition to contributing to RT biological function during the early stages of virus 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

3

replication, the HIV-1 RT tryptophan repeat motif in a Gag-Pol context may play an 1

important role in suppressing the premature activation of PR during late-stage virus 2

replication. 3

INTRODUCTION 4

In the late stage of human immunodeficiency virus type 1 (HIV-1) replication, 5

thousands of viral capsid precursor (Pr55gag

) molecules assemble into virus particles 6

and bud out from the plasma membrane (42). During or soon after virus budding, 7

Pr55gag

is cleaved by viral protease (PR) into four major products: matrix (MA; p17), 8

capsid (CA; p24), nucleocapsid (NC; p7), and the C-terminal p6 domain (42). PR is 9

encoded by pol, which is initially translated as the polyprotein precursor Pr160gag-pol

. 10

It is generally believed that Pr160gag-pol

is incorporated into assembling virions via 11

interaction with Pr55gag

through its N-terminal gag determinants (10, 11, 19, 22, 40, 12

41). However, some researchers have demonstrated that HIV-1 and murine leukemia 13

virus (MLV) Pol can be packaged into virions at reasonable efficiency despite an 14

absence of Gag-Pol formation (3, 7). The proteolytic processing of Pr160gag-pol

gives 15

rise to PR, reverse transcriptase (RT), and integrase (IN) in addition to Gag cleavage 16

products. Blocking PR activity does not significantly affect virus particle assembly 17

and release, but it does eliminate viral infectivity (17, 27, 36). 18

The reading frame of HIV-1 pol partially overlaps that of gag. During Gag 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

4

translation, a -1 ribosomal frame shift event occurs at a frequency of 5%, resulting in 1

an approximately 1:20 expression level of Pr160gag-pol

to Pr55gag

(24). An artificial 2

overexpression of Pr160gag-pol

or PR-containing chimeric proteins results in a 3

significant reduction in virion release, presumably due to the premature cleavage of 4

Pr55gag

as mediated by PR (1, 20, 28, 35, 38, 39, 48). Accordingly, both PR 5

expression level and PR activation timing with respect to the proteolytic processing of 6

Gag and Gag-Pol are critical to virus assembly. The molecular mechanism behind PR 7

activation is not entirely clear. It is generally accepted that Pr160gag-pol

dimerization or 8

multimerization triggers PR activation, therefore sequences upstream or downstream 9

of PR may affect PR-mediated virus maturation by interfering with Gag-Pol 10

multimerization. Consistent with this suggestion, deletions of sequences upstream of 11

PR (11, 52) or mutations in downstream pol sequences can significantly affect 12

PR-directed virus particle maturation (4, 30, 37). 13

Biologically active RT is assumed to be present in the form of p66/p51 14

heterodimer (12, 31). A hydrophobic cluster consisting of six tryptophan (Trp) 15

residues has been identified in the connection subdomain of the HIV-1 RT subunit 16

(codons 398-414). This Trp repeat motif is highly conserved among primate lentiviral 17

reverse transcriptases (2). It has been shown that substitution mutations of HIV-1 RT 18

Trp repeat motif residues can markedly impair RT dimerization in vitro (33, 44), 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

5

suggesting a motif role in RT-RT interactions. Although the extent to which the RT 1

domain contributes to Gag-Pol multimerization is unknown, some data support the 2

idea that the RT sequence (the Trp repeat motif in particular) may affect PR activation 3

by favoring Gag-Pol multimerization. First, RT truncation mutations involving the Trp 4

repeat motif significantly impair PR-mediated Gag processing (30). Second, efavirenz 5

(EFV)—a non-nucleoside reverse transcriptase inhibitor (NNRTI) that greatly 6

enhances HIV-1 RT-dimerization in vitro (46, 47)—is capable of suppressing virion 7

production by enhancing the efficiency of PR-mediated Gag and Gag-Pol cleavage 8

(14, 45). However, a W401A alanine substitution mutation that abrogates RT 9

dimerization in vitro (49) almost completely negates the EFV inhibitory effect on 10

virion production (9). The lack of W401A susceptibility to this inhibitory effect is 11

most likely due to a defect in Gag-Pol/Gag-Pol interaction that impedes the EFV 12

enhancement of Gag-Pol multimerization, and consequently nullifies the EFV 13

enhancement of Gag processing. 14

Based on our previous finding that a W401A-imposed lack of susceptibility to 15

the EFV enhancement effect on Gag processing is partially mitigated by an additional 16

W402 alanine substitution, the W402 mutation may affect the Gag-Pol 17

multimerization required for effective PR activation (9). Here we demonstrate that an 18

alanine or leucine substitution of W402 results in enhanced Gag processing efficiency, 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

6

which is associated with a dramatic reduction in released virion level. 1

MATERIALS AND METHODS 2

Plasmid construction. The parental HIV-1 proviral plasmid used in this study 3

was derived from HXB2. RT mutations were generated by PCR-based overlap 4

extension mutagenesis using HIVgpt as a template. RT mutants W401A and 5

W401A/W402A were as described previously (9). Primers (forward) for engineering 6

W402A, W402L, and W402F mutations were 7

5’-GAAACATGGGAAACCTGGGCCACAGAGTAT-3’, 5’ 8

GAAACATGGGAAACATGGTTAACAGAGTAT 3’, and 5’- 9

GAAACATGGGAAACATGGTTCACCGAGTAT 3’, respectively. The reverse 10

primer was 5’-GAAATTGGATCCATTGGCAGTATGTATTG-3’. Resulting 11

amplicons served as primers for a second PCR round using either the forward primers 12

5’-AATGATGCAGAGAGGCAAT-3’ or 5’-GGATTAGATATCAGTACAATG-3, or 13

the reverse primer 5’-GAAATTGGATCCATTGGCAGTATGTATTG-3’. Amplified 14

DNA fragments were digested with a combination of EcoRV and BsrGI and ligated 15

into HIVgpt. The following constructs have all been described in detail in previous 16

reports: HIV-1 RT mutants (W401A, W401A/W402A) (9); Pol-truncated mutants 17

containing inserted stop codons at the designated IN or RT residue positions (RN198, 18

R560, R515, R425); plasmids expressing RT subunits p66 and p51 containing HA 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

7

tags at the N-terminus (9, 29, 30); and the HIV-1 PR-inactivated mutant HIVgpt D25 1

(11, 48). 2

Cell culture, transfection, and infection. 293T cells and HeLa cells were 3

maintained in DMEM supplemented with 10% fetal calf serum. Confluent 293T cells 4

were trypsinized, split 1:10, and seeded onto 10 cm dish plates 24 h before 5

transfection. For each construct, 293T cells were transfected with 20 µg of plasmid 6

DNA by the calcium phosphate precipitation method; 50 µm chloroquine was added 7

to enhance transfection efficiency. For infection, 10 µg of wt or mutant HIVgpt were 8

cotransfected with 5 µg of the VSV-G protein expression vector pHCMV-G (5). HeLa 9

cell infection and drug-resistant colony selection were performed as previously 10

described (8). Numbers of drug-resistant colonies were converted into titers (cfu/ml). 11

Infectivity was expressed as the ratio of the mutant titer to wt titer in parallel 12

experiments. 13

Western immunoblot analysis. Culture medium from transfected 293T cells 14

was filtered through 0.45 µm pore-size filters, followed by centrifugation through 2 15

ml of 20% sucrose in TSE (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA) 16

containing 0.1 mM phenylmethylsulfonyl fluoride (PMSF) at 4°C for 40 min at 17

274,000 × g (SW41 rotor at 40,000 rpm). Viral pellets and cell lysates mixed with 18

sample buffer were subjected to SDS-10% PAGE followed by immunoblotting 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

8

analysis as previously described (9). HIV Gag protein detection was performed using 1

an anti-p24gag

(mouse hybridoma clone 183-H12-5C) monoclonal antibody. Cellular 2

β-actin was detected using a mouse anti-β-actin monoclonal antibody (Sigma). 3

Primary antibodies for HIV-1 RT or HA-tagged RT detection were rabbit antiserum, 4

mouse anti-RT (13, 21), or anti-HA (Sigma). Rabbit antiserum served as the primary 5

antibody for HIV-1 IN detection (18); the secondary antibody was either a rabbit 6

anti-mouse or donkey anti-rabbit (HRP)-conjugated antibody. Manufacturer’s 7

protocols were followed for HRP activity detection (PerkinElmer). 8

In vitro RT assay. The procedure used for this study has been described 9

previously (11). Briefly, transfected 293T cell culture supernatant was harvested, 10

filtered, and pelleted as described for our Western immunoblot analysis. After serially 11

diluting viral pellets suspended in TSE, 10 µl of diluted sample was mixed with 40 µl 12

of reaction cocktail (11). Reaction mixtures were precipitated with ice-cold 10% 13

trichloroacetic acid and filtered through CF/C filters. After washing and drying, RT 14

activity was determined using a Beckman scintillation counter. 15

Coimmunoprecipitation assay. 293T cells transfected with HA-tagged and/or 16

Myc-tagged p66RT expression vector were collected and subjected to 17

immunoprecipitation analysis as previously described (9). 18

Immunoprecipitate-associated agarose beads were pelleted, washed tree times with 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

9

RIPA buffer, washed two times with PBS, eluted with 1X sample buffer with 5% 1

β-mercaptoethanol, boiled for 5 min, and subjected to SDS-10% PAGE as described 2

above. 3

RESULTS AND DISCUSSION 4

The W402A mutant is severely assembly-defective and can trans-dominantly 5

inhibit virion production 6

To determine whether an alanine substitution of RT codon W402 results in a 7

phenotype that differs from those resulting from the alanine substitution mutations 8

W401A and W401A/W402A, a constructed W402A mutant and the two other alanine 9

substitution mutants were transiently expressed in 293T cells and analyzed by Western 10

immunoblotting. To our surprise, the W402A transfectants expressed readily 11

detectable Gag but produced barely detectable virus-associated Gag, suggesting a 12

severe defect in virus assembly or release (Fig. 1A, lane 4; Fig. 1B). Similar results 13

were observed across several repeat independent experiments. In contrast, both 14

W401A and W401A/W402A transfectants produced virus particles at approximately 15

wt level and displayed partially degraded or barely detectable virus-associated RT 16

(Fig. 1A, lanes 3 and 5), which is consistent with previously reported results (9, 49). 17

Intracellular Gag and RT were readily detected for the W402A mutant, indicating that 18

it had no major impact on Gag and Gag-Pol expression. Notably, the W402A mutant 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

10

showed a relatively low cellular Pr55gag

/p24gag

ratio compared to wt and other 1

mutants (Fig. 1A upper panel, lanes 7-10), implying that the W402A-associated virion 2

production defect may be due to enhanced Pr55gag

cleavage efficiency. 3

To test whether the W402A mutant can affect virion production by wt or 4

assembly-competent mutants in trans, we co-expressed it with wt, W401A/W402A, or 5

an HIV-1 protease-defective (PR-) mutant and observed that virus-associated p24

gag 6

was readily detected when PR- was co-expressed with the W402A mutant (Fig. 1C, 7

lane 7 vs. lanes 8-9). Virus yields from the wt or mutants were significantly reduced 8

by the W402A mutant in a dose-dependent manner (Fig. 1C, upper panel), with a 9

noticeable decrease in the cellular Pr55gag

/p24gag

ratio (Fig. 1C, lower panel). These 10

data suggest that the W402A mutant can provide functional PR to mediate Gag 11

cleavage in trans, and provide support for the assumption that the W402A-incurred 12

virion assembly defect is primarily due to enhanced Gag cleavage efficiency. 13

W402A virus assembly defect is PR-activity dependent 14

To determine if the W402A virus assembly defect is directly associated with viral 15

protease activity, we treated W402A transfectants with a HIV-1 PR inhibitor (PI). As 16

expected, virus-associated W402A Gag (Pr55gag

, p41gag

, and mature p24gag

) and 17

pol-derived products (IN, RT subunits p66/p51, and RT-associated precursors such as 18

Pr160gag-pol

) that were previously undetectable or barely detectable became readily 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

11

detectable when PI concentrations were gradually increased (Fig. 2, lanes 5-8). 1

Similar results were observed in repeat independent experiments. These data support 2

the assumption that the W402A virus assembly defect is dependent on PR-activity. 3

Additional verification is the observation that the introduction of a PR-defective 4

mutation (PR-) into W402A restored virus production to a level comparable to that of 5

the PR- mutant, with expressed Pr55

gag and Pr160

gag-pol levels comparable to that of 6

the PR- mutant (data not shown). 7

We then tested the idea that W402 replacement with another amino acid residue 8

(in this case, Leu or Phe) can produce a phenotype similar to that of W402A. The 9

resulting mutants (designated W402L and W402F) were transiently expressed in 293T 10

cells. We also determined that the W402L mutant phenotype was similar to that of 11

W402A, with virus-associated Gag and RT barely detectable in transfectant 12

supernatant samples (Figs. 3A and 3B, lanes 3 and 4). Similar to W402A, the effect of 13

a HIV-1 PR inhibitor on PR activity resulted in substantial amounts of 14

virus-associated Gag and Gag-Pol being released from W402L transfectants (data not 15

shown). 16

In contrast, the W402F mutant exhibited a Gag processing profile similar to that 17

of wt, and a virus-associated Gag level comparable to that of wt (Fig. 3B, lane 5). 18

This suggests that an aromatic residue at RT codon 402 plays an important role in 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

12

preventing premature Gag cleavage. We found that both W402A and W402L mutants 1

(hereafter referred to as W402A/L) had relatively low levels of cellular Gag, 2

presumably due (at least in part) to enhanced proteolysis mediated by PR. In addition, 3

we consistently noted that the p24gag

/Pr55gag

ratios of W402A/L mutants were 4

significantly higher than those displayed by wt and W402F (Fig. 3D), thus supporting 5

our proposal that the W402A /L mutations triggered enhanced PR-mediated Gag 6

cleavage. Reduced virion release as a result of PR-mediated Gag cleavage has also 7

been observed in HIV-1 NC-deletion mutants, in which the slower NC mutant 8

assembly process allows PR to cleave Gag molecules prior to virion assembly and 9

budding (34). Additional experiments using a reticulocyte translation system may help 10

clarify the molecular mechanism behind premature PR activation in our RT mutants 11

(28). 12

Past studies have confirmed that most amino acid substitution mutations in RT 13

do not significantly impact PR-mediated Gag cleavage, regardless of whether or not 14

they affect RT dimerization. Substitution mutations at the RT primer grip residues 15

L234, W239 and W229 (6, 16, 25, 43, 50) or at the tryptophan repeat motif residues 16

W401 and W414 (44) that abrogate RT dimerization in vitro are not associated with 17

impaired Gag processing and/or virion production, even though the L234D and 18

W239A mutants are both deficient in virus-associated RT—presumably due (at least 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

13

in part) to premature Gag-Pol cleavage (25, 49, 51). Furthermore, substitution 1

mutations at HIV-1 RT G191 that are capable of facilitating RT dimerization in vitro 2

(15) have no significant impact on virus particle assembly and release (23). It is 3

therefore very surprising to find that the W402A/L mutation enhances Gag cleavage 4

efficiency and dramatically reduces virion production. According to Tachedjian et al., 5

leucine substitutions in the conserved Trp repeat motif residues W398, W402, Y405, 6

and W410 have no significant effect on RT dimerization (yeast two-hybrid system and 7

in vitro binding assays) (44). The results of our co-immunoprecipitation experiments 8

suggest that the W402A mutation does not significantly affect p66RT self-interaction 9

(data not shown). Further work is required to determine if substitution mutations at 10

W398, Y405, or W410 result in a phenotype similar to that of the W402A/L mutation. 11

Mutations at W402 significantly impair viral infectivity 12

Although W402F had a virus-associated p66/51RT level comparable to that of wt 13

and exhibited in vitro RT polymerase activity at a level near that of wt (Fig. 4), 14

according to results from a single cycle infection assay its infectivity was reduced 15

five-fold compared to that of wt (Table 1). This suggests that the W402F mutation 16

significantly impairs RT biological function during viral replication, even though it 17

does not exert any major effects on RT polymerase activity in vitro. In contrast, the 18

very low levels of RT activity demonstrated by W401A, W402A, and W402L are 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

14

compatible with their severely impaired infectivity. The relatively low level of 1

virus-associated RT activity for W402A/L may be due in part to a Gag-Pol package 2

defect as a result of premature Gag-Pol cleavage by PR. Consistent with this idea, 3

relatively lower levels of p66/51RT subunits were found in W402A virions compared 4

to wt virions when PR activity was partially inhibited (Fig. 2, lanes 6 vs. 2). 5

W402A mutation significantly impairs Gag processing following a deletion in the 6

RNase H subdomain 7

Given that the W402A enhancement effect on Gag processing is mediated by 8

influencing Gag-Pol/Gag-Pol interaction, additional C-terminal deletions in the pol 9

sequence may incur a conformational Gag-Pol change and disrupt Gag-Pol/Gag-Pol 10

interaction, thereby mitigating the W402A enhancement effect on Gag processing. We 11

found that virion production for the assembly-competent Gag-Pol truncated mutants 12

RN198, R560, R515, and R425 (Figs. 5A and 5B, lanes 1-5) (30) was markedly 13

reduced following the introduction of the W402A mutation (Fig. 5B, lanes 6-10). The 14

one exception was R515/W402A (lane 9), which demonstrated readily detectable 15

virus-associated Gag. Pr55gag

and p41gag

were identified as major species in both 16

supernatant and cell samples (lanes 4 vs. 9). Our finding of impaired Gag cleavage 17

accompanied by improved virus production is consistent with our hypothesis that the 18

inhibitory effect of W402A on virion production is primarily due to enhanced Gag 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

15

cleavage efficiency. The virus assembly defect characteristic of RN198/W402A, 1

R560/W402A, and R425/W402A is also dependent on PR activity, since 2

virus-associated Gag and Gag-Pol become readily detectable in supernatant following 3

treatment with a PR inhibitor (data not shown). 4

The W402A/L mutation may exert its virus-assembly inhibitory effect in a 5

fashion similar to that following EFV treatment (14)—that is, by triggering premature 6

PR activity via Gag-Pol multimerization enhancement. However, at this point it is 7

difficult to determine whether EFV or the W402A/L mutation enhance Gag-Pol 8

multimerization efficiency, given that Gag-Pol multimerization largely depends on the 9

N-terminal Gag domain, and that most RT deletion mutations have no detectable 10

effects on Gag-Pol multimerization (30). Together, the observations that (a) EFV 11

significantly reduced R515 virion production by enhancing Gag processing (data not 12

shown) and (b) the W402A mutation markedly impaired R515 Gag processing (Fig. 5) 13

suggest that W402A triggers PR activation in a manner that is similar but not identical 14

to that of EFV. It appears that the maintenance of appropriate Gag-Pol conformation is 15

critical to the ability of W402A to trigger premature PR activation. 16

The roles of tryptophan and proline residues in protein-protein interactions have 17

been well documented (26, 32). It is speculated that the large hydrophobic residue Trp 18

(especially its aromatic side chain) may play a stabilizing role in Gag-Pol 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

16

conformation and thus prevent accelerated Gag-Pol multimerization. Gag-Pol 1

conformation instability as incurred by W402A/L may propel or accelerate Gag-Pol 2

multimerization, resulting in premature PR activation. This may explain, at least in 3

part, why substituting W402 with Phe (which also contains an aromatic side chain) 4

has no measurable effect on virus processing and assembly. 5

In conclusion, our results indicate that the HIV-1 RT W402 codon in the Gag-Pol 6

context may play a crucial role in preventing PR from premature activation by 7

stabilizing Gag-Pol conformation during Gag-Pol/Gag-Pol interaction. A logical next 8

step is to test whether the inhibition of virion production by a single amino acid 9

substitution in the Trp repeat motif residue is also applicable to other primate 10

lentiviruses. Our results point to a potential HIV-1 RT Trp repeat motif target in 11

HIV/AIDS therapeutic interventions. 12

ACKNOWLEDGMENTS 13

The authors wish thank the following from the National Institutes of Health AIDS 14

Research and Reference Reagent Program for their assistance in obtaining the 15

following reagents: anti-RT monoclonal antibody (MAb21) (Stephen Hughes); 16

antiserum to HIV-1 RT (Stuart Le Grice); and antiserum to HIV-1 IN (Duane 17

Grandgenett). This work was supported by grant NSC95-2320-B-010-041-MY2 18

from the National Science Council, Taiwan, Republic of China. 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

17

1

REFERENCES 2

1. Arrigo, S. J., and K. Huffman. 1995. Potent inhibition of human 3

immunodeficiency virus type 1 (HIV-1) replication by inducible expression of 4

HIV-1 PR multimers. J. Virol. 69:5988-5994. 5

2. Baillon, J. G., N. T. Nashed, A. Kumar, S. H. Wilson, and D. M. Jerina. 6

1991. A leucine zipper-like motif may mediate HIV reverse transcriptase 7

subunit binding. New Biol. 3:1015-1019. 8

3. Buchschacher, G. L., Jr., L. Yu, F. Murai, T. Friedmann, and A. 9

Miyanohara. 1999. Association of Murine Leukemia Virus Pol with Virions, 10

Independent of Gag-Pol Expression. J. Virol. 73:9632-9637. 11

4. Bukovsky, A., and H. Gottlinger. 1996. Lack of integrase can markedly affect 12

human immunodeficiency virus type 1 particle production in the presence of an 13

active viral protease. J. Virol. 70:6820-6825. 14

5. Burns, J. C., T. Friedmann, W. Driever, M. Burrascano, and J. Yee. 1993. 15

Vesicular Stomatitis Virus G Glycoprotein Pseudotyped Retroviral Vectors: 16

Concentration to Very High Titer and Efficient Gene Transfer into Mammalian 17

and Nonmammalian Cells. Proceedings of the National Academy of Sciences 18

90:8033-8037. 19

6. Buxton, P., G. Tachedjian, and J. Mak. 2005. Analysis of the Contribution of 20

Reverse Transcriptase and Integrase Proteins to Retroviral RNA Dimer 21

Conformation. J. Virol. 79:6338-6348. 22

7. Cen, S., M. Niu, J. Saadatmand, F. Guo, Y. Huang, G. J. Nabel, and L. 23

Kleiman. 2004. Incorporation of Pol into Human Immunodeficiency Virus 24

Type 1 Gag Virus-Like Particles Occurs Independently of the Upstream Gag 25

Domain in Gag-Pol. J. Virol. 78:1042-1049. 26

8. Chen, Y. L., P. W. Ts'ai, C. C. Yang, and C. T. Wang. 1997. Generation of 27

infectious virus particles by transient co-expression of human 28

immunodeficiency virus type 1 gag mutants. J Gen Virol 78:2497-2501. 29

9. Chiang, C.-C., S.-M. Wang, Y.-T. Tseng, K.-J. Huang, and C.-T. Wang. 30

2009. Mutations at human immunodeficiency virus type 1 reverse transcriptase 31

tryptophan repeat motif attenuate the inhibitory effect of efavirenz on virus 32

production. Virology 383:261-270. 33

10. Chien, A. I., W. H. Liao, D. M. Yang, and C. T. Wang. 2006. A domain 34

directly C-terminal to the major homology region of human immunodeficiency 35

type 1 capsid protein plays a crucial role in directing both virus assembly and 36


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

18

incorporation of Gag-Pol. Virology 348:84-95. 1

11. Chiu, H. C., S. Y. Yao, and C. T. Wang. 2002. Coding sequences upstream of 2

the human immunodeficiency virus type 1 reverse transcriptase domain in 3

Gag-Pol are not essential for incorporation of the Pr160(gag-pol) into virus 4

particles. J Virol 76:3221-31. 5

12. di Marzo Veronese, F., T. D. Copeland, A. L. DeVico, R. Rahman, S. 6

Oroszlan, R. C. Gallo, and M. G. Sarngadharan. 1986. Characterization of 7

highly immunogenic p66/p51 as the reverse transcriptase of HTLV-III/LAV. 8

Science 231:1289-1291. 9

13. Ferris, A. L., A. Hizi, S. D. Showalter, S. Pichuantes, L. Babe, C. S. Craik, 10

and S. H. Hughes. 1990. Immunologic and proteolytic analysis of HIV-1 11

reverse transcriptase structure. Virology 175:456-464. 12

14. Figueiredo, A., K. L. Moore, J. Mak, N. Sluis-Cremer, M.-P. de Bethune, 13

and G. Tachedjian. 2006. Potent Nonnucleoside Reverse Transcriptase 14

Inhibitors Target HIV-1 Gag-Pol. PLoS Pathogens 2:e119. 15

15. Figueiredo, A., S. Zelina, N. Sluis-Cremer, and G. Tachedjian. 2008. Impact 16

of Residues in the Nonnucleoside Reverse Transcriptase Inhibitor Binding 17

Pocket on HIV-1 Reverse Transcriptase Heterodimer Stability Current HIV 18

Research 6:130-137. 19

16. Ghosh, M., P. S. Jacques, D. W. Rodgers, M. Ottman, J. L. Darlix, and S. F. 20

J. Le Grice. 1996. Alterations to the Primer Grip of p66 HIV-1 Reverse 21

Transcriptase and Their Consequences for Template-Primer Utilization. 22

Biochemistry 35:8553-8562. 23

17. Gottlinger, H. G., J. G. Sodroski, and W. A. Haseltine. 1989. Role of capsid 24

precursor processing and myristoylation in morphogenesis and infectivity of 25

human immunodeficiency virus type 1. Proceedings of the National Academy 26

of Sciences of the United States of America 86:5781-5785. 27

18. Grandgenett, D. P., and G. Goodarzi. 1994. Folding of the multidomain 28

human immunodeficiency virus type-I integrase. Protein Sci 3:888-897. 29

19. Halwani, R., A. Khorchid, S. Cen, and L. Kleiman. 2003. Rapid Localization 30

of Gag/GagPol Complexes to Detergent-Resistant Membrane during the 31

Assembly of Human Immunodeficiency Virus Type 1. J. Virol. 77:3973-3984. 32

20. Hill, M. K., C. W. Hooker, D. Harrich, S. M. Crowe, and J. Mak. 2001. 33

Gag-Pol Supplied in trans Is Efficiently Packaged and Supports Viral Function 34

in Human Immunodeficiency Virus Type 1. J. Virol. 75:6835-6840. 35

21. Hizi, A., C. McGill, and S. H. Hughes. 1988. Expression of Soluble, 36

Enzymatically Active, Human Immunodeficiency Virus Reverse Transcriptase 37

in Escherichia coli and Analysis of Mutants. Proceedings of the National 38


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

19

Academy of Sciences 85:1218-1222. 1

22. Huang, M., and M. A. Martin. 1997. Incorporation of Pr160(gag-pol) into 2

virus particles requires the presence of both the major homology region and 3

adjacent C-terminal capsid sequences within the Gag-Pol polyprotein. J. Virol. 4

71:4472-4478. 5

23. Huang, W., A. Gamarnik, K. Limoli, C. J. Petropoulos, and J. M. 6

Whitcomb. 2003. Amino Acid Substitutions at Position 190 of Human 7

Immunodeficiency Virus Type 1 Reverse Transcriptase Increase Susceptibility 8

to Delavirdine and Impair Virus Replication. J. Virol. 77:1512-1523. 9

24. Jacks, T., M. D. Power, F. R. Masiarz, P. A. Luciw, P. J. Barr, and H. E. 10

Varmus. 1988. Characterization of ribosomal frameshifting in HIV-1 gag-pol 11

expression. Nature 331:280-283. 12

25. Jacques, P. S., B. M. Wohrl, M. Ottmann, J. L. Darlix, and S. F. Le Grice. 13

1994. Mutating the "primer grip" of p66 HIV-1 reverse transcriptase implicates 14

tryptophan-229 in template-primer utilization. J. Biol. Chem. 15

269:26472-26478. 16

26. KAY, B. K., M. P. WILLIAMSON, and M. SUDOL. 2000. The importance 17

of being proline: the interaction of proline-rich motifs in signaling proteins with 18

their cognate domains. FASEB J. 14:231-241. 19

27. Kohl, N. E., E. A. Emini, W. A. Schleif, L. J. Davis, J. C. Heimbach, R. A. 20

Dixon, E. M. Scolnick, and I. S. Sigal. 1988. Active human immunodeficiency 21

virus protease is required for viral infectivity. Proceedings of the National 22

Academy of Sciences of the United States of America 85:4686-4690. 23

28. Krausslich, H. 1991. Human Immunodeficiency Virus Proteinase Dimer as 24

Component of the Viral Polyprotein Prevents Particle Assembly and Viral 25

Infectivity. Proceedings of the National Academy of Sciences 88:3213-3217. 26

29. Liao, W.-H., K.-J. Huang, Y.-F. Chang, S.-M. Wang, Y.-T. Tseng, C.-C. 27

Chiang, J.-J. Wang, and C.-T. Wang. 2007. Incorporation of Human 28

Immunodeficiency Virus Type 1 Reverse Transcriptase into Virus-Like 29

Particles. J. Virol. 81:5155-5165. 30

30. Liao, W.-H., and C.-T. Wang. 2004. Characterization of human 31

immunodeficiency virus type 1 Pr160gag-pol mutants with truncations 32

downstream of the protease domain. Virology 329:180-188. 33

31. Lightfoote, M. M., J. E. Coligan, T. M. Folks, A. S. Fauci, M. A. Martin, 34

and S. Venkatesan. 1986. Structural characterization of reverse transcriptase 35

and endonuclease polypeptides of the acquired immunodeficiency syndrome 36

retrovirus. J. Virol. 60:771-775. 37

32. Ma, B., T. Elkayam, H. Wolfson, and R. Nussinov. 2003. Protein-protein 38


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

20

interactions: Structurally conserved residues distinguish between binding sites 1

and exposed protein surfaces. Proceedings of the National Academy of Sciences 2

of the United States of America 100:5772-5777. 3

33. Mulky, A., S. G. Sarafianos, Y. Jia, E. Arnold, and J. C. Kappes. 2005. 4

Identification of Amino Acid Residues in the Human Immunodeficiency Virus 5

Type-1 Reverse Transcriptase Tryptophan-repeat Motif that are Required for 6

Subunit Interaction Using Infectious Virions. Journal of Molecular Biology 7

349:673-684. 8

34. Ott, D. E., L. V. Coren, and T. Shatzer. 2009. The Nucleocapsid Region of 9

Human Immunodeficiency Virus Type 1 Gag Assists in the Coordination of 10

Assembly and Gag Processing: Role for RNA-Gag Binding in the Early Stages 11

of Assembly. J. Virol. 83:7718-7727. 12

35. Park, J., and C. D. Morrow. 1991. Overexpression of the gag-pol precursor 13

from human immunodeficiency virus type 1 proviral genomes results in 14

efficient proteolytic processing in the absence of virion production. J. Virol. 15

65:5111-5117. 16

36. Peng, C., B. K. Ho, T. W. Chang, and N. T. Chang. 1989. Role of human 17

immunodeficiency virus type 1-specific protease in core protein maturation and 18

viral infectivity. J. Virol. 63:2550-2556. 19

37. Quillent, C., A. M. Borman, S. Paulous, C. Dauguet, and F. Clavel. 1996. 20

Extensive Regions of pol Are Required for Efficient Human Immunodeficiency 21

Virus Polyprotein Processing and Particle Maturation. Virology 219:29-36. 22

38. Rose, J. R., L. M. Babe, and C. S. Craik. 1995. Defining the level of human 23

immunodeficiency virus type 1 (HIV-1) protease activity required for HIV-1 24

particle maturation and infectivity. J Virol 69:2751-8. 25

39. Shehu-Xhilaga, M., S. M. Crowe, and J. Mak. 2001. Maintenance of the 26

Gag/Gag-Pol Ratio Is Important for Human Immunodeficiency Virus Type 1 27

RNA Dimerization and Viral Infectivity. J. Virol. 75:1834-1841. 28

40. Smith, A. J., N. Srinivasakumar, M. L. Hammarskjold, and D. Rekosh. 29

1993. Requirements for incorporation of Pr160gag-pol from human 30

immunodeficiency virus type 1 into virus-like particles. J. Virol. 67:2266-2275. 31

41. Srinivasakumar, N., M. L. Hammarskjold, and D. Rekosh. 1995. 32

Characterization of deletion mutations in the capsid region of human 33

immunodeficiency virus type 1 that affect particle formation and Gag- Pol 34

precursor incorporation. J. Virol. 69:6106-6114. 35

42. Swanstrom, R., and J. Wills. 1997. Synthesis, assembly and processing of 36

viral proteins, p. 263-334. In J. Coffin, S. Hughes, and H. Varmus (ed.), 37

Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 38


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

21

43. Tachedjian, G., H.-E. G. Aronson, and S. P. Goff. 2000. Analysis of mutations 1

and suppressors affecting interactions between the subunits of the HIV type 1 2

reverse transcriptase. Proceedings of the National Academy of Sciences of the 3

United States of America 97:6334-6339. 4

44. Tachedjian, G., H.-E. G. Aronson, M. d. l. Santos, J. Seehra, J. M. McCoy, 5

and S. P. Goff. 2003. Role of Residues in the Tryptophan Repeat Motif for 6

HIV-1 Reverse Transcriptase Dimerization. Journal of Molecular Biology 7

326:381-396. 8

45. Tachedjian, G., K. L. Moore, S. P. Goff, and N. Sluis-Cremer. 2005. 9

Efavirenz enhances the proteolytic processing of an HIV-1 pol polyprotein 10

precursor and reverse transcriptase homodimer formation. FEBS Letters 11

579:379-384. 12

46. Tachedjian, G., M. Orlova, S. G. Sarafianos, E. Arnold, and S. P. Goff. 2001. 13

Nonnucleoside reverse transcriptase inhibitors are chemical enhancers of 14

dimerization of the HIV type 1 reverse transcriptase. Proc Natl Acad Sci U S A 15

98:7188-93. 16

47. Venezia, C. F., K. J. Howard, M. E. Ignatov, L. A. Holladay, and M. D. 17

Barkley. 2006. Effects of Efavirenz Binding on the Subunit Equilibria of HIV-1 18

Reverse Transcriptase. Biochemistry 45:2779-2789. 19

48. Wang, C.-T., Y.-C. Chou, and C.-C. Chiang. 2000. Assembly and Processing 20

of Human Immunodeficiency Virus Gag Mutants Containing a Partial 21

Replacement of the Matrix Domain by the Viral Protease Domain. J. Virol. 22

74:3418-3422. 23

49. Wapling, J., K. L. Moore, S. Sonza, J. Mak, and G. Tachedjian. 2005. 24

Mutations That Abrogate Human Immunodeficiency Virus Type 1 Reverse 25

Transcriptase Dimerization Affect Maturation of the Reverse Transcriptase 26

Heterodimer. J. Virol. 79:10247-10257. 27

50. Wohrl, B. M., R. Krebs, S. H. Thrall, S. F. Le Grice, A. J. Scheidig, and R. S. 28

Goody. 1997. Kinetic Analysis of Four HIV-1 Reverse Transcriptase Enzymes 29

Mutated in the Primer Grip Region of p66. IMPLICATIONS FOR DNA 30

SYNTHESIS AND DIMERIZATION. J. Biol. Chem. 272:17581-17587. 31

51. Yu, Q., M. Ottmann, C. Pechoux, S. Le Grice, and J. L. Darlix. 1998. 32

Mutations in the primer grip of human immunodeficiency virus type 1 reverse 33

transcriptase impair proviral DNA synthesis and virion maturation. J Virol 34

72:7676-80. 35

52. Zybarth, G., and C. Carter. 1995. Domains upstream of the protease (PR) in 36

human immunodeficiency virus type 1 Gag-Pol influence PR autoprocessing. J. 37

Virol. 69:3878-3884. 38


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

22

1

TABLE AND FIGURE LEGENDS 2

Figure 1. Effects of W402A mutation on virus assembly and processing. (A) 293T 3

cells were transfected with wild-type (WT) or HIVgpt plasmids carrying one of the 4

following RT substitution mutations: W401A, W402A, or W401A/W402A. After 48 h, 5

cells and culture supernatant were collected and prepared for Western immunoblot 6

analysis. Cells (4% of the total sample and viral pellets (50% of the total sample) were 7

fractionated by 10% SDS-PAGE and electroblotted onto nitrocellulose filters. HIV-1 8

Gag proteins were probed with an anti-p24CA monoclonal antibody. RT and IN were 9

detected with anti-RT and anti-IN serum. (B) Relative levels of virus particle 10

production. Virus-associated Gag proteins were quantified by scanning mutant and 11

wild-type p24gag

-associated band densities from immunoblots as shown in panel A. 12

The total arbitrary densitometer units of each mutant were normalized to that of the 13

wild type in parallel experiments. Values of the ratios indicate the relative levels of 14

virus particles released. Error bars indicate standard deviation. *p<0.05. (C) 293T 15

cells were transfected with 10 µg of wild-type, W401A/W402A, or PR-inactivated 16

(PR-) HIVgpt plasmid alone (lanes 1, 4 and 7, respectively) or together with 5 µg 17

(lanes 2, 5 and 8) or 10 µg (lanes 3, 6 and 9) of W402A plasmid DNA. For each 18

transfection, plasmid DNA amounts were maintained at 20 µg with the addition of 19

pBlueScript SK. At 48 h post-transfection, cells and culture supernatant were 20


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

23

collected and subjected to Western immunoblot analysis as described above. Positions 1

of Pr160gag-pol

, RT p66 and p51 subunits, Pr55gag

, p41gag

, and p24gag

are indicated. 2

Figure 2. The W402A assembly defect is HIV-1 protease activity-dependent. 293T 3

cells were transfected with wt or mutant HIVgpt plasmids. At 4 h post-transfection, 4

cells were replated onto four dish plates and either left untreated (lanes 1 and 5) or 5

treated with HIV-1 protease inhibitor (PI) Ro31-8959 at concentrations of 0.01 (lanes 6

2 and 6), 0.1 (lanes 3 and 7), or 1.0 µM (lanes 4 and 8). At 48-72 h post-transfection, 7

cells and culture supernatant were collected, prepared, and subjected to Western 8

immunoblot analysis. Equivalent amounts of supernatant samples were probed with 9

anti-CA, anti-RT, or anti-IN antiserum (upper three panels). To give optimal results 10

for viewing p66/p51 RT subunits, blots were exposed for different lengths of time. 11

Positions of Pr160gag-pol

, p66/p51 RT subunits, IN, Pr55gag

, p41gag

, and p24gag

are 12

indicated. 13

Figure 3. Effects of W402 substitution mutations on virus assembly and 14

processing. (A-C) 293T cells were transfected with wt or mutant HIVgpt plasmids 15

carrying one of the following RT substitution mutations: W402A, W402L, or W402F. 16

At 48-72 h post-transfection, cells and culture supernatant were collected and 17

subjected to Western immunoblot analysis. HIV-1 Gag proteins were probed with an 18

anti-p24CA monoclonal antibody. RT was detected with anti-RT serum. Indicated are 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

24

positions of Pr160gag-pol

, RT p66 and p51 subunits, Pr55gag

, p41gag

and p24gag

. The 1

lower blot in panel B was derived from the panel A blot by extending the exposure. (D) 2

Effects of W402A and W402L mutations on Gag processing efficiency. Cellular 3

Pr55gag

and p24gag

levels were quantified by scanning Pr55gag

and p24gag

band 4

densities from immunoblots. Ratios of p24gag

to p55gag

were determined for wt and 5

each mutant. Bars indicate standard deviation. *p＜0.05. 6

Figure 4. Relative reverse transcriptase activity levels of HIV-1 RT mutants. 7

293T cells were transfected with the indicated plasmid The double mutant 8

W401A/W402A—recognized as being severely defective in terms of RT activity 9

(9)—served as a control.. At 48-72 h post-transfection, supernatant was collected, 10

pelleted, and resuspended in PBS buffer. Equivalent aliquots were subjected to in vitro 11

RT assays and Western immunoblot analyses. Ratios of RT activity to Gag protein 12

levels obtained via immunoblot band density quantification were determined for each 13

mutant and normalized to those of wt. Values for each construct were derived from at 14

least three independent experiments. Error bars indicate standard deviation. 15

Figure 5. Effects of W402A mutation on assembly and processing of truncated 16

HIV-1 Gag-Pol mutant. (A) Schematic representations of HIV-1 Gag-Pol truncation 17

mutations. Mature Gag protein domains and pol-encoded p6*, PR, RT, and IN (p31) 18

are indicated, along with p66RT subdomain boundaries. Numbers refer to amino acid 19


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

25

residue positions. Designated construct numbers indicate IN or RT terminal amino 1

acid residue positions. The final 4 residues in each truncated construct are shown with 2

inserted or altered amino acids in boldface. The W402A mutation was introduced into 3

each of the truncated Gag-Pol mutants; resulting constructs were designated 4

RN198/W402A, R560/W402A, R515/W402A, and R425/W402A, respectively. The 5

backbone of all expression constructs is HIVgpt. ‘*’ denotes the W402 position. (B) 6

293T cells were transfected with designated constructs. At 48-72 h, cells and 7

supernatant were harvested and subjected to Western blot analysis as described in the 8

Figure 1 legend. 9

Table 1. Infectivity of HIV-1 RT mutants.

Constructs

Titer

(c.f.u./ml)

Wild type* (c.f.u./ml)

Infectivity#

(%)

M ± SD

W401A 392 10,980 3

590 8,400 6 5.3 ± 2.0

940 12,320 7

W402A 48 10,980 3

58 8,400 5 6.0 ± 3.6

280 12,320 10

W402L 224 10,980 15

278 8,400 24 17.3 ± 5.8

652 12,320 13

W402F 432 10,980 20

452 8,400 27 19.3 ± 8.0

272 12,320 11

10


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

26

293T cells were transfected with the indicated plasmid plus a VSV-G expression 1

vector. At 48-72 h post-transfection, approximately 50% of the collected supernatant 2

was subjected to Western immunoblot analysis. The remaining supernatants were 3

aliquoted and used to infect HeLa cells. Supernatant amounts used for infections: wt 4

and W402F, 50 µl; W401A, W402A, and W402L, 1 ml. Infection and selection of 5

drug-resistant colonies were performed as described in Materials and Methods. 6

Drug-resistant colonies were converted to titers (c.f.u./ml). No drug-resistant colonies 7

were detected in the absence of VSV-G co-expression (data not shown). 8

* Wild-type (HIVgpt) titers were determined in parallel experiments. Experiments 9

were performed in triplicate. 10

# Ratios of viral titers to Gag protein levels (obtained via immunoblot band density 11

quantification) were determined for each mutant and normalized to those of wt in 12

parallel experiments. Mean and standard deviation (M + SD) values for viral 13

infectivity are indicated. 14

15

16


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Documents

A Single Amino Acid Substitution in HIV-1 Reverse Transcriptase