__A Semi-synthetic Organism With an Expanded Genetic Alphabet Malyshev2014

7/23/2019 __A Semi-synthetic Organism With an Expanded Genetic Alphabet Malyshev2014

1/17

LETTER doi:10.1038/nature13314

A semi-synthetic organism with an expandedgenetic alphabetDenis A. Malyshev1, Kirandeep Dhami1, Thomas Lavergne1, Tingjian Chen1, Nan Dai2, Jeremy M. Foster2, Ivan R. Correa Jr2

& Floyd E. Romesberg1

Organismsare definedby theinformationencoded in their genomes,andsince the originof life thisinformation has beenencoded using atwo-base-pair genetic alphabet (AT and GC).In vitro, thealphabethas beenexpanded to includeseveral unnatural base pairs (UBPs)13.We have developed a class of UBPs formed between nucleotides bear-inghydrophobicnucleobases,exemplifiedby thepairformedbetweend5SICSanddNaM(d5SICSdNaM),whichisefficiently PCR-amplified1

and transcribed4,5 in vitro, and whose unique mechanism of repli-cation has been characterized6,7. However, expansion of an organ-

isms genetic alphabet presents new and unprecedented challenges:the unnatural nucleoside triphosphates mustbe available inside thecell; endogenous polymerases must be able to use the unnatural tri-phosphates to faithfully replicate DNA containing the UBP withinthe complex cellular milieu; and finally, the UBP must be stable inthe presence of pathways that maintain the integrity of DNA. Herewe show thatan exogenously expressed algal nucleotide triphosphatetransporterefficientlyimports the triphosphatesof both d5SICS anddNaM (d5SICSTP and dNaMTP) into Escherichia coli, and that theendogenous replication machineryuses themto accuratelyreplicatea plasmid containing d5SICSdNaM. Neither the presence of theunnatural triphosphates nor the replication of the UBPintroduces anotable growthburden. Lastly,we findthat the UBPis notefficientlyexcised by DNArepairpathways. Thus, theresulting bacteriumis the

first organism to propagate stably an expanded genetic alphabet.Tomake theunnatural triphosphates availableinsidethecell, weprevi-

ously suggested using passive diffusion of the free nucleosides into thecytoplasm followed by their conversion to the corresponding tripho-sphate via the nucleoside salvage pathway8. Although we have shownthat analogues of d5SICS and dNaM are phosphorylated by the nucle-oside kinase fromDrosophila melanogaster8, monophosphate kinasesare more specific9, and inE. coliwe found that overexpression of theendogenous nucleoside diphosphate kinase results in poor growth. Asan alternative, we focused on the nucleotide triphosphate transport-ers (NTTs) of obligate intracellular bacteria and algal plastids1014. Weexpressed eight different NTTs inE. coliC41(DE3)1517 and measuredtheuptakeof[a-32P]-dATPas a surrogate fortheunnatural triphosphates(Extended Data Fig. 1). We confirmedthat [a-32P]-dATP is efficiently

transported into cells by the NTTs from Phaeodactylum tricornutum(PtNTT2)18and Thalassiosira pseudonana(TpNTT2)18. AlthoughNTTsfrom Protochlamydia amoebophila (PamNTT2 and PamNTT5)15 alsoimport [a-32P]-dATP, PtNTT2 showed the most activity, and both itandTpNTT2 are known to have broad specificity18, making them themost promising NTTs for further characterization.

Transport via an NTT requires that the unnatural triphosphates aresufficiently stable in culture media; however, preliminary characteriza-tion of d5SICSTP and dNaMTP indicated that decomposition occursin thepresence of actively growingE. coli (ExtendedData Fig.2). Similarbehaviour wasobserved with [a-32P]-dATP, and the dephosphorylationproducts detected by thin-layerchromatography(TLC)for[a-32P]-dATP,or by high-performance liquid chromatography (HPLC) and matrix-assisted laser desorption/ionization(MALDI) for d5SICSTPanddNaMTP,

suggest that decomposition is mediated by phosphatases.As no degra-dation was observed upon incubation in spent media, decompositionseems to occur within theperiplasm.No increasein stabilitywas observedin cultures of single-gene-deletion mutants ofE. coli BW25113 lackinga specific periplasmic phosphatase19 (as identified by the presence of aSec-type amino-terminal leadersequence), includingphoA, ushA, appA,aphA,yjjX,surE,yfbR,yjjG,yfaO, mutT,nagD,yggV,yrfGor ymfB,suggesting thatdecomposition results fromthe activity of multiple phos-phatases. However, the extracellular stability of [a-32P]-dATP was sig-

nificantly greater when 50 mM potassiumphosphate (KPi) wasaddedtothegrowthmedium (Extended Data Fig.3). Thus, we measured [a-32P]-dATP uptakefrommediacontaining 50 mMKPi after inductionof thetransporter with isopropyl-b-D-thiogalactoside(IPTG)(Extended DataFig.4). Although induction with1 mM IPTG resultedin slower growth,consistentwiththe previouslyreportedtoxicity of NTTs17,italsoresultedin maximal [a-32P]-dATP uptake. Thus, after addition of 1 mM IPTG,we analysedthe extracellular and intracellular stability of [a-32P]-dATPas a function of time (Extended Data Fig. 5). Cells expressingPtNTT2were foundto have the highest levels of intracellular [a-32P]-dATP, andalthoughboth extra- andintracellulardephosphorylationwas still observed,the ratio of triphosphate to dephosphorylation products inside the cellremained roughly constant, indicating that the extracellular concen-trations and PtNTT2-mediated influx are sufficient to compensate for

intracellular decomposition.Likewise, we found that the addition of KPi increased the extracel-

lular stability of d5SICSTP and dNaMTP (Extended Data Fig. 2), and

1Department ofChemistry, TheScrippsResearch Institute, 10550NorthTorreyPinesRoad, LaJolla, California92037,USA. 2NewEnglandBiolabs, 240CountyRoad, Ipswich,Massachusetts 01938,USA.

ba

NS OO

O

O O

O

O

d5SICSdNaM

NN

HN H

O

O

H N

N

N

N

NH

H

OO

O

O O

O

dCdG

25

50

75

0

100

Compositio

n(%)

25

50

75

0

100

Composition(%)

d5SICS

[3P] (M) 86 9

Cytoplasm

Media 3P2P1P0P

dA dNaM

30 4

Figure 1| Nucleoside triphosphate stability and import. a, Chemicalstructureof thed5SICSdNaMUBP compared to thenatural dGdC base pair.b, Composition analysis of d5SICS and dNaM in the media (top) andcytoplasmic (bottom) fractions of cells expressingPtNTT2 after 30 minincubation; dA shown for comparison. 3P, 2P, 1P and 0P correspond totriphosphate, diphosphate, monophosphate and nucleoside, respectively; [3P]is the intracellular concentration of triphosphate. Error bars represent s.d.of the mean,n53.

0 0 M O N T H 2 0 1 4 | V O L 0 0 0 | N A T U R E | 1

Macmillan Publishers Limited. All rights reserved2014
http://www.nature.com/doifinder/10.1038/nature13314http://www.nature.com/doifinder/10.1038/nature13314


2/17

when a stationary phase culture was diluted 100-fold into fresh media,the half-lives of both unnatural triphosphates(initial concentrations of0.25 mM)werefoundto be approximately 9 h, which seemedsufficient

forour purposes. Thirty minutes after their addition tothemedia,neitherof theunnaturaltriphosphates was detected in cells expressingTpNTT2;in contrast, 90mM of d5SICSTPand 30mM ofdNaMTPwere found inthe cytoplasm of cells expressingPtNTT2 (Fig. 1b). Although intracel-lular decomposition was still apparent, the intracellular concentrationsof intact triphosphate are significantly above the sub-micromolarKM

values of the unnatural triphosphates for DNA polymerases20, settingthe stage for replication of the UBP in a living bacterial cell.

Thereplication of DNAcontaining d5SICS-dNaM hasbeen validatedin vitro withdifferentpolymerases,primarilyfamilyA polymerases, suchas the Klenow fragment ofE. coli DNApolymerase I (pol I)20,21.Asthemajority of theE. coligenome is replicated by pol III, we engineered aplasmidtofocusreplicationoftheUBPtopolI.PlasmidpINF(theinfor-mation plasmid)was constructed frompUC19 usingsolid-phase DNAsynthesis andcircular-extensionPCRto replace thedAdT pairat posi-tion 505 with dNaM paired opposite an analogue of d5SICS (dTPT322)(Fig. 2a, b). This positions the UBP 362 bp downstream of the ColE1origin of replication where leading-strand replication is mediated bypol I23, and within the TK-1 Okazaki processing site24, where lagging-strand synthesis is also expected to be mediated by pol I. SyntheticpINF was constructed using the d5SICS analogue because it shouldbeefficiently replaced by d5SICS if replication occursin vivo, making it

possible to differentiatein vivoreplicated pINF from synthetic pINF.To determine whetherE.coli canusethe imported unnatural triphos-

phates to stably propagate pINF, C41(DE3)cells werefirst transformedwitha pCDF-1b plasmid encodingPtNTT2 (hereafter referred toaspACS,foraccessoryplasmid, Fig. 2a)and grownin mediacontaining 0.25 mMofbothunnaturaltriphosphates,50mMKPiand1mMIPTGtoinducetransporterproduction. Cells werethen transformedwith pINF, andaftera 1-hrecovery period,cultures werediluted tenfoldwith thesame mediasupplemented with ampicillin, and growth was monitored via cultureturbidity(Extended Data Table1).As controls,cells were also transformedwith pUC19, or grown without either IPTG or without the unnaturaltriphosphates. Again, growth was significantly slower in the presenceofIPTG,buttheadditionofd5SICSTPanddNaMTPresultedinonlyaslight further decrease in growth in the absence of pINF, and interest-

ingly, it eliminated a growth lag in the presence of pINF (Fig. 2c),suggesting thatthe unnatural triphosphates arenot toxic andarerequiredfor the efficient replication of pINF.

To demonstrate the replication of pINF, we recovered the plasmidfrom cells after 15 h of growth. The introductionof theUBP resulted in

a

pINF

2,686 bp

pACS

5,151 bp

3,000

362

lacpromoter

Primase recognition sequence

lacoperator

5' - CATGGTCATAGCTGTTTCCTGTGTGAAATTGTTAT CCGCTCACAXTTCCACACAACATACGAGCCGGAAGC

3' - GTACCAGTATCGACAAAGGACACACTTT AACAATAGGCGAGTGTYAAGGTGTGTTGTATGCTCGGCCTTCG

505

lacZ

TK-1 Okazaki processing site

10

eb

pINF

Transformation

and growth

pUC19

PCR

pINF

E. colipACS

PCR

PCR

350 bp

100 bp

200 bp

pINF

+

B

PCR

SA

pINF pUC19

67%

dXTP/dYTP

IPTG + + ++

Plasmid

+ + + + +

+ + ++

+

B

f

pINF

+

pUC19

+

+

+

++

+

IPTGIPTG

pINF

+

PCR

X

dXTP

dYTP

dXTP

dY TP

XY

XY

dXTP

dYTP

XY

XY

XY

XY

XY

dXTP

dYTP

dXTP

dYTP

dXTP

dYTP0.6

c

Time (h)11 13 15 17 19

0.4

0

0.2

OD600

EP

+++

Acquisition time (min)

1.5 2.0 2.5 3.0 3.5 4.0 6.5 7.0 7.5

Counts(104)

4

6

0

2

8dC dG dA

dT 6.9 7.0 7.16.8

4

6

0

2

8

Counts(102)

d5SICS

pINF

IPTG

pUC19

++

+

+

++

+

d

5,000

4,0

00

1,0

00

1,0

00

2,00

0

500

X

Y

1,50

0

2,000

2,5

00c

loDF

Amp

Rp

romoter T7te

rmin

ator

Amp

R

pro

mote

r

AmpR

or

i

Sm

lacI

prom

oterlac

operatorT7

promoterlacI

PtN

TT2

lac

oper

ator

lacZ

lacpromote

r

dXTPdYTP

dXTPdYTP

Figure 2| Intracellular UBP replication. a, Structure of pACS and pINF.dX and dY correspond to dNaM and a d5SICS analogue 22 that facilitatedplasmid construction (see Methods).cloDF, origin of replication;Sm, streptomycin resistance gene;AmpR, ampicillin resistance gene;ori,ColE1 origin of replication;lacZa,b-galactosidase fragment gene.b, Overviewof pINF construction. A DNA fragment containing the unnatural nucleotidewas synthesized via solid-phase DNA synthesis and then used to assemblesyntheticpINF via circular-extension PCR29.X,dNaM;Y9, dTPT3 (ananalogueof d5SICS22); y, d5SICS (see text). Colour indicates regions of homology. The

doublynicked product was used directly to transform E. coli harbouringpACS.c, The addition of d5SICSTP and dNaMTP eliminates a growth lag of cellsharbouring pINF. EP, electroporation. Error bars represent s.d. of the mean,n5 3.d, LC-MS/MS total ion chromatogram of global nucleoside content inpINF and pUC19 recorded in dynamic multiple reaction monitoring(DMRM)mode. pINF and pUC19 (control) were propagated inE. coliin the presence orabsence of unnatural triphosphates, and with or withoutPtNTT2 induction.The inset shows a 100-fold expansion of the mass-count axis in the d5SICSregion.e, Biotinylation only occurs in the presence of the UBP, the unnaturaltriphosphates and transporter induction. After growth, pINF was recovered,and a 194-nucleotide region containing the site of UBP incorporation(nucleotides 437630) was amplified and biotinylated. B, biotin; SA,streptavidin. The natural pUC19 control plasmid was prepared identically topINF. A 50-bp DNA ladder is shown to the left. f, Sequencing analysisdemonstrates retention of the UBP. An abrupt termination in the Sangersequencing reaction indicatesthe presenceof UBP incorporation(site indicated

with arrow).

RESEARCH LETTER

2 | N A T U R E | V O L 0 0 0 | 0 0 M O N T H 2 0 1 4



3/17

a small (approximately twofold)reduction in thecopynumberof pINF,as gaugedby itsratioto pACS (Extended Data Table 1);we determinedthat the plasmid was amplified 23 107-fold during growth (approxi-mately 24 doublings) based on the amount of recovered plasmid andthe transformationefficiency. To determinethe levelof UBP retention,the recovered plasmid was digested, dephosphorylated to single nucle-osides, and analysed by liquidchromatography-tandem massspectrom-etry(LC-MS/MS)25. Although thedetectionandquantificationof dNaM

were precluded by its poor fragmentation efficiency and low production counts over background, signal for d5SICS was clearly observable(Fig.2d). External calibration curves wereconstructed usingthe unnat-ural nucleoside andvalidated by determining its ratioto dA in syntheticoligonucleotides (Extended Data Table 2). Using the resulting calibra-tion curve, we determined the ratio of dA to d5SICS in recoveredpINFwas 1,106 to 1, which when compared to the expected ratio of 1,325to 1, suggests the presence of approximately one UBP per plasmid. Nod5SICS was detected in control experiments in which the transporterwas not induced, or when the unnatural triphosphates were not addedto the media, or when pUC19was used instead of pINF (Fig. 2d, inset),demonstrating that itspresence results from the replication of the UBPandnot frommisinsertionof theunnatural triphosphates oppositea naturalnucleotide. Importantly, as the synthetic pINF contained an analogue

of d5SICS, and d5SICS was only provided as a triphosphate added tothe media, its presence in pINF confirms in vivoreplication.To independently confirm and quantify the retention of the UBP in

therecovered plasmid,the relevant regionwas amplifiedby PCRin thepresence of d5SICSTP and a biotinylated dNaMTP analogue4 (Fig.2e).Analysis by streptavidin gelshiftshowedthat 67%of theamplifiedDNAcontained biotin. No shift was observed in control experiments wherethe transporter was not induced,or when unnatural triphosphates werenot added, or when pUC19 was used instead of pINF, demonstratingthat the shift results from the presence of the UBP. Based on a calibra-tion curve constructed from the shifts observed with the amplificationproducts of controlled mixtures of DNA containing dNaM or its fullynatural counterpart (Methods andExtendedData Fig. 6),the observedgelshiftcorrespondstoa UBPretentionof 86%. Similarly, when theampli-fication product obtained with d5SICSTP and dNaMTP was analysedby Sanger sequencing in the absence of the unnatural triphoshates1,26,27,thesequencing chromatogramshowed completetermination at the posi-tion of UBPincorporation, which withan estimatedlower limit of read-through detection of 5%, suggests a level of UBP retention in excess of95% (Fig. 2f). In contrast, amplification products obtained from pINFrecovered fromcultures grownwithout PtNTT2induction, withoutaddedunnatural triphosphates, or obtained from pUC19 propagated underidentical conditions, showed no termination. Overall, the data unam-biguously demonstrate that DNA containing the UBP was replicatedin vivoand allow us to estimate that replication occurred with fidelity(retention per doubling)of at least 99.4% (24 doublings; 86% retention;0.994245 0.86). This fidelity corresponds to an error rate of approxi-mately 1023, whichis comparable to the intrinsicerrorrate of some poly-merases with natural DNA28.

ThehighretentionoftheUBPovera15-hperiodofgrowth(approx-imately 24 doublings) strongly suggests that it is not efficiently excisedby DNA repair pathways. To test further this hypothesis and to exam-ine retention during prolonged stationary phase growth, we repeatedthe experiments, but monitoredUBP retention,cell growth and unnat-ural triphosphate decomposition forup to 6 days withoutproviding anyadditionalunnaturaltriphosphates(Fig. 3 andExtended DataFig. 7).At15 and 19 h of growth, the cultures reachedan optical density at 600 nm(OD600) of approximately 0.9 and 1.2, respectively, and both d5SICSTPanddNaMTPdecomposedto 1720%and1016%of theirinitial0.25-mMconcentrations(ExtendedDataFig. 7a).Inagreementwith theexperimentsdescribedabove,retentionof theUBP after 15h was9765%and.95%,as determined by gelshift andsequencing, respectively, andafter 19 h itwas 9163%and .95%. As thecultures entered stationary phaseand the

triphosphates decomposedcompletely, plasmid lossbegan to compete

with replication (Extended Data Fig. 7b, c, d), but even then, retentionof the UBP remained at approximately 45% and 15%, at days 3 and 6respectively. Moreover, when d5SICS-dNaM was lost, it was replacedby dAdT, which is consistent with the mutational spectrum of DNApolI20. Finally,the shape of theretention versustimecurvemirrorsthatof thegrowth versus time curve.Taken together, these data suggest thatin the absence of unnatural triphosphates, the UBP is eventually lostby replication-mediated mispairing, and not from the activity of DNArepair pathways.

We have demonstrated thatPtNTT2 efficiently imports d5SICSTPand dNaMTP into E. coli and thatan endogenous polymerase, possiblypol I, efficiently usesthe unnatural triphosphates to replicateDNA con-

tainingthe UBPwithin thecellularenvironmentwith reasonable efficiencyand fidelity. Moreover, the UBP appears stable during both exponen-tial andstationary phase growthdespitethe presence of allDNA repairmechanisms. Remarkably, although expression ofPtNTT2 results in asomewhat reducedgrowthrate,neitherthe unnatural triphosphatesnorreplication of theUBPresults in significantfurther reduction in growth.Theresultingbacterium is the first organism thatstably harboursDNAcontainingthreebasepairs.Inthefuture,thisorganism,oravariantwiththe UBP incorporated at other episomal or chromosomal loci, shouldprovide a synthetic biology platform to orthogonallyre-engineer cells,with applications ranging from site-specific labelling of nucleic acidsin living cells to theconstruction of orthogonal transcription networksand eventuallythe production and evolution of proteins with multiple,different unnatural amino acids.

METHODS SUMMARYTo prepare electrocompetent C41(DE3) pACS cells, freshly transformed E. coliC41(DE3)pACS wasgrown overnightin 23YT medium (1.6% tryptone,1% yeastextract, 0.5%NaCl) supplementedwith streptomycin andKPi. After 100-fold dilu-tion into thesamemedium andoutgrowth at 37uCtoOD6005 0.20,IPTG wasaddedto induce expression ofPtNTT2. After 40 min, cultures were rapidly cooled, washedwithsterilewater andresuspendedin 10%glycerol.An aliquot of electrocompetentcells was mixed with pINF and electroporated. Pre-warmed 23YT medium con-tainingstreptomycin,IPTG andKPi wasadded, andan aliquot wasdiluted3.3-foldin the same media supplemented with 0.25 mM each of dNaMTP and d5SICSTP.Theresultingmixturewas allowed torecover at 37 uC withshaking.After recovery,cultures were centrifuged. Spent media was analysedfor nucleotidecompositionbyHPLC(Extended DataFig. 7a);cells wereresuspendedin freshmediumcontainingstreptomycin,ampicillin, IPTG, KPiand 0.25 mM eachof dNaMTPand d5SICSTP,and grown with shaking. At defined time points, OD600was determined and ali-

quots were removed and centrifuged. Spent media were analysed for nucleotide

500 25 75 146

Time (h)

0

1

2

3

OD600

Retention(%)

20

40

60

80

100

0

d5SICSTP(%)

dN

aMTP(%)

Figure 3| Intracellular stability of the UBP. E. coliC41(DE3) pACS wastransformed with pINF and grown after a single dose of d5SICSTP anddNaMTP was providedin themedia. UBPretention in recoveredpINF,OD600,and relative amount of d5SICSTP and dNaMTP in the media (100%5 0.25mM), were determined as a function of time. Error bars represent s.d. of the

mean,n5 3.

LETTER RESEARCH

0 0 M O N T H 2 0 1 4 | V O L 0 0 0 | N A T U R E | 3



4/17

composition, and pINFwas recoveredby spincolumn purification. UBP retentionwas characterized by LC-MS/MS, PCR amplification and gel electrophoresis, orsequencing, as described in the Methods.

Online Content Any additionalMethods, ExtendedData display items and SourceData are available in theonline version of the paper; references unique to thesesections appear only in the online paper.

Received 27 November 2013; accepted 8 April 2014.

Published online 7 May 2014.

1. Malyshev, D. A.et al.Efficient and sequence-independent replication of DNAcontaining a third base pair establishes a functional six-letter genetic alphabet.Proc. Natl Acad. Sci. USA 109,1200512010 (2012).

2. Yang, Z., Chen, F., Alvarado, J. B. & Benner, S. A. Amplification, mutation, andsequencing of a six-letter synthetic genetic system.J. Am. Chem. Soc. 133,1510515112 (2011).

3. Yamashige,R. etal. Highly specificunnatural basepairsystemsas a third basepairfor PCR amplification. Nucleic Acids Res. 40,27932806 (2012).

4. Seo, Y. J., Malyshev, D. A., Lavergne, T., Ordoukhanian, P. & Romesberg,F. E.Site-specific labeling of DNA and RNA using an efficiently replicated andtranscribed class of unnatural base pairs.J. Am. Chem. Soc. 133, 1987819888(2011).

5. Seo, Y. J., Matsuda, S. & Romesberg, F. E. Transcription of an expanded geneticalphabet. J. Am. Chem. Soc. 131,50465047 (2009).

6. Betz, K.et al. Structural insights into DNA replication without hydrogen bonds.J. Am. Chem. Soc. 135, 1863718643 (2013).

7. Betz, K.et al. KlenTaq polymerase replicates unnatural base pairs by inducing aWatsonCrick geometry. Nature Chem. Biol. 8, 612614 (2012).

8. Wu, Y.,Fa, M.,Tae, E. L., Schultz, P. G. & Romesberg,F. E. Enzymaticphosphorylation of unnatural nucleosides.J. Am. Chem. Soc. 124, 1462614630(2002).

9. Yan, H. & Tsai, M. D. Nucleoside monophosphate kinases: structure, mechanism,and substrate specificity.Adv. Enzymol. 73, 103134 (1999).

10. Winkler,H. H. & Neuhaus,H. E. Non-mitochondrial ATPtransport. TrendsBiochem.Sci. 24, 6468 (1999).

11. Amiri, H., Karlberg, O. & Andersson, S. G. Deeporigin of plastid/parasite ATP/ADPtranslocases. J. Mol. Evol.56,137150 (2003).

12. Hatch, T. P., Al-Hossainy, E. & Silverman, J. A. Adenine nucleotide and lysinetransport in Chlamydia psittaci. J. Bacteriol.150, 662670 (1982).

13. Winkler,H. H. Rickettsialpermeability:an ADP-ATPtransport system.J. Biol.Chem.251, 389396 (1976).

14. Horn, M. & Wagner,M. Bacterial endosymbionts of free-living amoebae.J. Eukaryot.Microbiol.51,509514 (2004).

15. Haferkamp, I. etal. Tappingthenucleotidepoolof thehost:novelnucleotide carrierproteins ofProtochlamydia amoebophila. Mol. Microbiol. 60,15341545 (2006).

16. Miroux, B. & Walker, J. E. Over-production of proteins in Escherichia coli: mutant

hosts that allow synthesis of some membrane proteins and globular proteins athigh levels.J. Mol. Biol.260,289298 (1996).

17. Haferkamp,I. & Linka,N. Functionalexpression andcharacterisationof membranetransport proteins.Plant Biol.14, 675690 (2012).

18. Ast, M. et al. Diatom plastids depend on nucleotide import from the cytosol. Proc.Natl Acad. Sci. USA106, 36213626 (2009).

19. Baba,T. etal. Construction of Escherichia coliK-12 in-frame, single-gene knockoutmutants: the Keio collection. Mol. Syst. Biol. 2, 2006.0008 (2006).

20. Lavergne, T., Malyshev, D. A. & Romesberg,F. E. Majorgroove substituents andpolymerase recognition of a class of predominantly hydrophobic unnatural basepairs. Chemistry18, 12311239 (2012).

21. Seo, Y. J., Hwang, G. T., Ordoukhanian, P. & Romesberg, F. E. Optimization of anunnatural base pair toward natural-like replication.J. Am. Chem. Soc. 131,

32463252 (2009).22. Li,L. etal. Natural-likereplicationof an unnatural basepairfor theexpansionof the

geneticalphabet and biotechnology applications.J. Am. Chem.Soc. 136, 826829(2014).

23. Tomizawa,J. & Selzer, G. Initiationof DNAsynthesisin Escherichia coli. Annu. Rev.Biochem.48,9991034 (1979).

24. Allen, J. M.et al. Roles of DNA polymerase I in leading and lagging-strandreplication defined by a high-resolution mutation footprint of ColE1 plasmidreplication. Nucleic Acids Res. 39, 70207033 (2011).

25. Hashimoto, H. et al.Structure of a NaegleriaTet-like dioxygenase in complex with5-methylcytosine DNA.Nature 506, 391395 (2013).

26. Malyshev, D. A., Seo, Y. J., Ordoukhanian, P. & Romesberg, F. E. PCR with anexpanded genetic alphabet.J. Am. Chem. Soc. 131, 1462014621 (2009).

27. Hirao,I. et al. An unnatural hydrophobic base pair system: site-specificincorporation of nucleotide analogs into DNA and RNA.Nature Methods3,729735 (2006).

28. Goodman, M. F. Error-prone repair DNA polymerases in prokaryotes andeukaryotes. Annu. Rev. Biochem.71,1750 (2002).

29. Quan, J. & Tian, J. Circularpolymerase extension cloning for high-throughputcloning of complex andcombinatorial DNA libraries. Nature Protocols 6, 242251(2011).

Supplementary Informationis available in theonline version of the paper.

Acknowledgements We thankI. Haferkamp andJ. Audiafor kindlyproviding theNTTplasmids and helpful discussions, and P. Ordoukhanianfor providing access to theCenterfor Protein andNucleic Acid Research at TSRI. This work wassupported by theUS National Institutes of Health (NIH) (GM 060005).

Author ContributionsD.A.M., K.D., T.C. and F.E.R. designed the experiments. D.A.M.,K.D.and T.L.performedthe experiments. N.D., J.M.F. andI.R.C.J. performed LC-MS/MSanalysis. D.A.M., K.D. and F.E.R. analysed data and D.A.M. and F.E.R. wrote themanuscript with assistance from the other authors.

Author Information Reprints and permissions information is available atwww.nature.com/reprints. The authors declare competing financial interests: detailsare available in theonline version of the paper.Readers are welcome to comment on

the online version of the paper. Correspondence and requestsfor materialsshould beaddressed to F.E.R. ([email protected]) .

RESEARCH LETTER

4 | N A T U R E | V O L 0 0 0 | 0 0 M O N T H 2 0 1 4

http://www.nature.com/doifinder/10.1038/nature13314http://www.nature.com/doifinder/10.1038/nature13314http://www.nature.com/reprintshttp://www.nature.com/doifinder/10.1038/nature13314http://www.nature.com/doifinder/10.1038/nature13314mailto:[email protected]:[email protected]://www.nature.com/doifinder/10.1038/nature13314http://www.nature.com/doifinder/10.1038/nature13314http://www.nature.com/reprintshttp://www.nature.com/doifinder/10.1038/nature13314http://www.nature.com/doifinder/10.1038/nature13314


5/17

METHODSMaterials. 23YT,23YT agar,IPTG, ampicillin andstreptomycinwere obtainedfrom Fisher Scientific. Ampicillin and streptomycin were usedat 100mg ml21 and50 mg ml21, respectively. All pET-16b constructs containing the nucleotide trans-porters were kindly provided by I. Haferkamp (Technische Universitat Kaisers-lautern, Germany) with the exception of pET16b-RpNTT2, which along with theC41(DE3) E. coli strain, wasprovidedby J. P. Audia (Universityof South Alabama,USA). Plasmids pUC19 and pCDF-1b were obtained from Thermo Scientific andEMD Millipore, respectively. Plasmids were purified using the PureLink Quick

Plasmid DNAMiniprep Kit (Life Technologies).OneTaq, DeepVent,Q5 Hot StartHigh-Fidelity DNA Polymerases, and all restriction endonucleases were obtainedfrom New England Biolabs. In general, PCR reactions were divided into multiplealiquotswithone followedin realtime using 0.53 SybrGreenI (Life Technologies);following PCR, thealiquots wererecombined, purified byspin column(DNA CleanandConcentrator-5; ZymoResearch,Irvine,California,USA) withelutionin 20mlof water, then separated by agarose gel electrophoresis, followed by band excisionandrecovery (Zymoclean GelDNA RecoveryKit),eluting with20ml ofwater unlessstatedotherwise. Polyacrylamide gels were stained with13 Sybr Gold (LifeTech-nologies)for 30 min, agarosegels were cast with 13 Sybr Gold. Allgels were visu-alized usinga Molecular Imager GelDoc XR1equippedwith520DF30 filter(Bio-Rad)and quantified with Quantity One software (Bio-Rad). The sequences of all DNAoligonucleotides used in this study are provided in Supplementary Information.Natural oligonucleotides were purchasedfrom IDT (San Diego, California, USA).The concentrationof dsDNAwas measured by fluorescent dyebinding(Quant-iTdsDNA HS Assay kit, Life Technologies) unless stated otherwise. The concentra-tion of ssDNA was determined by UV absorption at 260 nm using a NanoDrop1000 (Thermo Scientific). [a-32P]-dATP (25mCi)was purchased from PerkinElmer(Shelton, Connecticut,USA).Polyethyleneimine cellulose pre-coated Bakerflex TLCplates (0.5 mm) were purchased from VWR. dNaM phosphoramidite, dNaM andd5SICSnucleosides wereobtainedfrom Berry& Associates Inc.(Dexter,Michigan,USA).Free nucleosidesof dNaM andd5SICS (Berry& Associates) were convertedtothecorresponding triphosphates underLudwigconditions30. Afterpurificationby anionexchange chromatography(DEAE Sephadex A-25) followed by reverse phase (C18)HPLC and elution through a Dowex 50WX2-sodium column, both triphosphateswerelyophilized andkept at220 uC until use.The d5SICSTP analogue dTPT3TP22

and the biotinylated dNaMTP analogue dmmo2SSBIOTP4 were made as reportedpreviously. MALDI-TOFmass spectrometry (AppliedBiosystems Voyager DE-PROSystem6008)was performedat theTSRICenterfor Proteinand Nucleic Acid Research.Constructionof NTT expression plasmids. ThePtNTT2 genewas amplifiedfromplasmid pET-16b-PtNTT2 using primers PtNTT2-forward and PtNTT2-reverse;

the TpNTT2 gene was amplified from plasmid pET-16b-TpNTT2 using primersTpNTT2-forward andTpNTT2-reverse.A linear fragment of pCDF-1bwas gener-ated using primers pCDF-1b-forward and pCDF-1b-reverse. All fragments werepurified as describedin Materials.The pCDF-1b fragment (100 ng,4.4310214mol)andeither thePtNTT2 (78ng, 4.4310214mol)or TpNTT2 (85ng, 4.4310214mol)fragment were then assembled together usingrestriction-free circular polymeraseextension cloning29 in 13OneTaq reaction buffer, MgSO4adjusted to 3.0 mM,0.2 mM of dNTP, and 0.02 U ml21 of OneTaq DNA under the following thermalcycling conditions: initial denaturation (96 uC, 1 min); 10 cycles of denaturation(96 uC, 30 s),touchdown annealing(54 uC to49.5 uC f or 3 0 s (20.5 uC percycle)),extensionof 68 uCfor5min,andfinalextension(68 uC,5min).Uponcompletion,thesamples were purifiedand used forheat-shocktransformationofE. coli XL10.Individual colonies were selected on lysogeny broth (LB)-agar containing strep-tomycin, and assayed by colony PCR with primers PtNTT2-forward/reverse orTpNTT2-forward/reverse.The presenceof the NTTgenes was confirmed by sequenc-ing and double digestion with ApaI/EcoO109I restriction endonucleases with the

followingexpected pattern: pCDF-1b-PtNTT2(2,546/2,605 bp),pCDF-1b-TpNTT2(2,717/2,605 bp), pCDF-1b (1,016/2,605 bp). The complete nucleotide sequenceof thepCDF-1b-PtNTT2plasmid(pACS)is providedin SupplementaryInformation.Growth conditionsto quantifynucleoside triphosphateuptake.E.coli C41(DE3)16

freshly transformed withpCDF-1b-PtNTT2wasgrownin23YT withstreptomy-cin overnight, then diluted (1:100) into fresh 23YT medium (1 ml of culture peruptake with[a-32P]-dATP;2 ml of culture peruptakewith d5SICSTPor dNaMTP)supplementedwith 50 mM potassium phosphate(KPi) and streptomycin.A nega-tivecontrol withthe inactivetransporterpET-16b-RpNTT2, was treatedidenticallyexcept ampicillin was used instead of streptomycin. Cells were grown to an OD600ofapproximately0.6 andthe NTTexpressionwas inducedby theaddition of IPTG(1 mM). The culture was allowed to grow for another hour (final OD600approxi-mately1.2)and then assayeddirectlyfor uptake as describedbelow usinga methodadapted from a previous paper15.Preparationof mediafraction for unnatural nucleoside triphosphate analysis.The experiment was initiated by the addition of either dNaMTP or d5SICSTP

(10mM each)directlyto themediato a final concentration of 0.25 mM.Cells were

incubated with the substrate with shaking at 37 uC for 30 min and then pelleted(8,000 r.c.f. (relative centrifugal force) for 5 min, 4 uC). An aliquot of the mediafraction (40ml) was mixed with acetonitrile (80 ml) to precipitate proteins31, andthen incubated at 22 uC for 30 min. Samples were either analysed immediately byHPLCor stored at280 uC untilanalysis. Analysis began with centrifugation (12,000r.c.f. for 10 min at 22 uC), then the pellet was discarded, and the supernatant wasreduced to approximately 20ml by SpeedVac,resuspendedin bufferA (see below)to a final volume of 50 ml, and analysed by HPLC (see below).

Preparation of cytoplasmic fraction for nucleoside triphosphate analysis. To

analyse the intracellular desphosphorylation of the unnatural nucleoside triphos-phate, cell pellets were subjected to 33 100ml washes of ice-cold KPi (50 mM).Pelletswerethen resuspendedin 250mloficecoldKPi(50mM)andlysedwith250mlof lysis buffer L7 of the PureLink Quick Plasmid DNA Miniprep Kit (200 mMNaOH, 1% w/vSDS),afterwhichthe resultingsolutionwas incubatedat 22 uCfor5 min.Precipitation buffer N4 (350ml,3.1 M potassiumacetate, pH5.5)was added,andthe sample wasmixed to homogeneity.Followingcentrifugation (.12,000 r.c.f.for 10 min, at 22 uC) the supernatant containing the unnatural nucleotides wasapplied to a HypersepC18 solidphase extraction column (Thermo Scientific) pre-washed with acetonitrile (1 ml) and buffer A (1 ml, see HPLC protocol for buffercomposition). The column was then washed with buffer A and nucleotides wereeluted with 1 ml of 50% acetonitrile:50% triethylammonium bicarbonate (TEAB)0.1 M (pH 7.5).The eluent was reduced to approximately 50ml in a SpeedVac andits volume was adjusted to 100ml with buffer A before HPLC analysis.

HPLCprotocol and nucleoside triphosphatequantification. Samples were appliedto a Phenomenex JupiterLC column(3mmC18300A,25034.6mm) andsubjected

to a linear gradient of 040% B over 40 min at a flow rate of 1 ml min21. Buffer A:95% 0.1 M TEAB, pH7.5; 5%acetonitrile. BufferB: 20% 0.1 M TEAB, pH7.5; 80%acetonitrile. Absorption was monitored at 230, 273, 288, 326 and 365 nm.

Each injection series included two extra control samples containing 5 nmol ofdNaMTP or d5SICSTP. The areas under the peaks that corresponded to tripho-sphate, diphosphate, monophosphate and free nucleoside (confirmed by MALDI-TOF) were integrated for both the control and the unknown samples (describedabove). After peak integration, the ratio of the unknown peak to the control peakadjusted for the loss from the extraction step (62% and 70% loss for dNaM andd5SICS, respectively, Extended Data Table 3), provided a measure of the amountof each of the moieties in the sample. To determine the relative concentrations ofunnaturalnucleotide inside the cell, the amount of imported unnaturalnucleotide(dXTP, mmol) wasthen divided by thevolume of cells,whichwas calculated as theproductof thevolumeof a singleE.coli cell(1 mm3based on a reportedaveragevalue32;that is, 13 1029 ml per cell) and the number of cells in each culture (OD600of 1.0equal to13 109 cells perml (ref. 32)). The RpNTT2 samplewas used as a negativecontrol and its signal was subtracted to account for incomplete washing of nucle-otide species from the media.

dATP uptake. To analyse theintracellular desphosphorylationof dATP, afterinduc-tion of the transporter, the uptake reaction was initiated by the addition of dATP(spikedwith [a-32P]-dATP)to a final concentration of 0.25 mM,followed by incu-bation at 37 uC with shaking for 30 min. The culture was then centrifuged (8,000r.c.f.for5minat22 uC).Supernatantwas analysedby TLC.Cell pelletswere washedthree times with ice-cold KPi (50 mM, 100 ml) to remove excess radioactive sub-strate, lysed with NaOH (0.2 M, 100 ml) and centrifuged (10,000 r.c.f. for 5 min at22 uC) to remove cell debris; supernatant was analysed by TLC.

TLC analysis.Samples (1ml) were applied on a 0.5 mm polyethyleneimine cellu-lose TLCplate anddevelopedwith sodium formatepH 3.0(0.5M, 30s; 2.5M, 2.5 min;4.0 M, 40 min). Plates weredried using a heatgun andquantifiedby phosphorimaging(Storm Imager, Molecular Dynamics) and Quantity One software.

Optimization of nucleotide extraction from cells for HPLC injection. To min-

imize the effect of the lysis and triphosphate extraction protocols on the decom-position of nucleoside triphosphate within the cell, the extraction procedure wasoptimizedfor thehighestrecovery withthe lowest extent of decomposition(ExtendedData Table 3). To test different extraction methods, cells were grown as describedabove,washed, andthen 5 nmol of eitherdNaMTP or d5SICSTP wasaddedto thepellets, which were then subjected to different extraction protocols including boil-ingwater, hotethanol,cold methanol,freeze andthaw,lysozyme, glass beads,NaOH,trichloroacetic acid (TCA) with Freon, and perchloric acid (PCA) with KOH33.Therecoveryandcompositionof thecontrolwas quantified byHPLCas describedabove to determinethe most effectiveprocedure.Method 3thatis, cell lysis withNaOH (Extended Data Table 3)was found to be most effective and reprodu-cible, thus we further optimized it by resuspension of the pellets in ice-cold KPi(50mM,250 ml) beforeaddition of NaOHto decrease dephosphorylation aftercelllysis(Method4). Cell pellets were then processedas describedabove. Seeaboveforthe final extraction protocol.

Preparation of the unnatural insert for pINF construction. The TK-1-dNaM

oligonucleotidecontaining dNaM was prepared using solid-phase DNA synthesis

LETTER RESEARCH



6/17

with ultra-mild DNA synthesis phosphoramidites on CPG ultramild supports(1mmol, Glen Research, Sterling, Virginia, USA) and an ABI Expedite 8905 syn-thesizer. After the synthesis, the DMT-ON oligonucleotide was cleaved from thesolid support, deprotected and purified by Glen-Pak cartridge according to themanufacturersrecommendation (GlenResearch), and then subjected to 8 M urea8% PAGE. The gel was visualizedby ultravioletshadowing, the band correspondingto the75-merwas excised, andthe DNAwas recoveredby crush andsoak extraction,filtration (0.45mm), andfinal desalting over Sephadex G-25 (NAP-25Columns, GEHealthcare). The concentration of the single stranded oligonucleotide was deter-

mined byultraviolet absorptionat 260nm assuming thatthe extinctioncoefficient ofdNaM at 260 nm is equal to that of dA. TK-1-dNaM (4 ng) was next amplified byPCR under the following conditions: 13OneTaq reaction buffer, MgSO4adjustedto 3.0 mM, 0.2 mM of dNTP, 0.1 mM of dNaMTP, 0.1 mM of the d5SICSTP ana-logue dTPT3TP, 1mM of each of the primers pUC19-fusion-forward and pUC19-fusion-reverse, and0.02 Uml21 ofOneTaqDNAPolymerase(inatotalof43 50mlreactions)underthe followingthermalcycling conditions: initialdenaturation (96uC,1 min) followed by 12 cyclesof denaturation (96 uC, 10 s),annealing(60 uC,15s),andextension(68 uC, 2 min). An identical PCRwithout theunnatural triphosphateswas runto obtain fully natural insert under identical conditions for the constructionof thenatural control plasmid. Reactions were subjected to spin column purificationand then the desired PCR product (122 bp) was purified by a 4% agarose gel.

pUC19 linearization for pINF construction. pUC19 (20 ng) was amplified byPCR under the following conditions: 13Q5 reaction buffer, MgSO4adjusted to3.0 mM, 0.2 mMof dNTP, 1 mM of each primers pUC19-lin-forward and pUC19-lin-reverse, and 0.02 U ml21 of Q5 Hot Start High-Fidelity DNA Polymerase (in a

total of43 50ml reactionswith one reaction containing0.53 Sybr Green I) underthe following thermalcyclingconditions: initialdenaturation (98 uC,30 s); 20cyclesof denaturation (98 uC, 10 s), annealing (60uC, 15 s),and extension (72 uC,2 min);andfinalextension (72uC, 5 min). ThedesiredPCR product (2,611 bp)was purifiedby a 2% agarose gel.

PCR assembly of pINF and the natural control plasmid. A linear fragment wasamplified from pUC19 using primers pUC19-lin-forward and pUC19-lin-reverse.The resulting product(800 ng,4.63 10213 mol) wascombinedwith eitherthe nat-ural or unnaturalinsert (see above)(56 ng,7.03 10213 mol) andassembledby cir-cularoverlapextensionPCR under the followingconditions:13OneTaq reactionbuffer,MgSO4 adjustedto 3.0mM,0.2 mMof dNTP,0.1 mMof dNaMTP,0.1 mMof the d5SICSTP analogue dTPT3TP, and 0.02 U ml21 of OneTaq DNA Polymer-ase (in a total of4350ml reactions with onereaction containing0.53SybrGreenI)using the followingthermal cycling conditions: initial denaturation (96 uC,1min);12 cycles of denaturation(96 uC,30 s),annealing(62 uC, 1 min),and extension(68uC,

5 min); final extension(68u

C,5 min); and slowcooling (68u

C to1 0u

Catarateof 20.1 uC s21). The PCR product was analysed by restriction digestion on 1% aga-rose and used directly for E. colitransformation. The d5SICS analogue dTPT322

pairs with dNaM, anddTPT3TP was used in place of d5SICSTP as DNAcontain-ing dTPT3dNaM is better PCR amplifiedthan DNA containingd5SICSdNaM,andthis allowedfor differentiationof synthetic and invivo replicatedpINF, as wellas facilitated the construction of high-quality pINF (UBP content .99%).

Preparation of electrocompetent cellsfor pINFreplication in E. coli. C41(DE3)cellswere transformed by heatshock34 with 200ng ofpACSplasmid, andthetrans-formants were selected overnight on 23YT-agar supplemented with streptomy-cin.A single cloneof freshly transformed C41(DE3)pACS was grown overnightin23YT medium (3 ml) supplemented with streptomycin and KPi (50 mM). After100-fold dilution into thesame fresh 23YT media (300 ml), the cells were grownat 37 uC until they reached an OD600of 0.20 at which time IPTG was added to afinal concentration of 1 mMto inducethe expression ofPtNTT2.Cells weregrownforanother40 minand then growthwas stopped by rapidcoolingin icewaterwith

intensive shaking.Aftercentrifugation in a prechilled centrifuge(2,400r.c.f.for 10 min,4 uC), the spent media was removed, and the cells were prepared for electropora-tion by washing with ice-cold sterile water (33 150 ml). After washing, the cellswere resuspended in ice-cold 10% glycerol (1.5 ml) and split into 50-ml aliquots.Althoughwe foundthat dryice yielded betterresults thanliquidnitrogenfor freezingcells to store for later use, freshly prepared cells were used for all reported experi-ments as they provided higher transformation efficiency of pINF and higher rep-lication fidelity of the UBP.

Electroporation and recovery for pINFreplication in E. coli. Thealiquot ofcellswas mixed with2 ml of plasmid (400 ng), transferredto 0.2cm gapelectroporationcuvette and electroporated using a Bio-Rad Gene Pulser according to the manu-facturers recommendations (voltage 25 kV, capacitor 2.5 mF, resistor 200 V, timeconstant 4.8ms). Pre-warmed 23YT media (0.95 ml,streptomycin,1 mM IPTG,50 mM KPi) was added, and after mixing, 45 ml was removed and combined with105ml of thesame media (3.33-folddilution)supplementedwith 0.25mM of dNaMTPand d5SICSTP. The resulting mixture was allowed to recover for 1 h at 37 uC with

shaking (210 revolutions per min (r.p.m.)). The original transformation media

(10ml)wasspreadonto23YT-agar containingstreptomycin with10- and 50-folddilutions for the determinationof viablecolony forming unitsafter overnightgrowthat37 uC to calculate the number of the transformedpINF molecules (see the sectionon calculation of the plasmidamplification).Transformation, recoveryand growthwere carried outidentically forthe natural control plasmid. In addition,a negativecontrol was run and treated identically to pINF transformation except that it wasnotsubjected to electroporation (Extended DataFig. 7b).No growth in theuntrans-formed negative control samples was observed even after 6 days. No PCR amp-lification of the negative control was detected, which confirms that unamplified

pINF plasmid is not carried through cell growth and later detected erroneously asthe propagated plasmid.

Analysis of pINF replication inE. coli. After recovery, the cells were centrifuged(4,000r.c.f. for5 min, 4 uC), and spent media (0.15 ml)was removed andanalysedfor nucleotide composition by HPLC (Extended Data Fig. 7a). The cells were resus-pended infresh23YT media (1.5 ml,streptomycin, ampicillin, 1 mM IPTG, 50 mMKPi, 0.25 mM dNaMTP, 0.25 mM d5SICSTP)and grown overnight at 37 uC whileshaking (250 r.p.m.), resulting in tenfold dilution compared to recovery media or33.3-fold dilution compared to the originally transformed cells. Aliquots (100 ml)weretakenafter15,19,24,32,43,53,77and146h,OD600was determined, and thecells were centrifuged (8,000 r.c.f. for 5 min, 4 uC). Spent media were analysed fornucleotide composition by HPLC(ExtendedData Fig.7a), andthe pINFand pACSplasmid mixtures were recovered andlinearized with NdeIrestriction endonuclease;pINF plasmid waspurified by1% agarosegel electrophoresis (ExtendedData Fig. 7b)and analysed by LC-MS/MS. The retention of the UBP on the pINF plasmid wasquantified by biotin gel shift mobility assay and sequencing as described below.

Mass spectrometry of pINF.Linearized pINFwas digested to nucleosidesby treat-mentwith a mixture of nuclease P1 (Sigma-Aldrich), shrimp alkaline phosphatase(NEB), and DNase I (NEB), overnight at 37 uC, following a previously reportedprotocol25. LC-MS/MS analysis was performed in duplicate by injecting 15 ng ofdigested DNA on an Agilent 1290 UHPLC equipped with a G4212A diode arraydetector and a 6490A Triple Quadrupole Mass Detector operating in the positiveelectrospray ionizationmode (1ESI).UHPLCwas carried outusing a WatersXSelectHSS T3 XP column (2.13 100 mm, 2.5 mm) with the gradient mobile phase con-sisting of methanol and 10 mM aqueous ammonium formate (pH 4.4). MS dataacquisition was performed in Dynamic Multiple Reaction Monitoring (DMRM)mode. Each nucleoside was identified in the extracted chromatogram associatedwith itsspecificMS/MStransition: dA at m/z252R136, d5SICSat m/z292R176,and dNaM atm/z275R171. External calibration curves with known amounts ofthe natural and unnatural nucleosides were used to calculate the ratios of indivi-dualnucleosides withinthe samples analysed. LC-MS/MS quantificationwas vali-

dated using synthetic oligonucleotides

1

containing unnatural d5SICS and dNaM(Extended Data Table 2).

DNA biotinylation by PCR to measure fidelity by gel shift mobility assay.Purified mixtures of pINF and pACS plasmids (1 ng) from growth experimentswere amplified by PCR under the following conditions: 13OneTaq reaction buf-fer, MgSO4 adjusted to 3.0 mM, 0.3 mM of dNTP, 0.1 mM of the biotinylateddNaMTP analogue dMMO2SSBIOTP, 0.1 mM of d5SICSTP, 1mM of each of theprimerspUC19-seq-forward and pUC19-seq-reverse,0.02 Uml21 of OneTaqDNAPolymerase, and 0.0025 U ml21 ofDeepVentDNA Polymerase ina total volumeof25ml in an CFX Connect Real-Time PCR Detection System (Bio-Rad) under thefollowingthermal cycling conditions: initial denaturation (96 uC,1 min); 10cyclesof denaturation (96 uC, 30 s),annealing(64 uC, 30 s),and extension(68 uC,4 min).PCR products were purified, and the resulting biotinylated DNA duplexes (5 ml,2550 ng) were mixed with streptavidin (1 ml, 1 mgml21, Promega) in phosphatebuffer(50mM sodiumphosphate, pH7.5,150mM NaCl,1 mMEDTA),incubatedfor 30 min at 37 uC, mixed with 53non-denaturing loading buffer (Qiagen), and

loaded onto 6% non-denaturingPAGE. Afterrunning at 110 V for 30 min, the gelwas visualized andquantified.The resultingfragment (194bp) withprimerregionsunderlined and the unnatural nucleotide in bold (X represents dNaM or its bioti-nylated analogue dMMO2SSBIO) is 59-GCAGGCATGCAAGCTTGGCGTAATCATGG TCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAXTTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAG.

Streptavidin shift calibrationfor gelshift mobilityassay. We havealreadyreporteda calibration between streptavidin shift and the fraction of sequences with UBP inthe population (seeSupplementary Fig.8 of ref.1). However,we found thatspikingthe PCR reaction with DeepVent improves the fidelity with which DNA contain-ing d5SICS-dMMO2SSBIO is amplified, and thus we repeated the calibration withadded DeepVent. To quantify the net retention of the UBP, nine defined mixturesof theTK-1-dNaM templateand itsfullynaturalcounterpart wereprepared(ExtendedDataFig.6a), subjected to biotinylationby PCRand analysedby mobility-shiftassay

on 6% non-denaturing PAGE as described above. For calibration, the mixtures

RESEARCH LETTER



7/17

TK-1-dNaM template and its fully natural counterpart with a known ratio ofunnatural and natural templates (0.04 ng) were amplified under the same condi-tionsover ninecycles of PCR withpUC19-fusionprimers and analysed identicallyto samplesfrom the growth experiment (see the section on DNA biotinylation byPCR).Each experiment wasrun intriplicate (arepresentative gelassayis showninExtended DataFig.6b),and thestreptavidin shift(SAS,%) wasplottedas functionof the UBP content (UBP, %). The data was then fit to a linear equation, SAS50.773UBP 1 2.0 (R25 0.999), where UBP corresponds to the retention of theUBP(%) inthe analysed samples aftercellular replicationand wascalculated from

the SAS shift using the equation above.Calculation of plasmid amplification. The cells were plated on 23YT-agarcontaining ampicillin and streptavidin directly after transformation with pINF,andthe colonies were counted after overnightgrowth at 37 uC. Assumingeach cellis onlytransformedwith onemoleculeof plasmid,colony counts correspond to theoriginal amount of plasmid that was taken up by the cells. After overnight growth,theplasmidswere purifiedfrom a specificvolumeof the cellcultureand quantified.As purified plasmid DNA represents a mixture of the pINF and pACS plasmids,digestion restriction analysis with NdeI exonuclease was performed to linearizebothplasmids, followedby 1% agarose gel electrophoresis (ExtendedData Fig.7b).An example of calculations for the 19-h time point with one of three triplicates isprovided in Supplementary Information.Fragment generation for Sanger sequencing to measure fidelity.Purified mix-tures of pINF andpACS plasmids (1ng) after theovernight growthwereamplifiedby PCRunder the followingconditions:13OneTaq reaction buffer,MgSO4 adjustedto 3.0 mM, 0.2 mM of dNTP, 0.1 mM of dNaMTP, 0.1 mM of the d5SICSTP ana-

logue dTPT3TP, 1mM of each of the primers pUC19-seq2-forward and pUC19-seq-reverse (see below), and 0.02 Uml21 of OneTaq DNA Polymerase in a total

volume of 25 ml under the following thermal cycling conditions: initial denatura-tion(96 uC,1 min);and 10cycles ofdenaturation (96uC,30 s),annealing(64 uC,30s),andextension(68 uC, 2 min). Productswere purifiedby spincolumn,quantifiedtomeasure DNA concentration and then sequencedas describedbelow. The sequencedfragment (304bp) withprimer regions underlinedand the unnatural nucleotideinbold (X,dNaM) is 59-GCTGCAAGGCGATTAAGTTGGGTAACGCC AGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAXTTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAG.Sanger sequencing.The cycle sequencing reactions (10ml) were performed on a9800 Fast ThermalCycler(AppliedBiosystems) withthe CycleSequencingMix (0.5ml)

of the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) con-taining 1 ng template and6 pmol of sequencing primerpUC19-seq-reverseunderthe following thermal cycling conditions: initial denaturation (98 uC, 1 min); and25 cycles of denaturation (96uC,10s),annealing(60 uC,15s),andextension(68uC,2.5 min). Upon completion, the residual dye terminators were removed from thereaction with Agencourt CleanSEQ (Beckman-Coulter, Danvers, Massachusetts,

USA). Products were eluted off the beads with deionized water and sequenceddirectly on a 3730 DNA Analyzer (Applied Biosystems). Sequencing traces werecollected using Applied Biosystems Data Collection software v3.0 and analysedwith the Applied Biosystems Sequencing Analysis v5.2 software.

Analysis of Sanger sequencingtraces. Sanger sequencing traceswere analysed asdescribed previously1,26 to determinethe retentionof theunnatural base pair. In brief,thepresenceof an unnaturalnucleotideleads to a sharpterminationof thesequencingprofile,whereas mutation to a natural nucleotide results in read-through.The extentof this read-through after normalization is inversely correlated with the retention

of the unnatural base pair. Raw sequencing traces were analysed by first adjustingthestart andstop points forthe Sequencing Analysissoftware(Applied Biosystems)andthen determining the average signal intensityindividually for eachchannel (A,C, G and T) for peaks within the defined points. This was done separately for theparts of thesequencing trace before(section L) and after (section R) theunnaturalnucleotide. TheR/Lratio after normalization (R/L)normfor sequencing decay andread-through in the control unamplified sample (R/L5 0.55(R/L)norm 1 7.2, seeref. 26 for details) corresponds to the percentage of the natural sequences in thepool. Therefore, an overall retention(F) of theincorporationof theunnatural basepair during PCR is equal to 1 (R/L)norm. As significant read-through (over 20%)was observed in the direction of the pUC19-seq2-forward primer even with thecontrol plasmid (synthetic pINF); sequencing of only the oppositedirection(pUC19-seq-reverse)was used to gauge fidelity.Raw sequencing tracesare shown in Fig. 2fand provided as Supplementary Data.

30. Ludwig, J. & Eckstein, F. Rapid and efficient synthesis ofnucleoside

59-0-(1-thiotriphosphates), 5

9-triphosphates and 2,3

9-cyclophosphorothioatesusing 2-chloro-4H-1,3,2-benzodioxaphosphorin-4-one.J. Org. Chem.54,

631635 (1989).31. Alpert, A. & Shukla, A. Precipitation of Large, High-Abundance Proteins from

Serum withOrganic SolventsinABRF 2003:TranslatingBiology usingProteomicsand Functional Genomics Poster no. P111-W http://www.abrf.org/Other/ABRFMeetings/ABRF2003/Alpert.pdf (2003).

32. Kubitschek, H. E. & Friske, J. A. Determination of bacterial cell volume with theCoulter Counter.J. Bacteriol.168, 14661467 (1986).

33. Yanes, O., Tautenhahn, R., Patti, G. J. & Siuzdak,G. Expanding coverage of themetabolomefor global metaboliteprofiling.Anal.Chem. 83, 21522161 (2011).

34. Seidman,C. E., Struhl, K.,Sheen, J.& Jessen,T. Introductionof plasmid DNAintocells.Curr. Prot. Mol. Biol. Chapter 1, Unit 1.8 (2001).

35. Knab, S., Mushak, T. M., Schmitz-Esser, S., Horn, M. & Haferkamp, I. Nucleotideparasitism bySimkania negevensis (Chlamydiae).J. Bacteriol. 193, 225235(2011).

36. Audia, J. P. & Winkler, H. H. Study of the fiveRickettsia prowazekiiproteinsannotated as ATP/ADP translocases (Tlc): OnlyTlc1 transports ATP/ADP, whileTlc4 and Tlc5 transport other ribonucleotides.J. Bacteriol. 188,62616268

(2006).37. Hofer,A., Ekanem,J. T.& Thelander,L. Allostericregulationof Trypanosomabrucei

ribonucleotide reductase studied in vitro and in vivo.J. Biol. Chem.273,3409834104 (1998).

38. Reijenga, J. C., Wes, J. H. & van Dongen, C. A. M. Comparison of methanoland perchloric acid extraction procedures for analysis of nucleotidesby isotachophoresis.J. Chromatogr. B Biomed. Sci. Appl. 374, 162169 (1986).

LETTER RESEARCH

http://www.abrf.org/Other/ABRFMeetings/ABRF2003/Alpert.pdfhttp://www.abrf.org/Other/ABRFMeetings/ABRF2003/Alpert.pdfhttp://www.abrf.org/Other/ABRFMeetings/ABRF2003/Alpert.pdfhttp://www.abrf.org/Other/ABRFMeetings/ABRF2003/Alpert.pdf


8/17

ExtendedData Figure 1 | Natural triphosphateuptake by NTTs. a, Surveyofreported substrate specificity (KM,mM) of the NTTs assayed in this study.b, PtNTT2 is significantly more activein theuptake of [a-32P]-dATP comparedto other nucleotide transporters. Raw (left) and processed (right) data areshown. Relative radioactivity corresponds to the total number of countsproducedby each sample. Interestingly,both PamNTT2 andPamNTT5 exhibit

a measurable uptake of dATP although this activity was not reported before.This can possibly be explained by the fact that substrate specificity was onlycharacterized using competition experiments, and assay sensitivity mightnot have been adequate to detect this activity15. References 35, 36 are cited inthis figure.

RESEARCH LETTER



9/17

Extended Data Figure 2| Degradation of unnatural triphosphates ingrowth media. Unnatural triphosphates (3P) of dNaM and d5SICS aredegraded to diphosphates (2P), monophosphates (1P) and nucleosides (0P) inthe growing bacterial culture. Potassium phosphate (KPi) significantly slows

down the dephosphorylation of both unnatural triphosphates.a, Representative HPLC traces (for the region between ,20 and 24min).dNaM and d5SICS nucleosides are eluted at approximately 40 min and notshown.b, Composition profiles.

LETTER RESEARCH



10/17

Extended Data Figure 3| Effect of potassium phosphate on dATP uptakeand stability in growth media. a, KPi inhibits the uptake of [a-32P]-dATP atconcentrations above 100mM. Raw(left) andprocessed (right) data areshown.TheNTT from Rickettsiaprowazekii (RpNTT2) does notmediate theuptake ofany of the dNTPs and was used as a negative control: its background signalwas subtracted from those ofPtNTT2 (black bars) andTpNTT2 (white bars).Relative radioactivity corresponds to the total number of counts produced byeach sample.b, KPi (50 mM) significantly stabilizes [a-32P]-dATP in themedia. Triphosphate stability in the media is not significantly affectedby the nature of the NTT expressed. 3P,2P and1P correspond to triphosphate,diphosphate and monophosphate states, respectively. Error bars represents.d. of the mean, n5 3.

RESEARCH LETTER



11/17

Extended Data Figure 4| dATP uptake and growth of cells expressingPtNTT2 as a function of inducer (IPTG) concentration. Growth curves and[a-32P]-dATP uptake by bacterial cells transformed with pCDF-1b-PtNTT2(pACS) plasmid as a function of IPTG concentration. a, Total uptake ofradioactive substrate (left) and total intracellular triphosphate content (right)are shownat two different timepoints. Relative radioactivity corresponds to the

total number of counts produced by each sample.b, A stationary phase cultureof C41(DE3) pACS cells was diluted 100-fold into fresh 23YT mediacontaining 50 mM KPi, streptomycin, and IPTG at the indicatedconcentrations and were grown at 37uC. Error bars represent s.d. of themean,n5 3.

LETTER RESEARCH



12/17

Extended Data Figure 5| Stability and uptake of dATP in the presence of

50 mM KPi and 1 mM IPTG. Composition of [a-32

P]-dATP in the media(left) and cytoplasmic fraction (right) as a function of time. TLC images andtheir quantifications are shown at the bottom and the top of each of the panels,

respectively.3P, 2P and 1P correspondto nucleoside triphosphate,diphosphate

and monophosphate,respectively. M refers to a mixture of all threecompoundsthat was used as a TLC standard. The position labelled Start corresponds tothe position of sample spotting on the TLC plate.

RESEARCH LETTER



13/17

Extended Data Figure 6| Calibration of the streptavidin shift (SAS). a, TheSAS is plotted as a function of the fraction of template containing the UBP.Error bars represent s.d. of the mean, n5 3.b,Representative data.SA, streptavidin.

LETTER RESEARCH



14/17

Extended Data Figure 7| Decomposition of unnatural triphosphates, pINFquantification, and retention of the UBP with extended cell growth.a, Dephosphorylation of the unnaturalnucleoside triphosphate. 3P, 2P, 1P and0P correspond to triphosphate, diphosphate, monophosphate and nucleosidestates, respectively. The composition at the end of the 1 h recovery is shown atthe right.b, Restriction analysis of pINF and pACS plasmids purified fromE. coli, linearized with NdeI restriction endonuclease and separated on a 1%agarose gel (assembled from independent gel images). Molar ratios of pINF/pACS plasmids areshown at thetop of each lane. Foreach time point,triplicate

data are shown in three lanes with the untransformed control shown in thefourth, rightmost lane (see Methods).c, Number of pINF doublings as afunction of time. The decrease starting at approximately 50 h is due to the lossof thepINF plasmid that also results in increasederror. Seethe section on pINFreplication inE. coliin the Methods for details. d, UBP retention (%) as afunction of growth as determined bygel shift (data shown in Fig. 3) andSangersequencing (sequencing traces are available as Supplementary Data). In a,candd, error shown is the s.d. of mean,n5 3.

RESEARCH LETTER



15/17

Extended Data Table 1| OD600of E. colicultures and relative copynumber of plasmid (pINF or control pUC19) as determined by itsmolar ratio to pACS after 19 h of growth

X, NaM; Y, 5SICS.

LETTER RESEARCH



16/17

Extended Data Table 2| Relative quantification by LC-MS/MS using synthetic oligonucleotides containing d5SICS and dNaM

*dA/d5SICS and dA/dNaM ratios were calculated assuming that randomized nucleotides (N) around the unnatural base are distributed equally.

RESEARCH LETTER



17/17

Extended Data Table 3| Summary of the most successful extraction methods

*Recovery of all nucleotides (3P, 2P, 1P and nucleoside).

{Calculated as a ratio of 3P composition (%) before and after the extraction.

References 37, 38 are cited in this figure. Details of methods 3 and 4 can be found online ( http://2013.igem.org/wiki/images/e/ed/BGU_purelink_quick_plasmid_qrc.pdf).

LETTER RESEARCH
http://2013.igem.org/wiki/images/e/ed/BGU_purelink_quick_plasmid_qrc.pdfhttp://2013.igem.org/wiki/images/e/ed/BGU_purelink_quick_plasmid_qrc.pdf

Documents

__A Semi-synthetic Organism With an Expanded Genetic Alphabet Malyshev2014