A revised manuscript of JCM01016-10 (Version 3 · 113 the cells were collected when 90% of the cells displayed a cytopa thic effect (CPE). 114 L15 medium containing GF-1 cells and

1

A revised manuscript of JCM01016-10 (Version 3) 1

Real-time quantitative polymerase chain assay for monitoring of nervous 2

necrosis virus infection in grouper aquaculture 3

Hsiao-Che Kuo1,2,3§, Ting-Yu Wang

1§, Peng-Peng Chen1, Young-Mao Chen

1,2,3, 4

Hui-Ching Chuang1, and Tzong-Yueh Chen

1,2,3*

5

6

1Laboratory of Molecular Genetics, Institute of Biotechnology, College of Bioscience 7

and Biotechnology, 2Research Center of Ocean Environment and Technology, and 8

3Agriculture Biotechnology Research Center, National Cheng Kung University, 9

Tainan, Taiwan 10

§These authors contributed equally to this work. 11

12

Running title: Live virus monitoring in grouper fin tissue 13

14

*Corresponding author: 15

Dr. Tzong-Yueh Chen 16

Laboratory of Molecular Genetics, Institute of Biotechnology, College of Bioscience 17

and Biotechnology, National Cheng Kung University, Tainan 70101, Taiwan 18

Phone: 886-6-2757575 ext. 65622 ext. 610 19

Fax: 886-6-2766505 20

E-mail: [email protected] 21

22

Number of words in abstract: 177 23

Number of words in text: 3850 24

Number of figures: 7 25

Number of tables: 1 26

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.01016-10 JCM Accepts, published online ahead of print on 12 January 2011

on March 23, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

2

Abstract 27

Viral nervous necrosis caused by nervous necrosis virus (NNV), exacts a high 28

mortality and results in huge economic loses in grouper aquaculture in Taiwan. The 29

present study developed a real-time quantitative polymerase chain reaction (RT-qPCR) 30

method for NNV monitoring. The assay showed a strong linear correlation (r2

= 0.99) 31

between CT and RNA quantities, which allowed identification of infected groupers by 32

the CT value and could be exploited to warn of NNV infection prior to an outbreak in 33

grouper fish farms. Similar to primary tissues, RT-qPCR also confirmed the copious 34

content of NNV; the result was verified by using in situ reverse transcriptase-PCR. 35

This indicated that grouper fin was a suitable sample for NNV detection, in a manner 36

that could be relatively benign to the fish. The rapid spread of NNV infection to the 37

entire population of affected farms was evident. The developed RT-qPCR method is 38

rapid, highly sensitive and applicable to routine high-throughput detection of a large 39

numbers of samples, and has potential as a suitable tool for diagnostic, 40

epidemiological and genetic studies in grouper aquaculture. 41

42

Keywords: nervous necrosis virus; Epinephelus spp.; real-time quantitative PCR; 43

diagnosis 44


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

3

1. Introduction 45

More than 50 different species of grouper inhabit the tropical waters around Taiwan; 46

some have been farmed since 1979. Key aquaculture techniques on an industrial scale 47

have been well-established. During that time, considerable economic losses have been 48

sustained in grouper aquaculture due to infection of grouper by piscine nodavirus 49

belonging to family Nodaviridae and genus Betanodavirus (2). The infection causes 50

viral nervous necrosis (VNN) in Asia (24) and viral encephalitis and retinopathy in 51

Europe (27) on grouper hatchery-reared larvae and juveniles, resulting in a high 52

mortality rate (80-100%). This pathogen can also infect a wide range of marine fish 53

species globally (15, 16, 24). 54

Most Betanodavirus are neuropathogenic viruses that cause damage throughout 55

the central nervous system, which can be characterized by vacuolation and 56

degeneration of neurons (14, 22). The clinical signs of VNN infected larval-stage 57

grouper are abnormal schooling and swimming behaviour (whirling, spiralling), and 58

loss of appetite. The Betanodavirus genome is segmented and consists of two to three 59

segments (RNA1, RNA2 and RNA3) of linear positive-sense, single-stranded RNA (9, 60

14). RNA1 (3,100 bp) encodes protein A, which is the viral part of the 61

RNA-dependent RNA-polymerase. RNA2 (1,400 bp) encodes the capsid protein (12, 62

17). RNA3, a subgenomic transcript of RNA1, encodes protein B2 and is present only 63

in the nucleus of a virus infected cell but not in the viron (7, 26). 64

Current diagnostic detection methods for nervous necrosis virus (NNV) are 65

based on histopathology and polymerase chain reaction (PCR). PCR is the most 66

sensitive and commonly used, but suffers from a limited ability to detect low copy 67

numbers of the viral genome in infected tissue. Detection and quantification of viral 68

RNA by reverse-transcription PCR (RT-PCR) and quantitative real-time PCR 69


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

4

(RT-qPCR) have been very popular due to their high sensitivity and reliable 70

specificity (1, 8, 13). Successful detection of viral RNA requires control of the 71

variation of the initial amount of RNA from samples, the amount and integrity of 72

isolated RNA and the efficiency of the RT-PCR protocol (8). 73

In this study, a highly sensitive RT-qPCR method and a novel approach that 74

allows quantification of NNV RNA2 from living groupers was developed. Visual 75

inspection of the melting curve (23) revealed the results immediately without any 76

further analyses. Using quantitative methods specific for viral pathogens in 77

aquaculture allows for the collect of valuable information and contributes to 78

knowledge of viral epidemiology in this case, provides an early warning of NNV 79

infection prior to disease outbreak and can be exploited in monitoring the 80

transportation of live and frozen grouper fish between countries. The present method 81

may represent a valuable tool for diagnostic, epidemiological and genetic studies in 82

grouper aquaculture. 83 on March 23, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

5

2. Materials and methods 84

Fish samples, tissues and cells 85

Twenty-four different grouper aquaculture farms in eight different areas of southern 86

Taiwan (Fig. 1, Table 1) were sampled. The 144 groupers that were collected were 87

transported alive to a laboratory at National Cheng Kung University (Fig. 1). Six 88

random asymptomatic groupers ranging in size from 0.5–3 inches were obtained from 89

the individual grouper aquaculture farms. These fish were maintained in a 1 × 0.5 × 90

0.5 m3 fish tank with constant aeration and a water temperature of 28 ± 2°C for 2 91

weeks. A commercial diet was fed daily to satiation. Initially, groupers from the same 92

fish farm were maintained as a group, resulting in 24 groups. 93

Samples of brain, eye, gill, fin, head kidney, heart, intestine, liver, muscles and 94

spleen tissues from were obtained from juvenile fish that displayed clinical signs of 95

NNV infection. The infected juvenile grouper fish were collected from three different 96

grouper aquaculture farms in Kunshen in 2004. The experiments were repeated three 97

times and five diseased juvenile groupers were collected from individual fish farms 98

for each experiment. 99

Grouper fin cells (GF-1, BCRC 960094) were obtained from the Bioresources 100

Collection and Research Center (BCRC) in Taiwan. Grouper liver cells (GLa) and 101

grouper kidney cells (GK) were kindly supplied by Dr. H.L. Yang, National Cheng 102

Kung University, Taiwan. The cells were grown in a humidified incubator operating 103

at 28°C in an antibiotic-free L15 medium (Life Technologies, Carlsbad, CA, USA) 104

supplemented with 5% v/v heat-inactivated fetal bovine serum (FBS) (3). 105

Virus isolation and purification 106

Grouper NNV (gNNV) were isolated from naturally infected groupers (Epinephelus 107

lanceolatu) collected in 2004 in Jiading, Taiwan (22). Virus was isolated from fin 108


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

6

tissue. The tissues were frozen in liquid nitrogen and homogenated in 10 volumes of 109

L15 medium, centrifuged at 10,000 rpm for 20 min, and the supernatant fraction was 110

passed through a 0.22 µm filter and stored at -80°C until used. 111

For collection of virus particles, the isolated virus was cultured in GF-1 cells and 112

the cells were collected when 90% of the cells displayed a cytopathic effect (CPE). 113

L15 medium containing GF-1 cells and NNV were mixed with 2.2 % NaCl and 5% 114

polyethylene glycol (PEG)8000 (w/v) and centrifuged at 10,000 × g for 1 h at 4 °C. 115

The pellet was resuspended in 2 ml TES buffer, mixed with an equal amount of Freon 116

113 and shaken vigorously for 5 min. Supernatants were combined and mixed with 3 117

ml, 3 ml and 2 ml of 40%, 30% and 20% of CsCl, respectively. CsCl 118

density-gradients were formed by centrifugation in a Beckman SW40Ti rotor 119

(Beckman Coulter, Fullerton, CA, USA) at 35,000 r.p.m. for 16 h at 4 °C. Syringes 120

were used to collect 3 ml of the virus-containing fraction, which was diluted 10-fold 121

using TES buffer. 122

Primer design for amplification of NNV coat protein fragment 123

The primer pair (203-F GACGCGCTTCAAGCAACTC and 203-R 124

CGAACACTCCAGCGACACAGCA) was designed by alignment of 18 different 125

NNV coat protein cDNA sequences (Supplementary Table 1) from the National 126

Center for Biotechnology Information (NCBI). Two consensus sequences targeting 127

the coat protein gene (RNA2) were chosen by using the Primer Express Software 128

version 1.0 (Applied Biosystems, Foster City, CA, USA) to amplify 203 bps for 129

RT-qPCR. 130

RNA isolation, cDNA synthesis, RT-PCR and virus copy number 131

A piece of fin tissue sampled from each grouper was subjected to the following RNA 132

extraction procedure. RNA extraction from the homogenated fin tissue and pure NNV 133


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

7

particles was performed using TRIzol™ reagent (Invitrogen, Valencia, CA, USA) 134

according to the manufacture’s protocol. Briefly, for 100 mg tissue, 1 ml TRIzol 135

regent and an additional 200 µl of ice-cold chloroform was added. Isopropanol was 136

used to precipitate RNA and the RNA pellet was then resuspended in 137

diethylpyrocarbonate-treated water. 138

Reverse-transcription was performed by Moloney Murine Leukemia Virus 139

(M-MLV) reverse transcriptase (Promega, Madison, WI, USA) according to the 140

manufacture’s protocol. Two micrograms of the extracted total RNA was used as 141

template and specific primers pairs (203-F and 203-R) were used for PCR, which 142

involved 94 °C for 5min and 35 cycles of 94 °C for 40 sec, 55 °C for 40 sec, 72 °C for 143

40 sec and 72 °C for 5 min. 144

RNA samples isolated from purified virus and cDNA were quantified using an 145

Ultrospec 3300 Pro spectrophotometer (Amersham Biosciences, Piscataway, NJ, USA) 146

and dilutions were made using sheared salmon sperm DNA (5 ng ml-1

) as a diluent. 147

The plasmid with virus gene (RNA 2) was used as a standard for calculation of viral 148

copy number. The viral copy number was identified by the molecular weight (one 149

virus particle = 1.5 × 106 [= 4542 (bps) × 330(Da)]) of the virus. For 1 µg µl

-1 of viral 150

RNA, there are 6.66 × 10-13

(= 1000 × 10-9

/1.5 × 106) viral moles, which is equal to 151

4.0 × 1011

(= 6.66 × 10-13

× 6.023 × 1023

) virus copies. 152

RT-qPCR 153

The 203 bp PCR product from NNV coat protein cDNA (RNA2) was cloned into a 154

pGEM-T Easy vector (Promega). RT-qPCR was carried out using a GeneAmp 2700 155

Thermocycler coupled with a GeneAmp®

7000 Sequence Detection System (Applied 156

Biosystems) in wells of a 96 well plate. Each well contained 12.5 µl of 2 × SYBR®

157

Green Master Mix (Applied Biosystems), 5 µM each of forward and reverse primers 158


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

8

and 2 µl cDNA, for a final volume of 25 µl. The thermal profile for RT-qPCR was 1 159

cycle of 95 °C for 2 min; 40 cycles of 95 °C for 15 s and 60 °C for 1 min; and 72 °C 160

for 20 s. 161

In situ reverse transcriptase-PCR 162

Fin tissues from both healthy and infected 3-inch-long groupers were fixed overnight 163

in freshly prepared 10% formaldehyde solution and embedded in paraffin. Four 164

micron-thick sections were cut using a Leica CM 1900 microtome (Leica 165

Microsystems, Nussloch, Germany), mounted on a polylysin-coated slide, 166

deparaffinized in xylene for 5 min and dehydrated with a graded series of ethanol 167

solutions (30, 50, 70, 85, 95, and 3 × 100%; each containing 0.85% NaCl). Tissues 168

were then stained with hematoxylin-eosin (H&E). In situ RT-PCR was modified a 169

previously described regimen (21) and was done using a DIG Probe Synthesis Kit 170

and DIG Nucleic Acid Detection Kit (Roche Applied Science, Mannheim, 171

Germany) following the manufacturer’s instructions. The sections were visualized 172

using an Axiovert 40 microscope (Carl Zeiss, Gottingen, Germany) and images were 173

captured using an SPOT RT3TM

camera (Spot Imaging Solutions, Sterling Heights, 174

MI, USA). 175

Evaluation of RT-qPCR data 176

RT-qPCR data were analyzed by the 7000 Sequence Detection System (ver. 1.0). In 177

the system, the fluorescence of SYBR Green against the internal passive reference dye, 178

ROX (∆Rn) is measured at the end of each cycle. A sample is considered positive 179

when ∆Rn exceeds the threshold value. The threshold value is set at the midpoint of 180

∆Rn vs. cycle number plot. For all the amplifications described in this study, the 181

threshold value of ∆Rn was set as 0.25. The threshold cycle (CT) is defined as the 182

cycle at which a statistically significant increase in Rn is first detected. Target cDNA 183


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

9

copy number and CT values are inversely proportional. Compared to a sample with 184

low copy number of the target gene, a sample which contains high copy number of the 185

same gene will cross the threshold at an earlier cycle. The copy number of NNV 186

sample is determined by normalizing the CT values of the samples and then 187

extrapolating the normalized CT values to the standard curve of the corresponding 188

virus (Supplementary Fig. 1, Supplementary Tables 2 and 3). 189


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

10

3. Results 190

Specificity test of designed primer pair 191

The designed primer pair (203-F and 203-R) was specific to grouper NNV coat 192

protein gene (Fig. 2A) and produced no PCR artifacts and primer dimers (Fig. 2A, 193

lane N). Other grouper pathogens such as iridovirus and Vibrio anguillarum, and 194

grouper fish genomes (E. coioides, E. lanceolantus and E. fuscoguttatus genomes 195

from non-NNV infected fish) were not amplified by the primer pair (Fig. 2A). 196

Sensitivity test of the conventional PCR assay on gel 197

The analytical sensitivity of PCR was initially optimized using a plasmid 198

(pGEM-T-NNV) containing NNV coat protein gene or cDNA obtained from viral 199

RNA. PCR and RT-PCR detection limitation on plasmid (Fig. 2B) and virus particles 200

(Fig. 2C), respectively, revealed that use of 10-fold serial dilutions of pGEM-T-NNV 201

and virus particles as templates permitted detection of as few as 100 cDNA copies 202

(Fig. 2B) and 1,900 virus copies (Fig. 2C). 203

Sensitivity test of the real time-qPCR assay 204

For RT-qPCR, the melting curve was 85 °C for the 203F and 203R primer pair. The 205

standard curve was generated by 10-fold dilutions of the plasmid (1 × 109 to 1 × 10

1 206

copies; Supplementary Fig. 1A and Supplementary Table 2)/virus (1.9 × 1010

to 1.9 × 207

102

copies; Supplementary Fig. 1B and Supplementary Table 3) and accurate 208

measurement of the assay was evaluated by linearity parameters; e.g., assay 209

regression coefficient (r2) > 0.99 and 100% reaction efficiency. In addition, the mean 210

CT values of replicate assays ranged from 5.17 ± 0.09 (for 1 × 109 copies) and 6.09 ± 211

0.06 (for 1.9 × 1010

copies) to 36.01 ± 0.66 (for one copy) for plasmid DNA and 36.52 212

± 1.65 (for 1.9 × 102copies) for viral cDNA, respectively (Supplementary Figs. 1A 213

and 1B, Supplementary Tables 2 and 3). Serial dilutions of plasmid DNA/viral cDNA 214


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

11

were used to examine the variability of the RT-qPCR assay in satisfying the value of 215

coefficient of variation (CV). CV was 0.9%–6.34% for the plasmid assay 216

(Supplementary Fig. 1A and Supplementary Table 2) and 0.34%–5.07% for the viral 217

assay (Supplementary Fig. 1B and Supplementary Table 3). 218

NNV spread in fish farm populations 219

During the investigation of NNV infection of 24 different grouper aquaculture farms, 220

which involved monitoring the same fish for 2 weeks in the laboratory, fin tissue 221

samples from the first sampling day (test result) and two weeks later (tracking test 222

result) were subjected to RT-qPCR analysis. The results revealed the rapid spread of 223

NNV to contaminate the entire tank within the 2 week period (Table 1). In fish 224

farms/tanks #11 and #19, only one in six (16.6%) grouper fish were identified as 225

NNV-infected by RT-qPCR in the test result, whereas the tracking test results for both 226

samples was 100% within 2 weeks. In fish farms/tanks #5, #8 and #17, no NNV (0%) 227

was detected from random collected six fish in the test and tracking test results (Table 228

1). 229

Brain, eye and fin tissues from NNV infected fish contain a large amount of NNV 230

The organs (brain, eye, gill, fin, head kidney, heart, intestine, liver, muscle and spleen) 231

from NNV naturally infected grouper could be classified into two groups according to 232

the RT-qPCR results of NNV. One group (brain, eye, and fin) contained > 109 copies 233

of NNV coat protein gene per gram tissue, while the other group (gill, head kidney, 234

heart, intestine, liver, muscle and spleen) had < 107 copies of NNV coat protein gene 235

per gram tissue (Fig. 3). Grouper fin tissues contained a copious amount of virus, 236

similar to the primary tissues for NNV, and was 100-fold higher than the other tissues 237

(Fig. 3). 238

NNV propagation in fin tissue cells is higher than liver and head kidney cells 239


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

12

From the cell line experiments, grouper fin, liver and kidney cells were used to culture 240

NNV. The results showed that more NNV could be reproduced in fin cells (GF-1) 241

than in liver and head kidney cells at 5 days post-infection (p.i.) (Fig. 4). In grouper 242

liver (GLa) cells and head kidney (GK) cells, the number of NNV (1.0 × 108 to 1.0 × 243

109

copies per ml for GLa cells and 1.0 × 107 to 1.0 × 10

8 copies per ml for GK cells) 244

stabilized of NNV become stable after 1 and 2 days p.i., respectively. But, in grouper 245

fin cells (GF-1 cells), NNV continued to amplify (1.0 × 1011

to 1.0 × 1012

copies per 246

ml) until 5 days p.i. (Fig. 4). During the first 2 days p.i., the number of virus in GLa 247

and GK cells amplified very rapidly ( > 1,000 fold), but only > 100 fold in GF-1 cells. 248

However, at 5 days p.i., the number of virus in GF-1 cell increased 10 million-fold 249

from the initial inocula (Fig. 4). Monitoring the development of cytopathic effect 250

(CPE) after NNV infection of GF-1 cells (Fig. 5) revealed that > 50% of the infected 251

cells become rounded and swollen, detached and lytic by 3 days p.i. By 5 days p.i., 252

disintegration of cells was evident (Fig. 5). 253

Grouper fin tissue contains NNV 254

Four micron-thick sections of NNV-infected grouper fin tissues (for the location of 255

the sampled tissue see Fig. 6A) were hybridized with 203NNV probe (amplified by 256

203-F and 203-R). A positive reaction was characterized by a dark precipitate in fin 257

tissues (Fig. 6B). The dark precipitation spots accumulated in the nuclei of osteocytes 258

in the spiny dorsal fin. No positive reaction was found in fin tissue from NNV-free 259

groupers (Fig. 6D). H&E staining revealed fewer cells in the NNV-infected fin tissues 260

(Fig. 6C) than NNV-free infected fin tissues (Fig. 6E), indicative of cell death upon 261

NNV infection. 262

CT value as an indicator for the NNV infection 263

Twenty-four grouper aquaculture farms and six fish from each farm were sampled for 264


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

13

NNV infection by examination of fin tissues and monitoring of the same collected fish 265

for 2 weeks. From 36 NNV-infected grouper fish and 11 healthy groupers (i.e., 266

absence of symptoms of NNV infections) (Supplementary Table 4), fin tissues were 267

collected for detection of NNV infection without need of fish sacrifice. NNV-infected 268

and healthy grouper displayed CT values of 12–24 and 29–32, respectively (Fig. 7 and 269

Supplementary Table 4). 270


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

14

4. Discussion 271

NNV infection is a serious problem in grouper farming. Mortality in hatchery-reared 272

larvae and juveniles can reach 100% of the population. A rapid and reliable technique 273

for detecting virus-infected fish could circumvent an outbreak, and so is an important 274

and very desirable goal. Many methods had been developed to detect and quantify 275

infectious virus particles, such as cell culture-based methods, immunohistochemistry 276

and enzyme-linked immunosorbent assay; all are time-consuming and complicated. 277

Some methods can only detect fish that display clinical signs of NNV-infection but 278

not fish that are asymptomatic in the early stage of infection. Therefore, predictive 279

information is crucial for disease control in fish farms (6). 280

Different methods detecting virus have varying level of sensitivity. In the recent 281

years, RT-qPCR has been shown to satisfy the need for a fast, reliable, and accurate 282

quantification and sensitive diagnostic testing with a reduced risk of carry-over 283

contamination (6, 28). The presently-developed method was capable of detecting from 284

1.0 × 109 copies to as low as two copies per reaction. Two virus copies per reaction 285

can easily identify fish recently infected with NNV that have been hitherto clinically 286

silent, and represents a the most sensitive detection methods described to date (5, 8, 287

10, 18, 19). Moreover, a linear regression of over 0.99 (r2

> 0.99) produces a CV from 288

0.9%–6.34% for the plasmid assay and 0.34%–5.07% for the viral assay, indicating 289

that the assays are highly reproducible. The high sensitivity combined with its wide 290

detection on range makes the present method ideal for detecting NNV infections in 291

different tissues. 292

The actual application of the RT-qPCR method on fish farms showed monitoring 293

of the disease in individual fish was possible by sampling fin tissues. The results from 294

the investigation of NNV infection of 24 different grouper aquaculture farms for 2 295


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

15

weeks also revealed the rapid spread of NNV to the entire population (Table 1). The 296

results indicated that the NNV is highly infectious horizontally and causes high 297

mortality rate (100%). 298

NNV can be detected in brain, eye, gill, skeletal muscle, liver, pyloric gland, 299

intestine and blood cells in the heart of diseased juvenile grouper by in situ 300

hybridization (4). In larvae of striped jack (Pseudocaranx dentex), NNV can be 301

detected in the spinal cord, brain and retina tissues (11). Presently, similar results were 302

obtained, in which the brain and eye in NNV-infected juvenile grouper contained over 303

1.0 × 109 virus copies per gram tissue; other tissues including the gill, head kidney, 304

heart, intestine, liver, muscle and spleen usually contained < 107 virus copies per gram 305

tissue (Fig. 3). Notably, fin tissue also contained > 1.0 × 109 NNV copies per gram 306

tissue, matching the primary tissues (brain and eye) (4, 11). Why the fin tissue harbors 307

such a large amount of the virus and whether fin tissue is also a primary target of 308

NNV are intriguing issues that warrant study. 309

Fish dorsal fin induction and development are related to neural crest cells (19, 310

25), which later develop into the peripheral nervous system and which is the target of 311

NNV (20). The initial site of multiplication of NNV is the spinal cord, from which the 312

virus spreads to the brain and finally to the retina (20). Hyperplasia can also be 313

observed in the skin of naturally infected fish and virus multiplication has been 314

described in these affected epithelial cells (20). 315

The collective information from previous and present studies is compatible with 316

the suggestion that NNV infection might stem from the entry of the virus into fin 317

epithelial cells or skin epithelial cells. After NNV enters through the fin skin into fin 318

tissue, the virus multiplies and spreads to the circulatory system. NNV particles are 319

ultimately distributed in primary tissues with copious numbers of NNV remaining in 320


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

16

fin tissue, resulting in a carrier state. 321

Contrary to the above view, no virus particles were evident in the skin or gills 322

following the experimental injection of NNV into the fish circulatory system (20), 323

which could rule out the possibility of NNV being released from a carrier host 324

through the skin or gill. Release may instead involve the fin epithelial cells. In the 325

wild, NNV could be released from fin epithelial cells into sea water to be horizontally 326

transmitted to other fish. Further studies of the horizontal transmission hypothesis are 327

necessary, such as labeling NNV with a fluorescent protein and visualizing the 328

movement of NNV by live cell imaging. 329

Currently, grouper fish have to be sacrificed and tissues collected (e.g., brain or 330

eye) for NNV detection. This holds true even if sampling is from the gills or blood 331

(blood can only be collected from heart in the early stage of grouper infection). The 332

presently described sampling of fin tissue can achieve NNV detection without killing 333

the fish. Therefore, detection of NNV and monitoring the amount of virus from 334

grouper fin may provide the solution to early prevention of NNV infection and 335

increasing the safety level (virus-free) of trade in groupers between breeding fish 336

farms. 337

In RT-qPCR, a positive reaction is detected by accumulation of a fluorescent 338

signal, which allows not only detection of the presence of the viral genome, but also 339

enables an estimate of its infectious potential. RT-PCR or the virus cultivation test 340

alone may not detect NNV-infected groupers that have yet to display signs of NNV 341

infection. CT is defined as the number of cycles required for the fluorescent signal to 342

cross the threshold. CT levels are inversely proportional to the amount of target 343

nucleic acid in the sample. The data from CT value of NNV-infected and non-infected 344

grouper can be used for identification and isolation of the potential infected groupers 345


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

17

before outbreak. Lower CTs values (< 29) represent strong positive reactions 346

indicative of abundant NNV in the sample, and are indicative of a higher probability 347

in a serious outbreak of VNN. CTs values of 24–28 represent suspected infections, 348

while CT > 29 are indicative of weak reactions involving minimal amounts of target 349

nucleic acid, which could represent an environmental contamination. 350

In conclusion, the presently described RT-qPCR method enables detection and 351

quantification of NNV in living grouper fish. The method can provide more 352

information, such as the number of viruses, and can identify latently infected fish 353

farms better than reverse transcriptase-PCR. The present method is very rapid, highly 354

sensitive and is applicable to routine high throughput assay, making it a suitable tool 355

for diagnostic, epidemiological and genetic studies in grouper aquaculture. Moreover, 356

grouper fin can be used as the major target organ for NNV detection without the need 357

to seriously injure or sacrifice the grouper. Therefore, the method could be applied for 358

continuously monitoring NNV infection and also can provide information on 359

evaluating the vaccination of broodstocks. The CT value can also provide an early 360

warning of NNV infection before outbreaks in grouper aquaculture farms. 361


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

18

Acknowledgements 362

We thank Dr. Brian D. Hoyle for editing the manuscript. We would like to thank Mr. 363

Fu-Ping Chang, Mr. Nai-Heng Yu, and Tekho Co. Ltd. (An Pin Live Fish Center) for 364

kindly providing living fish samples from the participating fish farms for this study. 365

This research was funded and supported by Fish Breeding Association Taiwan, and 366

the Landmark Project (B0127) of National Cheng Kung University, the plan of 367

University Advancement, Ministry of Education, Taiwan. 368


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

19

References 369

1. Bustin, S.A. 2002. Quantification of mRNA using real-time reverse transcription 370

PCR (RT-PCR): trends and problems. J. Mol. Endocrinol. 29:23-39. 371

2. Carstens, E.B., M.K. Estes, S.M. Lemon, J. Maniloff, M.A. Mayo, D.J. 372

McGeoch, C.R. Pringle, and R.B. Wickner. 2000. Virus Taxonomy, Academic 373

Press, San Diego. 374

3. Chen, Y.M., Y.L. Su, J.H.Y. Lin, H.L. Yang, and T.Y. Chen. 2006. Cloning 375

of a orange-spotted grouper (Epinephelus coioides) Mx cDNA and 376

characterization of its expression in response to nodavirus. Fish Shellfish 377

Immunol. 20:58-71. 378

4. Chi, S.C., B.J. Lo, and S.C. Lin. 2001. Characterization of grouper nervous 379

necrosis virus (GNNV). J. Fish Dis. 24:3-13. 380

5. Ciulli, S., E. Galletti, L. Gallina, F. Vaccari and S. Prosperi. 2006. Detection 381

and quantification of Betanodavirus by real time PCR. Vet. Res. Comm. 382

30:235-238. 383

6. Dalla Valle, L., V. Toffolo, M. Lamprecht, C. Maltese, G. Bovo, P. Belvedere, 384

and L. Colombo. 2005. Development of a sensitive and quantitative diagnostic 385

assay for fish nervous necrosis virus based on two-target real-time PCR. Vet. 386

Microbiol. 110:167-179. 387

7. Fenner, B.J., R. Thiagarajan, H.K. Chua, and Kwang, J. 2006. Betanodavirus 388

B2 is an RNA interference antagonist that facilitates intracellular viral RNA 389

accumulation. J. Virol. 80:85-94. 390

8. Grove, S., R. Faller, K.B. Soleim, and B.H. Dannevig. 2006. Absolute 391

quantitation of RNA by a competitive real-time RT-PCR method using piscine 392

nodavirus as a model. J. Virol. Methods 132:104-112. 393

9. Iwamoto, T., K. Mise, K. Mori, M. Arimoto, T. Nakai, and T. Okuno. 2001a. 394

Establishment of an infectious RNA transcription system for Striped jack 395

nervous necrosis virus, the type species of the betanodaviruses. J. Gen. Virol. 396

82:2653-2662. 397

10. Iwamoto, T., K. Mori, M. Arimoto, and T. Nakai. 2001b. A combined 398

cell-culture and RT-PCR method for rapid detection of piscine nodaviruses. J. 399

Fish Dis. 24:231-236. 400

11. Kiryu, I., L.D. de la Peña, and Y. Maeno. 2007. Distribution of nervous 401


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

20

necrosis virus in orange-spotted grouper Epinephelus coioides with 402

asymptomatic infection. Fish Pathol. 42:163-165. 403

12. Lin, C.S., M.W. Lu, L. Tang, W. Liu, C.B. Chao, C.J. Lin, N.K. Krishna, 404

J.E. Johnson, and A. Schneemann. 2001. Characterization of 405

virus-like-particles assembled in a recombinant baculovirus system expressing 406

the capsid protein of a fish nodavirus. Virology 290:50-58. 407

13. Mackay, I.M., K.E. Arden, and A. Nitsche. 2002. Real-time PCR in virology. 408

Nucl. Acids Res. 30:1292-1305. 409

14. Mori, K.I., T. Nakai, K. Muroga, M. Arimoto, K. Mushiake, and I. 410

Furusawa. 1992. Properties of a new virus belonging to nodaviridae found in 411

larval striped jack (Pseudocaranx dentex) with nervous necrosis. Virology 412

187:368-371. 413

15. Munday, B.L., T. Nakai, and H.D. Nguyen. 1994. Antigenic relationship of the 414

picorna-like virus of larval barramundi, Lates calcarifer Bloch to the nodavirus 415

of larval striped jack, Pseudocaranx dentex (Bloch and Schneider). Aust. Vet. J. 416

71:384-385. 417

16. Munday, B.L., and T. Nakai. 1997. Special topic review: nodaviruses as 418

pathogens in larval and juvenile marine finfish. World J. Microbiol. Biotechnol. 419

13:375-381. 420

17. Nagai, T., and T. Nishizawa. 1999. Sequence of the non-structural protein gene 421

encoded by RNA1 of striped jack nervous necrosis virus. J. Gen. Virol. 422

80:3019-3022. 423

18. Nerland, A.H., C. Skaar, T.B. Eriksen, and H. Bleie. 2007. Detection of 424

nodavirus in seawater from rearing facilities for Atlantic halibut Hippoglossus 425

hippoglossus larvae. Dis. Aquat. Org. 73:201-205. 426

19. Newth, D.R. 1956. On the neural crest of the lamprey embryo. J. Embyol. Exp. 427

Morphol. 4:358-375. 428

20. Nguyen, D., T. Nakai, and K. Muroga. 1996. Progression of striped jack 429

nervous necrosis virus (SJNNV) infection in naturally and experimentally 430

infected striped jack Pseudocaranx dentex larvae. Dis. Aquat. Org. 24:99-105. 431

21. Nuovo, G.J. 1995. In situ PCR: protocols and applications. PCR Methods Appl. 432

4:S151-S167. 433

22. Ou, M.C., Y.M. Chen, M.F. Jeng, C.J. Chu, H.L. Yang, and T.Y. Chen. 2007. 434

Identification of critical residues in nervous necrosis virus B2 for 435


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

21

dsRNA-binding and RNAi-inhibiting activity through by bioinformatic analysis 436

and mutagenesis. Biochem. Biophys. Res. Comm. 361:634-640. 437

23. Ririe, K.M., R.P. Rasmussen, and C.T. Witter. 1997. Product differentiation by 438

analysis of DNA melting curves during polymerase chain reaction. Anal. 439

Biochem. 245:154-160. 440

24. Skliris, G.P., J.V. Krondiris, D.C. Sideris, A.P. Shinn, W.G. Starkey, and R.H. 441

Richards. 2001. Phylogenetic and antigenic characterization of new fish 442

nodavirus isolates from Europe and Asia. Virus Res. 75:59-67. 443

25. Smith, M., A. Hickman, D. Amanze, A. Lumsden, and P. Thorogood. 1994. 444

Trunk neural crest origin of caudal fin mesenchyme in the zebrafish 445

Brachydanio-Rerio. Proc. R Soc. Lond. Ser. B 256:137-145. 446

26. Sommerset, I., and A.H. Nerland. 2004. Complete sequence of RNA1 and 447

subgenomic RNA3 of Atlantic halibut nodavirus (AHNV). Dis. Aquat. Organ. 448

58:117-125. 449

27. Starkey, W.G., J.H. Ireland, K.F. Muir, M.E. Jenkins, W.J. Roy, R.H. 450

Richards, and H.W. Ferguson. 2001. Nodavirus infection in Atlantic cod and 451

Dover sole in the UK. Vet. Res 149:179-181. 452

28. Starkey, W.G., R.M. Millar, M.E. Jenkins, J.H. Ireland, K.F. Muir, and R.H. 453

Richards. 2004. Detection of piscine nodavirus by realtime nucleic acid 454

sequence based amplification (NASBA). Dis. Aquat. Org. 59:93-100. 455

29. Sung, C.H., and J.K. Lu. 2009. Reverse transcription loop-mediated isothermal 456

amplification for rapid and sensitive detection of nervous necrosis virus in 457

groupers. J. Virol. Methods 159:206-210. 458


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

22

Legends of figures 459

Fig. 1. The locations of sampling grouper aquaculture farms in southern Taiwan. 460

Taiwan encompasses subtropical and tropical regions and is suitable for culturing 461

groupers. Grouper samples were collected from 24 different grouper aquaculture 462

farms in eight regions (gray circles): An-Nan (n = 2 farms), Anping (n = 2), Budai (n 463

= 2), Cigu (n = 3), Jiading (n = 5), Kunshen (n = 5), Linbian (n = 1) and Linyuan (n = 464

4). The white ring indicates the location of National Cheng Kung University. 465

466

Fig. 2. The primer sensitivity and specificity tests. (A) The primer pair used in this 467

study specifically amplified only a 203 bp fragment of NNV coat protein. M, 100 bp 468

DNA marker; N, negative control (deionized distilled H2O as template); NNV, NNV 469

particles (2 µg); IR, purified iridovirus (2 µg); VB, Vibrio anguillarum (2 µg); Ecg, E. 470

coioides genome from non-NNV infected fish (100 ng); Elg, E. lanceolantus genome 471

from non-NNV infected fish (850 ng); Efg, E. fuscoguttatus genome from non-NNV 472

infected fish (270 ng). (B) Ten-fold serial dilutions of pGEM-T-NNV were used for 473

PCR reactions. The detection limitation of RT-PCR on plasmid was about 100 DNA 474

copies. Lanes 1-10 indicate the DNA copy number from 109 to10

0. Lane 11, negative 475

control (distilled deionized H2O), M: 100 bp DNA marker. (C) Ten-fold serial 476

dilutions of virus particles were used as template for RT-PCR. The limitation of 477

RT-PCR sensitivity was about 190-1,900 virus copies, Lanes 1-10 indicate the virus 478

copy number from 1.9 × 1010

to 1.9 × 101 . Lane 11, negative control (distilled 479

deionized H2O). M, 100 bp DNA marker. The arrows indicate the 203 bp PCR 480

product amplified from the primer pair (203-F and 203-R) used in this study. 481

482

Fig. 3. RT-qPCR results of NNV copy number in different organs of infected 483

groupers. Brain, eye, gill, fin, head kidney, heart, intestine, liver, muscle and spleen 484


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

23

were obtained from NNV naturally infected groupers. Within those organs, brain, eye 485

and fin contained > 109 copies of NNV coat protein gene per gram tissue and the other 486

organs (gill, head kidney, heart, intestine, liver, muscle, and spleen) had < 107 copies 487

of NNV coat protein gene per gram tissue. The experiments were repeated three times 488

and six fish samples were examined each time. 489

490

Fig. 4. NNV propagation in GF-1, GLa and GK cells. Cultures of GF-1, GLa and 491

GK cells were inoculated with 5 × 104–5 × 10

5 per ml of NNV, which was isolated 492

from naturally infected groupers. Cells were sampled separately at days 0, 2, 3, 4, 5, 6, 493

7, 8 and 9 after inoculation. RNA was isolated from the samples and cDNA were 494

quantified by RT-qPCR then the copy number of NNV was determined and calculated 495

according to the molecular weight of NNV. The data show the NNV RNA copies per 496

ml from the sample. 497

498

Fig. 5. Cytopathic effects elicited by NNV infection of GF-1 cells. Subconfluent 499

GF-1 cells were inoculated with NNV at 28°C for 5 days prior to microscopic 500

visualization. Cytopathic effect was apparent as refractile, rounded, swollen and 501

semiattached cells, and areas of clearance compared to the uninfected control cells. (A) 502

Uninfected GF-1 cells. (B) Cells examined at 5 days p.i. . Bar = 10µm. 503

504

Fig. 6. NNV detection on fin tissue of naturally infected groupers by in situ 505

RT-PCR. (A) An image of grouper fish (35 days old); the circle indicates the 506

sampling position of dorsal fin. (B) Fin tissue from NNV naturally infected fish. The 507

arrows indicate the signals of virus characterized by a dark precipitate spots. (C) H&E 508


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

24

staining of fin tissue from NNV naturally infected fish. (D) The healthy grouper 509

(NNV-infected free) did not show any dark precipitation spots. (E) H&E staining of 510

NNV-free infected fin tissues. Bar = 50 µm (B, C, D and E); Bar = 1 cm (A). 511

512

Fig. 7. The distribution of CT values in infected and healthy groupers. The graph 513

shows that the CT value for the NNV-infected grouper (12–24), while that of healthy 514

groupers ranged from 29–32. The region between broken lines indicates the CT values 515

of 24–29, indicative of suspected infection with NNV. 516


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

25

Table 1. Summary results of NNV detection by RT-qPCR in fin tissue from 24 517

different grouper aquaculture farms. 518

519

Farm/

tank #§

Location Species* Size of

fish

Test result**

Tracking test

result‡

Collection

date

1 Kunshen E. coioides 1 inch －＋＋＋－－＋＋＋＋＋＋ Mar/2008

2 Budai E. coioides 2 inch ＋＋＋＋＋＋＋＋＋＋＋＋ Aug/2008

3 Kunshen E. coioides 2 inch －＋－＋－－＋＋＋＋＋＋ Mar/2008

4 Linyuan E.coioides 2 inch ＋－＋－－－＋＋＋－－－ Aug/2008

5 Jiading E. lanceolatus 0.5 inch －－－－－－－－－－－－ Mar/2008

6 Kunshen E. coioides 0.5 inch ＋＋＋－＋＋＋＋＋＋＋＋ Aug/2008

7 Cigu E. coioides 1.5 inch －＋－＋－－＋＋＋＋＋＋ Apr/2008

8 An-Nan E. lanceolatus 3 inch －－－－－－－－－－－－ Aug/2008

9 Jiading E. malabaricus 1 inch －＋＋－－－＋＋＋＋＋＋ Apr/2008

10 Jiading E. coioides 2 inch －＋－＋＋＋＋＋＋＋＋＋ Aug/2008

11 Jiading E. lanceolatus 2 inch ＋－－－－－＋＋＋＋＋＋ Apr/2008

12 Linyuan E. coioides 1 inch －＋－＋－－＋＋＋＋＋＋ Sep/2008

13 Cigu E. malabaricus 1 inch ＋－－＋－－＋＋＋＋＋＋ Jan/2008

14 Kunshen E. coioides 1 inch ＋＋－＋＋－＋＋＋＋＋＋ May/2008

15 Budai E. lanceolatus 1.5 inch －－＋－＋＋＋＋＋＋＋＋ Sep/2008

16 Kunshen E. coioides 2 inch ＋＋－－－－＋＋＋＋＋＋ Jan/2008

17 Jiading E. lanceolatus 1 inch －－－－－－－－－－－－ May/2008

18 Linbian E. coioides 0.5 inch －－＋＋＋－＋＋＋＋＋＋ Sep/2008

19 Anping E. lanceolatus 0.5 inch －＋－－－－＋＋＋＋＋＋ Jan/2008

20 Anping E. lanceolatus 3 inch ＋－＋－－＋＋＋＋＋＋＋ May/2008

21 Linyuan E. coioides 2 inch ＋＋＋－＋－＋＋＋＋＋＋ Sep/2008

22 Cigu E. coioides 0.5 inch －＋－＋－＋＋＋＋＋＋＋ Jan/2008

23 Linyuan E. coioides 0.5 inch ＋－＋－－－＋＋＋＋＋＋ May/2008

24 An-Nan E. lanceolatus 2.5 inch －＋－＋－－＋＋＋＋＋＋ Sep/2008

* E. coioides (orange-spotted grouper); E. lanceolatus (giant grouper); E. malabaricus 520

(malaba grouper) 521 **

The test results of NNV detection by RT-qPCR; ＋, fin tissues from fish samples 522

been indentified had NNV signal by RT-qPCR(CT value between 12 and 24); －, fin 523

tissues from samples been indentified had no NNV signal by RT-qPCR (CT > 32)‡The 524

test results of NNV detection by RT-qPCR after two weeks of the same sampled fish. 525 §The fish samples been collected from the same fish farm were pooled together in a 526

fish tank and labled as the same number of the fish farm. 527


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

26

Fig. 1.


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

27

Fig. 2.


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

28

Fig. 3.


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

29

Fig. 4.


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

30

Fig. 5.


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

31

Fig. 6.


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

32


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

33

Fig. 7.


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

34

Supplemental Table 1. cDNA sequences of NNV coat proteins from GenBank.

Isolate* Host species Accession no. Reference

**

B00GD Barramundi AY140793 Chi et al., 2003

BFNNV Barfin flounder D38635 Nishizawa et al., 1995

CC01YL1 Chinese catfish AY140794 Chi et al., 2003

Co00CC1 Cobia AY140795 Chi et al., 2003

DGNNV Dragon grouper AF245004 Lin et al., 2001

EE98PH European eel AY140796 Chi et al., 2003

GGNNV Greasy grouper AF318942 Tan et al., 2001

HG00GD Hump-back grouper AY140799 Chi et al., 2003

JFNNV Japanese flounder D38527 Nishizawa et al., 1995

MGNNV Malabaricus grouper AF245003 Lin et al., 2001

RGNNV Redspotted grouper AY744705 Huang et al., 2007

RGNNV Redspotted grouper D38636 Nishizawa et al., 1995

SJNNV Striped jack D30814 Nishizawa et al., 1995

SJNNV Striped jack NC_003449 Iwamoto et al., 2001

TPNNV Tiger puffer D38637 Nishizawa et al., 1995

WSSNNV White star snapper AY835642 Lu et al., upb.

YP99PD Yellow-wax pompano AY140800 Chi et al., 2003

YGNNV Yellow grouper AF283554 Lai and Chang, upb. * BFNNV, Barfin flounder nervous necrosis virus; DGNNV, Dragon grouper nervous

necrosis virus; GGNNV, Greasy grouper nervous necrosis virus; JFNNV, Japanese

flounder nervous necrosis virus; MGNNV, Malabaricus grouper nervous necrosis

virus; RGNNV, Redspotted grouper nervous necrosis virus; SJNNV, Striped jack

nervous necrosis virus; TPNNV, Tiger puffer nervous necrosis virus; WSSNNV,

White star snapper nervous necrosis virus; YGNNV, Yellow grouper nervous necrosis

virus; upb, unpublished. **

The references were shown in supplemental references for NNV cDNA sequences


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

35

Supplemental Table 2. Ten-fold serial dilutions of plasmid as template. CT value

Dilution factor

1 2 3

Mean SD CV(%)

109 5.26 5.16 5.09 5.17 0.09 1.64

108 9.01 9.84 10.07 9.46 0.60 6.34

107 12.47 12.33 13.02 12.61 0.37 2.89

106 17.09 16.69 17.15 16.97 0.25 1.47

105 20.68 20.84 21.24 20.91 0.30 1.45

104 24.56 24.15 24.49 24.40 0.22 0.90

103 29.84 28.11 28.48 28.81 0.91 3.16

102 33.13 32.19 32.36 32.56 0.81 2.48

101 35.28 36.18 36.57 36.01 0.66 1.84


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

36

Supplemental Table 3. Ten-fold serial dilutions of virus as template.

CT value Dilution factor

1 2 3

Mean SD CV(%)

1.9×1010

6.08 6.04 6.15 6.09 0.06 0.90

1.9×109 8.61 8.70 9.04 8.78 0.23 2.57

1.9×108 12.22 12.17 12.60 12.33 0.24 1.90

1.9×107 16.06 16.01 15.95 16.00 0.06 0.34

1.9×106 19.50 19.28 20.85 19.87 0.85 4.28

1.9×105 24.13 23.69 25.08 24.30 0.71 2.92

1.9×104 27.80 27.09 28.79 27.89 0.85 3.06

1.9×103 30.66 31.06 33.63 31.78 1.61 5.07

1.9×102 35.69 35.46 38.43 36.52 1.65 4.52


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

37

Supplemental Table 4. Grouper fish sample collection for calculation of CT

values.

Fish

#

Location Species Size of

fish

(inch)

condition Ct Collection date

1 Jiading E. lanceolatus 3 NNV-free 30.0890 2002~2004

2 Jiading E. coioides 2 NNV-free 30.6750 2002~2004



5 Jiading E. malabaricus 3 NNV-free 29.6620 2002~2004

6 An-Nan E. coioides 3 NNV-free 30.0380 2002~2004

7 An-Nan E. lanceolatus 3 NNV-free 30.4950 2002~2004


9 An-Nan E. malabaricus 3 NNV-free 30.1050 2002~2004




13 An-Nan E. malabaricus 3 NNV-free 31.7320 2002~2004
























37 Anping E. malabaricus 3 NNV-infection 10.8820 2002~2004

38 Anping E. coioides 2 NNV-infection 13.9620 2002~2004

39 Anping E. lanceolatus 2 NNV-infection 12.3560 2002~2004

40 Linbian E. coioides 3 NNV-infection 23.5390 2002~2004

41 Linbian E. malabaricus 2 NNV-infection 23.9070 2002~2004


43 Linbian E. lanceolatus 3 NNV-infection 23.4030 2002~2004


45 Linbian E. malabaricus 2 NNV-infection 10.8820 2002~2004


47 Linbian E. lanceolatus 3 NNV-infection 13.9620 2002~2004


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

38

Supplemental Fig. 1. Representative standard curve plots of NNV RNA2

real-time (RT)-qPCR assays. (A) RT-qPCR reactions with 1×101-1×10

9 copies of

plasmids (containing NNV RNA2 gene) were carried out and the threshold cycle (CT)

for each of three replicates per dilution was plotted against the log of the

corresponding initial template concentration. (B) Standard curve from 10-fold serial

dilutions (1.9×1010

to 1.9×102

copies) of an NNV RNA standard in three replicates

measurements. Rn: normalized fluorescent intensity; CT: threshold cycle (the first

cycle in which a significant increase of amplification signal is detected over the mean

baseline signal); Log C: logarithm values of NNV copy numbers; r2: coefficient of

determination. The amount of NNV RNA (237 ng/l) were identified via OD260/OD280.

The virus molecular weight is 1.50×106 [4542(bps)×330(Da)] and the amount of NNV

RNA was calculated as 1.58×10-13

(237×10-9

/1.5×106) mole per liter. 1.58×10

-13 mole

is 9.5×1010

virus copies per liter of NNV RNA.


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

39

Supplemental References 1 2

Huang, J.N., L. Lin, S.P. Weng, and J.G. He. 2007. High expression of capsid 3

protein of red-spotted grouper nervous necrosis virus in an avian cell line requires 4

viral RNA2 non-coding regions. J. Fish Dis. 30:439-444. 5

Iwamoto, T., K. Mise, K. Mori, M. Arimoto, T. Nakai, T. Okuno. 2001. 6

Establishment of an infectious RNA transcription system for Striped jack nervous 7

necrosis virus, the type species of the betanodaviruses. J. Gen. Virol. 82: 8

2653-2662. 9

Lin, C.S., M.W. Lu, L. Tang, W. Liu, C.B. Chao, C.J. Lin, N.K. Krishna, J.E. 10

Johnson, A. Schneemann. 2001. Characterization of virus-like particles assembled 11

in a recombinant baculovirus system expressing the capsid protein of a fish 12

nodavirus. Virology 290:50-58. 13

Nishizawa, T., K. Mori, M. Furuhashi, T. Nakai, I. Furusawa, K. Muroga. 1995. 14

Comparison of the coat protein genes of five fish nodaviruses, the causative agents 15

of viral nervous necrosis in marine fish. J. Gen. Virol. 76:1563-1569. 16

Tan, C., B. Huang, S.F. Chang, G.H. Ngoh, B. Munday, S.C. Chen, J. Kwang. 17

2001. Determination of the complete nucleotide sequences of RNA1 and RNA2 18

from greasy grouper (Epinephelus tauvina) nervous necrosis virus, Singapore strain. 19

J. Gen. Virol. 82:647-653. 20


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

Documents

A revised manuscript of JCM01016-10 (Version 3 · 113 the cells were collected when 90% of the cells displayed a cytopa thic effect (CPE). 114 L15 medium containing GF-1 cells and