A Proteasome Inhibitor, Bortezomib, Inhibits Breast Cancer … · 2019-04-30 · proteasome inhibitor used to treat multiple myeloma, has a potent anabolic effect on bone (4–9)

2010;16:4978-4989. Published OnlineFirst September 15, 2010.Clin Cancer Res Marci D. Jones, Julie C. Liu, Thomas K. Barthel, et al. GenesGrowth and Reduces Osteolysis by Downregulating Metastatic A Proteasome Inhibitor, Bortezomib, Inhibits Breast Cancer

Updated version

10.1158/1078-0432.CCR-09-3293doi:

Access the most recent version of this article at:

Cited Articles

http://clincancerres.aacrjournals.org/content/16/20/4978.full.html#ref-list-1

This article cites by 46 articles, 13 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/16/20/4978.full.html#related-urls

This article has been cited by 1 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

[email protected] at

To request permission to re-use all or part of this article, contact the AACR Publications

Research. on January 13, 2014. © 2010 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 15, 2010; DOI: 10.1158/1078-0432.CCR-09-3293

Research. on January 13, 2014. © 2010 American Association for Cancerclincancerres.aacrjournals.org Downloaded from


http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-09-3293

http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-09-3293





http://clincancerres.aacrjournals.org/cgi/alerts

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]




http://clincancerres.aacrjournals.org/




Can

A PGroMet

MarciJesseSiddh

Abst

Mettients.develofractuubiqugrowtfor de

Author2Deparof NucMassacAdvanc5CenteBostonCenter,

Note: CPurdue

CorresUniversWorceE-mail:

doi: 10

©2010

Clin C4978

Do


Clinical
Canceresearch
cer Therapy: Preclinical

roteasome Inhibitor, Bortezomib, Inhibits Breast Cancerwth and Reduces Osteolysis by Downregulating

R

astatic Genes

D. Jones1,2, Julie C. Liu1, Thomas K. Barthel2, Sadiq Hussain1, Erik Lovria2, Dengfeng Cheng3,
A. Schoonmaker5, Sudhanshu Mulay5, David C. Ayers2, Mary L. Bouxsein4, Gary S. Stein1, artha Mukherjee5,6, and Jane B. Lian1
ractPur

a prottestedExp

growtinto tand aRes

Bortezed tumenviromicroin killcells wwhichnecro

h and mvelopmen

s' Affiliatiotment of Orlear Medihusetts Meed Orthoper for Regen, MassachColumbia U

urrent addUniversity,

ponding Aity of Massster, MA 0jane.lian@u

.1158/1078-

American A

ancer Res

wnloade

pose: The incidence of bone metastasis in advanced breast cancer (BrCa) exceeds 70%. Bortezomib,easome inhibitor used for the treatment of multiple myeloma, also promotes bone formation. Wethe hypothesis that proteasome inhibitors can ameliorate BrCa osteolytic disease.erimental Design: To address the potentially beneficial effect of bortezomib in reducing tumorh in the skeleton and counteracting bone osteolysis, human MDA-MB-231 BrCa cells were injectedhe tibia of mice to model bone tumor growth for in vivo assessment of treatment regimens beforefter tumor growth.ults: Controls exhibited tumor growth, destroying trabecular and cortical bone and invading muscle.omib treatment initiated following inoculationof tumor cells strikingly reduced tumor growth, restrict-or cells mainly to the marrow cavity, and almost completely inhibited osteolysis in the bone micro-nment over a 3- to 4-weekperiod as shownby [18F]fluorodeoxyglucose positron emission tomography,–computed tomography scanning, radiography, and histology. Thus, proteasome inhibition is effectiveing tumor cells within the bone. Pretreatment with bortezomib for 3 weeks before inoculation of tumoras also effective in reducing osteolysis. Our in vitro and in vivo studies indicate that mechanisms bybortezomib inhibits tumor growth and reduces osteolysis result from inhibited cell proliferation,sis, and decreased expression of factors that promote BrCa tumor progression in bone.clusion: These findings provide a basis for a novel strategy to treat patients with BrCa osteo-
Con
lytic lesions, and represent an approach for protecting the entire skeleton from metastatic bonedisease. Clin Cancer Res; 16(20); 4978–89. ©2010 AACR.

tic thenzymtion osis, aprote

astatic osteolytic disease is prevalent in cancer pa-In advanced breast cancer (BrCa), 70% of womenp osteolytic lesions, resulting in pain, pathologicre, and increased morbidity. Dysfunction of theitin-proteasome system is associated with tumor

etastatic disease, providing the rationalet of proteasome inhibitors as antineoplas-

has aaltersthe nustem ction rtrabecilar enmyelotainedbonepresencreasiboneand luNo

cludesphon

ns: 1Department of Cell Biology and Cancer Center,thopedics and Physical Rehabilitation, and 3Divisioncine, Department of Radiology, University ofdical School, Worcester, Massachusetts; 4Center fordic Studies, Beth Israel Deaconess Medical Center;erative Medicine, Massachusetts General Hospital,usetts; and 6Herbert Irving Comprehensive Cancerniversity, New York, New York

ress for J.C. Liu is School of Chemical Engineering,West Lafayette, Indiana.

uthor: Jane B. Lian, Department of Cell Biology,achusetts Medical School, 55 Lake Avenue North,1655. Phone: 508-856-5625; Fax: 508-856-6800;massmed.edu.

0432.CCR-09-3293

ssociation for Cancer Research.

; 16(20) October 15, 2010

Research. on January 13, 2clincancerres.aacrjournals.org d from

erapies (1, 2). The proteasome is a ubiquitouse complex that plays a critical role in the degrada-f proteins involved in cell cycle regulation, apopto-nd angiogenesis (2, 3). Bortezomib, a selectiveasome inhibitor used to treat multiple myeloma,potent anabolic effect on bone (4–9). Bortezomibthe bone marrow microenvironment by increasingmber and differentiation of resident mesenchymalells into osteoblasts, thereby increasing bone forma-ates within 4 weeks in normal mice and resulting inular bone formation in bone loss model (7). A sim-hancement of osteoblast differentiation is found inma patients treated with bortezomib who show sus-increases in circulating osteocalcin, a marker of

formation (6, 10). Thus, bortezomib treatment re-ts a novel and clinically feasible approach for in-ng bone formation in the setting of the osteolyticdisease accompanying metastatic breast, prostate,ng cancers (4, 5, 11).nsurgical treatment of bone metastatic lesions in-
s radiation therapy and bisphosphonates. Bispho-ates were initially reported to reduce the risk of
014. © 2010 American Association for Cancer



pathototalinin fragrouprequireffectthe skTum

the mcientplacevicioureleasbutesosteopromaggresmetasof bogrowtbonecouldthe mtogenosteocomb

Mate

Cell cThe

Type C

MC3Tcell lining 10maint

AnimApp

Commcombhouseperimand aand c(Fig. 4groupweeksat wecomptomoimagi

TibialborteMic

mg xypatellthe in(XiSca100 μclosedgivenoperai.p. ingun 2three

HistoFol

ed anfied iat 6-μor Ki-wereattach4.7 so

RadioOst

Faxitr

Translational Relevance

Breast cancer (BrCa) metastasis to the bone andosteolytic lesions typically caused by these metastasesare particularly resistant to pharmacologic therapy. Thisstudy shows that the Food and Drug Administration–approved proteasome inhibitor bortezomib strikinglydecreases the size of BrCa metastatic tumors and asso-ciated osteolytic lesions through multiple mechanisms:by inducing cellular necrosis and apoptosis, inhibitingtumor cell Wnt signaling and matrix degradation, andreducing vascularization. In addition, the proteosomeinhibitor provided a significant skeleton-wide bone an-abolic effect, despite the presence of a metastatic lesion.Current treatment of metastases with bisphosphonateslimits bone resorption but does not rebuild bone vol-ume lost to osteolysis. Our findings also provide evi-dence for increased capability to treat BrCa osteolyticdisease preemptively using bortezomib before tumorcell growth in bone by inhibiting tumor responses tothe bone microenvironment and by providing protec-tive anabolic effects on the skeleton.

Proteasome Inhibitors Prevent Tumor Growth in Bone

www.a

Do


logic fracture and bone pain, although a recent studyg over 7,000 BrCa patients indicated no reductioncture risk compared with placebo or no treatments (12–14). In addition, bisphosphonates at dosesed for cancer patients can have a significant sideprofile (15, 16), and alternate approaches to protecteleton are needed.or cells in the bone microenvironment overcomearrow compartment and inhibit the ability of suffi-stromal cells to differentiate into osteoblasts to re-lost bone. Cancer cells secrete factors that induce as cycle of osteoclast activation and growth factore that promotes tumor survival. Bortezomib contri-to the apoptosis of tumor cells and tumor-activatedclasts (17–19); as well, low-dose bortezomibotes bone anabolic effects in mice (7). Given thesive osteolytic disease produced by BrCa cells thattasize to the bone, we investigated the effectivenessrtezomib treatment for inhibiting rapid tumorh within the bone, and the potential for retainingvolume. We postulated that bortezomib treatmentbe an effective therapy by suppressing growth ofetastatic tumor (4, 7–9, 20–22), inhibiting osteoclas-esis and survival (9, 17, 21, 23–26), and stabilizing
progenitor cells within the marrow (26), or by a measu
appeagraphnificaOsteoon thdegree

ination of all these effects.

rials and Methods

ulture
metastatic human BrCa MDA-MB-231 (Americanulture Collection HTB-22) and mouse preosteoblast
and <single

acrjournals.org

Research. on January 13, 2clincancerres.aacrjournals.org wnloaded from

3-E1 (American Type Culture Collection CRL-2593)es were used. Cells were cultured in α-MEM contain-% fetal bovine serum (Invitrogen, Inc.). Cells wereained at 37°C in a humidified incubatorwith 5%CO2.

al careroval from the Institutional Animal Care and Useittee was obtained. Six-week-old female severeined immunodeficient (NCr/SCID) mice wered in pathogen-free conditions and used for all ex-ents. Per experiment, groups contained three mice,ll studies except for the bortezomib pretreatmentontinuous bortezomib experiment comparison) were repeated for a total of six to eight mice per. The repeat studies were terminated at either 6 or 7. At sacrifice, all mice were analyzed radiographicallyekly intervals followed by either histology, micro–uted tomography (μCT), or positron emissiongraphy (PET)/single-photon emission CT (SPECT)ng at sacrifice.

implantation of MDA-MB-231 cells andzomib treatmente were anesthetized with 0.15 mg ketamine/0.015lazine i.p. per gram of body weight. A medial para-ar incision was created, and a needle was placed intramedullary canal of the tibia by aid of fluoroscopyn 1000-1, XiTec). MDA-MB-231 cells (1 × 105 inL of PBS) were slowly injected into the tibia andwith 5-0 chromic suture (Ethicon, Inc.). Mice were0.1 mg/kg buprenorphine subcutaneous (SQ) post-tively. Bortezomib (Millennium Pharmaceuticals)jections at a dose of 0.3 mg/kg body weight were be-4 hours after intratibial injection and continuedtimes a week, or as indicated in each study.

logic analysislowing sacrifice, the lower extremities were dissect-d then fixed in 4% paraformaldehyde and decalci-n 18% EDTA (pH 8.0). Paraffin sections were cutm thickness and stained with routine H&E, TRAP,67 immunohistochemistry (27). Photomicrographsacquired on a Zeiss Axioskop 40 microscope withed AxioCam HRC and analyzed by AxioVision Relftware (Carl Zeiss MicroImaging).

graphic analysiseolysis was monitored by serial radiographs using aon MX-20 X-ray machine unit. We devised a scale tore the severity of osteolytic lesions based on theirrance by conventional radiography. Blinded radio-s were evaluated by seven different scorers, and sig-nt differences were determined by Student's t test.lytic lesions were scored on a scale of 0 to 5 basedeir severity: 0, no visible osteolysis; 5, most severeof osteolysis. A grade 1 lesion was small, isolated,
10% of the width of the bone; grade 2 includedor multifocal small lesions, <33% of the cortical
Clin Cancer Res; 16(20) October 15, 2010 4979




widthcorticawidthsive co

μCT aSpe

top mMedicviouslvolumtibia fthe prto 65was ethe grbonebonetrabecconne(SMI)Stude

PET/CBio

PET caglucosthetizPET ition.UniveFacilitlizedNanoacqui45 kVThe C1.37was c

Real-tmR

were aBrCaisolateturer'stion w(InvitfollowGAGACATTCCCAGGTTGCACAGTdehyd(forwalymph

TATCA(reverTGCC(TCF4CAGC(DKKAACCTCATCCTT(forwmatrixGAAC(reverCACAGAACTGAA(reverTCTTCGTGTto conPRISMwere d

AnnesortinBor

withthe AsciencCytomfor fl(FACSwereand side scatter parameters were acquired in linear. Datawere a

Resu

BortecauseGiv

multimentin boMDA-weigh7 weeborteosteocto incobservof theRad

osteolby bo

Jones et al.

Clin C4980

Do


; grade 3 lesions have a size of 33% to 75% of thel width; extensive lesions with >75% of the corticalare graded as 4; and pathologic fracture with exten-rtical destruction represents a grade 5 lesion.

nalysiscimens were scanned using a high-resolution desk-icrotomographic imaging system (μCT40, Scancoal AG) using an isotropic voxel size of 12 μm, as pre-y described (28–30). In tumored bone, total bonee is assessed by μCT by selecting the region of eachrom the knee joint to the most proximal aspect ofoximal tibial-fibular joint, which ranges from 5750 sections. In the nontumored distal femur, bonevaluated in the region starting 360 μm proximal toowth plate and extending 1,800 μm proximally. Forregions without tumors, we assessed the trabecularvolume fraction (%), trabecular thickness (μm),ular number (mm−1), trabecular separation (μm),ctivity density (1/mm3), and structure model index. Results were analyzed for significant differences bynt's t test.

T animal imagingscan NanoSPECT/CT and Philips Mosaic HPmeras were used to collect CT and [18F]fluorodeoxy-e (FDG) images of mice. Tumored mice were anes-ed and injected i.v. with 100 μCi of 18F-FDG, andmaging was done at 30 minutes after administra-All data imaging and analysis were done at thersity of Massachusetts Small Animal Imaging Corey. After each PET acquisition, the mouse, immobi-on the Minerva bed (Bioscan), was transferred toSPECT/CT camera for the CT acquisition. The CTsition was done at standard frame resolution,p tube voltage, and 500 ms of exposure time.T reconstruction was done using InVivoScopesoftware (Bioscan), and a PET/CT fusion imagereated.

ime reverse transcription-PCR analysisNA levels of metastatic and osteolytic-related genesnalyzed from MDA-MB-231 cells, MC3T3 cells, ortumor following bortezomib treatment. RNA wasd using Trizol (Invitrogen) according to themanufac-protocol. Oligo(dT) primers were used in conjunc-ith the SuperScript First-Strand Synthesis System

rogen) to synthesize cDNAs. Primer sequences are ass: mouse: alkaline phosphatase (AP), TTGTGCGA-AAGAGAGAGA (forward) and GTTTCAGGG-

TTTCAAGGT (reverse); collagen type 1A (COL1A),AAGGAAAAGAAGCACGTC ( fo rwa rd ) andCAGCTGGATAGCGACATC (reverse); DKK3,CCAGGAAGTTCACAAG (forward) and GGCCCA-CTTCATCAAT (reverse); glyceraldehyde-3-phosphaterogenase (GAPDH), AGGTCGGTGTGAACGGATTTG
rd) and TGTAGACCATGTAGTTGAGGTCA (reverse);oid enhanced binding factor 1 (LEF1), AGTGCAGC-
of mitreatm

ancer Res; 16(20) October 15, 2010


ACCAGAT(forward) andTTCATAGTATTTGGCCTGCTse); RUNX2, CGGCCCTCCCTGAACTCT (forward) andTGCCTGGGATCTGTA (reverse); transcription factor 4), CAGAATCCACAGATACAGCA (forward) andCTTTGAAATCTTCATC (reverse); human: Dickkopf 11), TCATTTCCGAGGAGAAATTGAG (forward) andTTCTTGTCCTTTGGTG (reverse); GAPDH, ATGTTCG-GGGTGTGAA (forward) and TGTGGTCATGAGT-CCA (reverse); LEF1, CCCGAGAACATCAAATAAAGTGard) and CTCTACAACAAGGGACCCTC (reverse);metalloproteinase-9 (MMP-9), CCTGGAGACCTGA-CAATC (forward) and CCACCCGAGTGTAACCATAGCse); receptor activator for NF-κB ligand (RANKL),TCAGAGCAGAGAAAGC (forward) and CTTTATGG-CAGATGGG (reverse); RUNX2, CGGCCCTCCC-CTCT (forward) and TGCCTGCCTGGGGTCTGTAse); and vascular endothelial growth factor (VEGF),AAGCCATCCTGTGTG (forward) and GCGAGTCT-TTTTGCAG(reverse). Real-timePCRanalysiswasdonefirm expression levels by using an ABI machine andsoftware (Applied Biosystems); significant differencesetermined by Student's t test.

xin V binding and fluorescence-activated cellg analysistezomib-treated MDA-MB-231 cells were stainedAnnexin V–FITC and propidium iodide (PI) usingnnexin V–FITC Apoptosis Detection kit (BD Bio-es). Stained live cells were submitted to the Flowetry Core Lab at the University of Massachusetts

uorescence-activated cell sorting (FACS) analysisCalibur, BD Biosciences). All fluorescent parametersacquired in logarithmic amplification, and forward

nalyzed using CellQuest software.

lts

zomib slows the growth of osteolytic lesionsd by BrCa tumors in the bone microenvironmenten the anabolic effects of bortezomib on bone inple myeloma, we investigated if bortezomib treat-could ameliorate the osteolysis caused by BrCa cellsne. Mice that received intratibial inoculations ofMB-231 BrCa cells were treated with 0.3 mg/kg bodyt bortezomib administered three times a week forks. This dose and schedule represents the highestzomib dose used in a study in which the serumalcin level, a marker of bone formation, was foundrease in response to bortezomib treatment (7). Weed this dose to be nontoxic throughout the durationstudy (n > 24 mice).iographs in Fig. 1A (three representative tibias) showytic lesions in controls at day 21 that are inhibitedrtezomib treatment. By 35 days, small focal areas
ssing trabeculae were observed with bortezomibent. With continued bortezomib (to day 49 in
Clinical Cancer Research




Fig. 1of botreatedminatcausingroupregioncontroon a son a sAn agtrols a

invadlysis fmedution othis pcated(Fig.was oThe

ex vivo

Fig. 1.progres(0.3 mgosteolygroup hscore (sosteolyduringsectionfollowincompaseparate experiments at 28 d (n = 5) and 49 d (n = 3). The relative bone volume was significantly lower in control-treated compared with bortezomib-treatedmice (P


www.a

Do


A), there was evidence of a slow rate of progressionne lysis in the majority (∼70%) of the bortezomib-mice in multiple independent experiments. At ter-

ion of studies, control mice had very large tumorsg significant morbidity, whereas the bortezomibs consistently had greatly reduced bone loss in theof the tumor cell inoculation when compared withl-treated mice. These conclusions are in part basedemiquantitative evaluation of the radiographs basedcoring system (see Materials and Methods; Fig. 1B).

< 0.05, 28 d; P = 0.001, 49 d).

gressive increase in osteolysis was observed in con-fter day 28 when tumor destroyed the cortical bone,

micethe co

acrjournals.org


ed the surrounding tissue, and contributed to osteo-rom the periosteal side of bone as well as from thellary cavity. In the bortezomib group, a clear inhibi-f osteolytic disease is delayed until 4 to 5 weeks. Afteroint, low levels of osteolytic activity occurred, indi-by the appearance of lesions at the end of the study1A). A similar late appearance of osteolytic lesionsbserved in different experiments (data not shown).tumor-containing tibias were further analyzed byμCT in three mice. Figure 1C shows tibias of control

Bortezomib slows growth of BrCa osteolytic lesions as seen by conventional radiographs and μCT. A, radiographs of NCr/SCID mice duringsion of tumor growth. Mice (n = 3) received intratibial injection of 100,000 MDA-MB-231 BrCa cells and were treated with bortezomib (BZB) or PBS/kg i.p.; three times per week) until sacrifice at 49 d following BrCa injection. Interval radiographs are shown, indicating a delay in the onset ofsis in bortezomib-treated mice. There is an absence of clearly defined lesions in bortezomib-treated mice until day 35; in contrast, the controlas clear osteolysis by day 21 (box). Microlytic lesions are seen in the bortezomib group on day 35 (box). B, quantitation of radiographs. Averageee Materials and Methods) from each time point and all reviewers for control and bortezomib-treated mice is presented. This shows the presence ofsis from day 21 in control-treated mice but delay of osteolysis until day 35 in the bortezomib-treated group. Additionally, the increase in osteolysisthe final week of the experiment (days 42-49) is shown (days 21 and 28, P < 0.05; days 35, 42, and 49, P < 0.005). C, μCT images. Transversedistal to the physis (left) and three-dimensional reconstruction of the proximal tibia (right) of bortezomib- and control-treated mice (n = 3) 49 dg intratibial injection of MDA-MB-231 BrCa cells. The reduction in osteolysis is evident by an unresorbed periosteal surface in bortezomib-treatedred with control group. D, quantitation of μCT images. Relative bone volume at time was assessed by μCT analysis of the proximal tibia in two

with extensive osteolytic disease eroding throughrtex, whereas the tibias of the bortezomib-treatedmice





hadmQuantibiasbone vtogethmice h

BorteThe

in vivo

ing thusingimageactivimice.was ctumoC, lef

Fig. 2.injectioand cobottomin the cnormalthe 25%B, effeccontrolcontrol3 and 4tumor wBortezobortezoof growevaluatTRAP-pon cort

Jones et al.

Clin C4982

Do


inimal evidence of cortical erosionandmild osteolysis.titative analysis by μCT shows that the tumor-bearingof the bortezomib-treated mice have >2-fold higherolume than the tibias of controlmice (Fig. 1D). Takener, these findings show that the bortezomib-treatedad a striking inhibition of osteolytic disease.

zomib reduces the size of BrCa tumors
volume of intratibial BrCa tumors was measured destro
ositive cells (panels 2 and 3). In the bortezomib-treated group, bone architectureical surfaces (panels 2 and 3). Sections are TRAP stained and presented at ×5 (l



e mice with [18F]FDG and visualizing the tumorPET imaging. Figure 2A shows representative PETs that identify a larger tumor volume and metabolicty in controls compared with bortezomib-treatedA 2-fold increase in tumor volume in the controlonfirmed by histologic examination of tibias withrs from bortezomib and control mice (Fig. 2B andt). In controls, there is aggressive lytic disease
ying trabecular and cortical bone with tumor
in bortezomib- and control-treated mice by inject- growth invading muscle. In striking contrast, tumor

Bortezomib treatment reduces the size of BrCa tumors implanted in the mouse tibia. A, in vivo PET imaging. Thirty-nine days following intratibialn, mice were injected i.v. with 50 μCi [18F]FDG. Representative PET image reconstructions of the tumor-containing tibial region of bortezomib-treatedntrol mice overlaid on CT image reconstructions of the same region. The color corresponds to the intensity of the 18F signal and is scaled fromto top (black to white) as shown in the color bars, where black indicates 0% radioactivity uptake and white indicates 100% uptake. Higher intensityontrol (white area) reflects the three-dimensional size of the tumor, whereas red areas are those tumor cells with less metabolic activity. Blue istissue cellular activity. Controls exhibited a 50% to 100% (yellow) range of intensity, whereas the bortezomib group showed isotope labeling withinto 50% (orange) intensity range. Standard uptake value for the control mouse is 2.94 g/mL and for the bortezomib-treated mouse is 2.31 g/mL.

t of bortezomib on tumor growth and progression (H&E-stained sections). Top, representative histologic sections of proximal tibias from sixand bortezomib-treated mice, showing the tumor size and tibial bone loss. Magnification, ×5. Lower, representative sections of bortezomib- and-treated tibias. 1, muscle of bortezomib-treated tibia showing tumor growth; 2, marrow cavity of bortezomib-treated tibia with necrotic cells;, area of similar tumor growth in bortezomib (3) and control (4) tibias. Magnification, ×10. C, quantification of tumor size and growth. Left, areas ofere selected from multiple histologic sections (n = 5-7) of bortezomib-treated and control tibias (n = 3) and tumor size (mm2) was calculated.mib-treated mice had significantly (60%) smaller tumors compared with control mice (P < 0.0001). Right, Ki-67 immunohistochemistry was done onmib- and control-treated tumor sections. The Ki-67 growth fraction was calculated as the % of total cells that were positive for Ki-67. The fractioning tumor cells was also significantly less in bortezomib tumors than controls (n = 4, P < 0.05). D, effect of bortezomib on bone osteolysis ased by TRAP staining. In controls, the cells of the bone surface were already resorbed (panel 1), and only small pieces of fractured bone remained with

was preserved (panel 1) and osteoclast activity was presenteft), ×10 (middle), and ×40 (right) magnification.





growtrestricoccur(Fig.point1) ofcells wSolidcell m(panewithinfoundcontrodecrecompulatedafter iThe

controby TRsorbedof bonat ×10The btical sthe pefindinlytic dtumofactor

Bortethe dBrC

resorptire skbonewas dmeasucontrobeculaborteznificanincludconnelike atrabecmatiosignifthe pborteztumor

TreatinocuTo

establdecrea

protecwe exof tim231 ceffectrendeSecontreatmlikelihThe streatethat wi.p. thulatiobeforepretreited cof micinocuwith bthan u

Fig. 3.was doof MDAtrabecubortezovolumesignificant (P < 0.05) decrease, indicative of a more plate-like architecturein the b


www.a

Do


h in the bortezomib-treated mice was initiallyted to the medullary cavity until a cortical breakred, allowing slow tumor growth in muscle2B). The bottom panels of Fig. 2B illustrate this. Viable tumor cells are found in muscle (panelbortezomib-treated mice, whereas areas of necroticere evident within the medullary cavity (panel 2).tumor tissue outside the bone exhibited similarorphology between bortezomib and controls

ls 3 and 4). The fraction of actively growing cellsthe tumor was examined by Ki-67 detection andto be far less in bortezomib-treated tumor than inl tumor (Fig. 2C, right; P < 0.05). The modestase in tumor growth fraction (% Ki-67+ cells)ared with tumor size can be accounted for by stim-tumor growth in the bortezomib-treated mice

nvasion into muscle.effect of tumor growth on bone osteolysis inls is visualized by minimal detection of osteoclastsAP staining, as there is little bone remaining to be re-in controls (Fig. 2D, panel 1). Only small remnantse remained with TRAP-positive cells (panels 2 and 3and ×40 magnifications of osteoclasts, respectively).

ortezomib group exhibited osteoclast activity on cor-urfaces, where tumor growth was expanding alongriosteal side as well as on the endosteal surface. Thesegs suggest that bortezomib treatment reduces osteo-isease by killing off tumor cells and that remainingr cells can still locally secrete osteoclast-activatings and can survive as a solid tumor.

zomib promotes increased bone formation inistal femur of the nontumor-bearing limba cells secrete many factors that cause local bonetion and also circulate systemically to affect the en-eleton. To assess the influence of bortezomib onaway from the area of the BrCa tumor, μCT analysisone and various parameters of bone growth werered in the distal femur of bortezomib-treated andl mice. Figure 3 shows that there is increased tra-r bone formation in femurs of mice treated withomib compared with control as evidenced by sig-t improvement in the parameters of bone growth,ing bone volume fraction, trabecular thickness,ctivity density, and SMI (reflecting a more plate-rchitecture in the bortezomib-treated bone). Theular number and spacing showed greater bone for-n in bortezomib- treated mice, but did not reachicance. These results are entirely consistent withreviously described bone anabolic property ofomib (7) and occur in the presence of metastaticgrowth.

ment with bortezomib before tumor celllation protects bone from osteolysisassess clinical relevance, a study was designed to
ish if bortezomib given before tumor metastasissed tumor growth and osteolytic disease and would
the tiblesion

acrjournals.org


t the bone from subsequent osteolysis. Therefore,amined bortezomib treatment of mice for a periode before the intratibial inoculation of MDA-MB-ells. The rationale was 2-fold. First, the anabolicthat bortezomib treatment has on bone might

r the bone less susceptible to subsequent osteolysis.d, this has translational relevance, as bortezomibent might be used prophylactically to decrease theood of BrCa patients developing osteolytic lesions.tudy consisted of three groups: mice that were notd before or following tumor cell inoculation, miceere treated with bortezomib (0.3 mg/kg body weightree times a week) both before and after tumor inoc-n, and mice that were treated with bortezomib onlybut not after injection of tumor cells (bortezomib

atment; Fig. 4A). All three mice in each group exhib-onsistent results. Radiographic analysis of the tibiase pretreated with bortezomib 3 weeks before time oflation with BrCa cells and mice treated continuouslyortezomib both exhibited smaller osteolytic lesionsntreated mice (Fig. 4B). The radiographic grading of

ortezomib-treated bone.

Bortezomib causes increased bone formation. μCT analysisne on the distal femurs of NCr/SCID mice 49 d following injection-MB-231 BrCa cells into the right proximal tibia. Parameters oflar bone formation showed significant (P < 0.05) increases inmib-treated mice as noted by increased bone volume/total, trabecular thickness, and connectivity density. SMI showed a

ias showed a statistically significant lower osteolyticgrade in the bortezomib continuous and bortezomib





pretretumoosteol(P < 0Pati

tinuoaddreon bowouldwith atimedeterm

the skof thabovegroupular btezomfemurtrabecand cof tra

Fig. 4.three ginoculainjectiothe precells inhigher-osteolyosteolyfor ostedecreas us gropretrea

Jones et al.

Clin C4984

Do


atment groups compared with control mice withrs (P < 0.0001) and a more effective inhibition ofysis in the continuously treated bortezomib group.05; Fig. 4C).ents with metastatic BrCa have a potential for con-usly developing new bony lesions. Therefore, wessed if the anabolic effect of bortezomib treatmentnes that did not contain tumor (shown in Fig. 3)provide protection to the skeleton in a patient

dvanced BrCa, and if this effect would remain over

ed grade was found in bortezomib pretreatment and bortezomib continuotment compared with bortezomib continuous group (*, P < 0.05).

despite the presence of tumor at a remote site. Toine if treatment with bortezomib may protect

pretrecontin



eleton from subsequent osteolysis, μCT analysise femurs of the three groups of mice described(Fig. 4A) was done examining both femurs of each. Several significant changes are observed in trabec-one structure between the control and the two bor-ib groups and between the left femur and the right(Fig. 5). Bortezomib treatment supports increasedular bone formation in both tumor-bearing (right)ontralateral (left) limbs reflected in all parametersbecular bone, in both bortezomib continuous and

ups compared with control (**, P < 0.0001) and bortezomib

Treatment with bortezomib before tumor cell inoculation protects bone from osteolysis. A, experimental design. The experiment consisted ofroups: a control group treated with saline from 21 d before intratibial inoculation with BrCa until termination of the experiment at 25 d followingtion, a bortezomib pretreatment group that received 0.3 mg/kg bortezomib i.p. three times a week for 21 d before BrCa cell inoculation with salinen for 25 d following inoculation, and a continuous bortezomib treatment group that received 0.3 mg/kg bortezomib i.p. three times a week in bothinoculation and postinoculation periods. B, radiographic analysis of NCr/SCID mice taken at 25 d following injection of MDA-MB-231 BrCato the right proximal tibia and the treatment conditions described above. Presented are views of the entire tibia (n = 3) and representativemagnification views of the area in which the majority of the osteolysis occurred. Note the fibular head overlapping the tibia in the area of thetic lesion visualized in lower panel higher magnifications. The tibias of bortezomib pretreated and bortezomib continuous treatment show smallertic lesions than those in the control group at both time points. C, radiographs were independently scored based on a grading scale developedolytic lesions (n = 7 reviewers). Bortezomib pretreatment and bortezomib continuous groups had a lower grade than the control group. Significantly

atment groups, compared with control (Fig. 5,uous versus control; P < 0.05 to P < 0.005). Both





pretrea signincreaer, it iright lhave vthe lemiceresultThe bated dreceiv(befocantlyreceivpretrepulsedcells wand pfrompretretibialdays oto pro

Bortecells aTo

the celevelsMDAwith50 nmand su

showe10 nmand 7spectibortezas deprolifmib (Fig. 6Bstaineline, dsteadithen rmib.(boundasherant)ing nFig. 6was grelati50 nmand aby boMDA-bortezWe

ventinexpresorpti24 hoprom

Fig. 5.bortezocontralawas dofemurstreatmeFig. 4 (parameanabolibortezocontinucompathe rightumor-bthan th*, P < 0#, P < 0


www.a

Do


atment and continuous bortezomib groups exhibitedificant improvement in bone formation (∼60%se in bone volume) compared with control. Howev-s noteworthy that the femurs from the tumor-affectedeg of both bortezomib and control mice consistentlyalues that indicate less bone when compared withft femurs (Fig. 5, right versus left). This suggests thatdevelop disuse osteopenia in the right femur as aof decreased weight bearing on the tumored leg.one anabolic effects of bortezomib were not attenu-uring the subsequent tumor growth period. Miceing a 21-day course of bortezomib before treatmentre inoculation of tumor cells) did not have signifi-different bone parameters compared with the miceing continuous treatment (Fig. 5, continuous versusatment; P > 0.05). This effect is significant in that adose of bortezomib before inoculation of canceras sufficient to confer an anabolic effect on bonerovide protection from osteolysis. We conclude,the increased bone volume following 3 weeks ofatment in the nontumored femur and the reducedosteolysis after inoculation during the following 25f tumor growth, that bortezomib could contributetecting the skeleton in advanced BrCa.

zomib decreases survival of MDA-MB-231 BrCand affects gene expressiongain insight into the mechanisms of bortezomib onllular activities of BrCa cells, cell growth and mRNAof metastatic and osteolytic genes were examined.-MB-231 proliferating cells were treated in vitrovarying doses of bortezomib, ranging from 0 to
ol/L, to determine the effects on cell proliferationrvival. Initial cell count studies done after 24 hours
decrewhere

.0005.

acrjournals.org


d that adherent cell counts decreased beginning atol/L bortezomib (21% of control), with a 62%4% cell loss at 20 and 50 nmol/L bortezomib, re-vely (data not shown). The loss of cell viability byomib was the result mainly of necrosis of the cellstermined by an Annexin V binding assay done onerating cells treated with varying doses of bortezo-Fig. 6A). FACS analysis of the cells (represented in) showed that the percentage of viable cells (neitherd with PI nor bound to Annexin V; Fig. 6A, solidiamond; Fig. 6B, bottom-left quadrant) decreasedly to 60% at a dose of 20 nmol/L bortezomib andemained constant to a dose of 50 nmol/L bortezo-The percentage of cells undergoing apoptosisd to Annexin V, but not stained with PI; Fig. 6A,d line, open square; Fig. 6B, bottom-right quad-did not exceed 10%. The amount of cells undergo-ecrosis (bound to Annexin V and stained with PI;A, solid line, circle; Fig. 6B, upper-right quadrant)reater than that of apoptotic cells and remainedvely constant from bortezomib doses of 10 tool/L. These results indicate that both necrosis

poptosis contribute to death of MDA-MB-231 cellsrtezomib treatment, but also suggest that theMB-231 cell line may have a small population ofomib-resistant cells.determined the contribution of bortezomib in pre-g osteolytic disease by analyzing dose-dependentssion of marker genes associated with bone re-on and formation in MDA-MB-231 cells treatedurs with bortezomib (Fig. 6C). Expression of genesoting tumor growth (RUNX2, MMP-9, and VEGF)
ased at increased bortezomib concentrations,as GAPDH, an internal marker of cellular RNA
Anabolic effects ofmib in tumor-bearing andteral femurs. μCT analysisne on the bilateral distalof the mice from the threent groups described inn = 3). In all measuredters, there is a significantc effect evident in bothmib pretreatment andous treatment groupsred with controls. Note thatt femur, proximal to theearing tibia, has less bonee contralateral femur..05; +, P < 0.001;





levelswe foantagothe caindicgrowt

ing thosteolTo

bortez

Fig. 6.A, the r14 h wAnnexinPI positFACS dcells thAnnexinC, the ausing qis showD, genePCR, agene ex16 and nces w

Jones et al.

Clin C4986

Do


, remained constant. In response to bortezomib,und a steady increase in expression of the Wntnist DKK1 (31), with a concomitant decrease innonical Wnt transcription factor LEF1. This finding

35 for all the monitored genes (all <30, except RANKL). Significant differe

ated that bortezomib is inhibiting tumor cellh mediated by the Wnt pathway, as well as reduc-

blast cwithin



e levels of genes in MDA-MB-231 cells related toytic activity in bone (32).evaluate the mechanism for the anabolic effect ofomib on bone formation, we examined a preosteo-

ere seen in RANKL, MMP-9, and LEF1 (P < 0.05, n = 5).

Bortezomib treatment reduces cell proliferation and decreases cell viability of BrCa cells in vitro but does not induce significant apoptosis.elative number of viable cells, necrotic cells, and cells undergoing apoptosis following treatment with bortezomib in the range of 0 to 50 nmol/L foras measured by binding of FITC-conjugated Annexin V and staining with PI followed by FACS analysis. The percentage of gated cells that wereV and PI negative (live cell, solid line, diamond), Annexin V positive and PI negative (apoptotic cells, dashed line, open square), and Annexin V and

ive (necrotic cells, solid line, circle) are shown as a function of the increasing concentration of bortezomib treatment. B, bivariate plots of the primaryata for ungated cells treated with 0 and 50 nmol/L bortezomib. The quadrants, which are defined using FACSCalibur software and representat are Annexin V and PI negative (bottom left), Annexin V positive and PI negative (bottom right), Annexin V negative and PI positive (top left), andV and PI positive (top right), show a far greater proportion of cells in the quadrant representing necrosis in response to bortezomib treatment.mount of transcript of various genes in MDA-MB-231 cells treated with bortezomib in the range of 0 to 50 nmol/L bortezomib for 24 h was measureduantitative PCR and standardized to the amount of GAPDH transcript in the same cells. The amount of transcript relative to no bortezomib treatmentn for each concentration of bortezomib treatment used. The CT values for monitored genes were between 18 and 25, except for MMP-9 (CT, 35).transcript levels were measured in MC3T3 osteoblast-like cells following 24-h treatment with 0 to 50 nmol/L bortezomib using quantitative

s described above. The CT values were all <21. E, tumor tissue from mice treated with bortezomib or control for 28 d was analyzed for relevantpression by quantitative PCR. The amount of transcript of bortezomib-treated tumors relative to control is shown. The CT values were between

ell line (MC3T3) analogous to osteoprogenitor cellsthe marrow for its responsiveness to the same dose





range20 anand Bmatioing dopposin thelowerwith tma (3in respexciseMMP-the inin thewas stof theosteocWe

osteolmultipinducto Wnmor v9 ostecell acgrowt

Discu

Hertezomboneof memib oviciouactivaanti-osignifiogy, rbonetributmicrothat incells tand tboneborteanaboIn o

hibiti4 weeof thegroupnatedgroupgest tresult

dose ddoseindicacontritumoosteochas bBrCathat i7 weetumofoundin vitrthat ahigh dEar

trialslesionone ocancediminmultinet einhibiin boThus,cells ting osthat bBrCaWe

bortezto facmentsue reRUNXThis pmor vosteoof boDKK1concotor oftentiaare ve22). Bthe Wand dprognmib aexpresteobladosesand rema pa33), c


www.a

Do


that affects BrCa cells (Fig. 6D). The high doses ofd 50 nmol/L were toxic to both cell types, osteoblastsrCa cells, resulting in loss of expression of bone for-n markers (COL1 and AP in the osteoblasts). A strik-ifference between BrCa and MC3T3 cells was theite effects on the Wnt pathway, which was inhibitedtumor cells but was stimulated in osteoblasts atdoses for bone formation. This finding is consistenthe anabolic effect of bortezomib in multiple myelo-3). We next determined if the same effects occurredonse to the in vivo dose of bortezomib. Tumor tissued from the tibia showed a striking inhibition of9 with a modest increase in DKK, consistent withvitro effect of bortezomib in BrCa cells. Additionally,tumor tissue, RANKL, promoting bone resorption,imulated. This finding reflects the histologic analysesbortezomib-treated group (see Fig. 2D) exhibitinglastic activity.conclude from these studies that metastasis-associatedytic disease is reduced in vivo by bortezomib throughle mechanisms in the bone microenvironment: bying cellular necrosis, decreasing the tumor responset signaling, reducing expression of a key factor in tu-ascularization, and decreasing the RUNX2 and MMP-olytic cascade. Together, these modifications in tumortivity by bortezomib contribute to inhibiting tumorh to the bone microenvironment.

ssion

e, we established that the proteasome inhibitor bor-ib effectively suppresses BrCa tumor growth withinand stimulates new bone formation in the presencetastatic disease. Antitumor growth effects by bortezo-ccur in the bone microenvironment, where thes cycle of tumor growth and osteolytic disease isted in response to BrCa cells. We show that thesteolytic effects of bortezomib are primarily due tocantly decreased tumor size as evidenced by histol-adiographic monitoring, and μCT quantitation ofvolume. Lastly, we have defined mechanisms con-ing to the inhibition of tumor growth in the boneenvironment and osteolytic disease by bortezomibclude (a) the sensitivity of highly metastatic BrCao necrosis, (b) reduction in expression of metastaticumor growth–related genes, and (c) promotion offormation throughout the skeleton. These effects ofzomib provide a beneficial antitumor and bonelic effect.ur continuously treated study, we find a striking in-on of osteolytic disease that continued throughks after inoculation. However, at 5 weeks, evidenceonset of osteolysis was identified in the bortezomib, which slowly progressed until the study was termi-when tumor size became unbearable in the control(7 or 8 weeks in repeat study). The Ki-67 assays sug-
hat surviving tumor cells exposed to bortezomibin a delayed onset of osteolysis. As our bortezomib
tezomtumo

acrjournals.org


id not cause toxic effects in mice, perhaps a higherwould be more effective in killing all BrCa cells, asted from our in vitro studies. Two mechanisms arebuting to reduced osteolytic disease: the killing ofr cells by bortezomib and bortezomib inhibition oflast activity through induction of apoptosis, whicheen identified in several studies (17–19, 23–26).cells are known to produce many different factorsnduce osteolytic disease. Notably, at sacrifice afterks, we observe TRAP-positive osteoclasts at ther-bone interface in bortezomib-treated mice and alsoRANKL to be expressed in the tumor tissue. Our

o studies analyzing bortezomib dose effects suggestsmall population of MDA-MB-231 cells survive atoses.ly studies found mixed results in ongoing clinicalevaluating the effect of bortezomib on osteolytics caused by solid tumors (34–37). However, inther study using the intratibial model of prostater, it was suggested that osteoclast activity wasished (38), similar to what has been shown inple myeloma patients (39). In our studies, theffect of systemic bortezomib is that proteasometion is effective in preventing BrCa tumor growthne and greatly diminishes the osteolytic disease.just as bortezomib is used for multiple myelomahat have increased proteasome activity (40) induc-teolytic bone disease [as does BrCa (18)], we findortezomib has the similar anti-osteolytic effects intumors.identified mechanisms that are directly attributed toomib, modifying the properties of BrCa cells in vivoilitate an anabolic effect in the bone microenviron-in the presence of a tumor. Analysis of the tumor tis-vealed a reduction in the metastasis-related genes2, VEGF, and MMP-9 at high doses of bortezomib.rofile reflects altered cellular properties, reduced tu-ascularization, migration, matrix destruction, andlytic disease (27, 30, 41–44). Another mechanismrtezomib inhibiting tumor growth is by elevation of, an inhibitor of the Wnt signaling pathway, and amitant decrease in LEF1, the transcriptional media-Wnt signaling, thereby decreasing tumor growth po-l. In multiple myeloma patients, serum levels of DKKry low, contributing to activated Wnt signaling (21,rCa tumorigenesis and bone metastasis are linked tont signaling pathway, having downregulated DKKysregulation of β-catenin linked to progression andosis (31, 45–47). These beneficial effects of bortezo-re also observed in the tumor tissue by the changes insed genes (reduced LEF1 and MMP-9). Notably, os-sts have the opposite response at low bortezomib, exhibiting increased LEF1/TCF4, AP, and COL1flecting bone formation activity. In multiple myelo-tients, bortezomib stimulates osteoblast activity (22,onsistent with the significant anabolic effect of bor-
ib in the nontumor-bearing limbs of mice with boners.




Oubortezbonevolum3-weethe skfemurthe boosteolbolicrepresimplicinhibiif borfor BrIn s

morsmetascell prpathwducinand intion (

bortezpreveconclubenefand in

Discl

D.C.research

Grant

StudS10RR0EndocrmembeResourcresponsviews o

Thepaymenadvertiindicate

Refe1. Sp

in c2. Ad

a n199

3. Andru

4. Giubomu

5. HeactEu

6. Zaismy

7. Mugeten491

8. Qiadifsig

9. Pesomlatein v

10. Shalkrefbla

11. Tedis10

12. Gnzol360

13. Va

Jones et al.

Clin C4988

Do


r studies are significant, as the anabolic effects ofomib on BrCa-free bone in the setting of metastaticdisease were shown by a 1.5-fold increase in bonee. Furthermore, we showed that the effects of ak pretreatment allowed accrual of bone throughouteleton from the analyses of the nontumor-bearings. This suggests a preemptive, protective effect tone, thereby diminishing the effect of tumor-mediatedysis. Thus, we find an additional benefit to the ana-bone effect, as pretreatment with bortezomib has asive effect on subsequent tumor growth. The clinicalations of these results are considerable. Proteasometors could provide a protective effect on the skeletontezomib were to be combined with other treatmentsCa before metastasis.ummary, proteasome inhibitors may treat solid tu-and the osteolytic bone disease that accompaniestasis by myriad effects that include decreasing tumoroliferation and survival, inhibiting bone-destructiveays and enzymes and vascularity of the tumors, re-g osteoclast number and function (17, 24, 25, 39),
creasing osteoblast differentiation and bone forma-
show inhibitory effects ofRece

publish

edronic acid in premenopausal breast cancer. N Engl J Med 2009;:679–91. Erratum in: N Engl J Med 2009;360:2379.

lachis A, Polyzos NP, Georgoulias V, Mavroudis D, Mauri D. Lack

ofsp

14. Cotio

15. Diecu

16. Kinint66

17. voos

18. Ro20

19. Uyity20

20. GaosJ C

21. Tediccewit

22. Hedemy

23. Ahpoinvpro

24. ZaabBio

25. Hoosdo

26. BoPu



omib on solid tumor (BrCa) growth in bone andntion of the early-onset osteolytic disease. Wede that proteasome inhibitors have multifactorialicial effects in prevention of BrCa growth in boneduced osteolysis.

osure of Potential Conflicts of Interest

Ayers: commercial research grant, Zimmer, Inc.; other commercialsupport, Musculoskeletal Transplant Foundation (MTF).

Support

ies reported were in part supported by NIH grants P01CA082834,23540, and F32AR055030.Core resources supported by theDiabetesinology Research Center grant DK32520 were also used. J.B. Lian is ar of the University of Massachusetts Diabetes and Endocrinologye Center (DK32520). The contents of this manuscript are solely theibility of the authors and do not necessarily represent the officialf the NIH.costs of publication of this article were defrayed in part by thet of page charges. This article must therefore be hereby markedsement in accordance with 18 U.S.C. Section 1734 solely tothis fact.

ived 12/15/2009; revised 08/19/2010; accepted 08/25/2010;ed OnlineFirst 09/15/2010.
7, 9, 22, 33). Our studies
rencesataro V, Norbury C, Harris AL. The ubiquitin-proteasome pathwayancer. Br J Cancer 1998;77:448–55.ams J, Palombella VJ, Sausville EA, et al. Proteasome inhibitors:ovel class of potent and effective antitumor agents. Cancer Res9;59:2615–22.de SR, Chen J, Maddika S. The ubiquitin pathway: an emergingg target in cancer therapy. Eur J Pharmacol 2009;625:199–205.liani N, Morandi F, Tagliaferri S, et al. The proteasome inhibitorrtezomib affects osteoblast differentiation in vitro and in vivo inltiple myeloma patients. Blood 2007;110:334–8.ider U, Kaiser M, Muller C, et al. Bortezomib increases osteoblastivity in myeloma patients irrespective of response to treatment.r J Haematol 2006;77:233–8.ngari M, Esseltine D, Lee CK, et al. Response to bortezomibassociated to osteoblastic activation in patients with multipleeloma. Br J Haematol 2005;131:71–3.kherjee S, Raje N, Schoonmaker JA, et al. Pharmacologic tar-ing of a stem/progenitor population in vivo is associated withhanced bone regeneration in mice. J Clin Invest 2008;118:–504.ng YW, Hu B, Chen Y, et al. Bortezomib induces osteoblastferentiation via Wnt-independent activation of β-catenin/TCFnaling. Blood 2009;113:4319–30.nnisi A, Li X, Ling W, Khan S, Zangari M, Yaccoby S. The protea-e inhibitor, bortezomib suppresses primary myeloma and stimu-s bone formation in myelomatous and nonmyelomatous bonesivo. Am J Hematol 2009;84:6–14.imazaki C, Uchida R, Nakano S, et al. High serum bone-specificaline phosphatase level after bortezomib-combined therapy inractory multiple myeloma: possible role of bortezomib on osteo-st differentiation. Leukemia 2005;19:1102–3.rpos E, Sezer O, Croucher P, Dimopoulos MA. Myeloma boneease and proteasome inhibition therapies. Blood 2007;110:98–104.ant M, Mlineritsch B, Schippinger W, et al. Endocrine therapy plus

evidence for fracture prevention in early breast cancer bispho-honate trials: a meta-analysis. Gynecol Oncol 2010;117:139–45.sta L. Bisphosphonates: reducing the risk of skeletal complica-ns from bone metastasis. Breast 2007;16 Suppl 3:S16–20.l IJ, Bergner R, Grotz KA. Adverse effects of bisphosphonates:rrent issues. J Support Oncol 2007;5:475–82.g AE, Umland EM. Osteonecrosis of the jaw in patients receivingravenous or oral bisphosphonates. Pharmacotherapy 2008;28:7–77.n Metzler I, Krebbel H, Hecht M, et al. Bortezomib inhibits humanteoclastogenesis. Leukemia 2007;21:2025–34.odman GD. Pathogenesis of myeloma bone disease. Leukemia09;23:435–41.GL, Trivedi R, Peles S, et al. Bortezomib inhibits osteoclast activ-in patients with multiple myeloma. Clin Lymphoma Myeloma07;7:587–9.rrett IR, Chen D, Gutierrez G, et al. Selective inhibitors of theteoblast proteasome stimulate bone formation in vivo and in vitro.lin Invest 2003;111:1771–82.

rpos E, Heath DJ, Rahemtulla A, et al. Bortezomib reduces serumkkopf-1 and receptor activator of nuclear factor-κB ligand con-ntrations and normalises indices of bone remodelling in patientsh relapsed multiple myeloma. Br J Haematol 2006;135:688–92.ider U, Kaiser M, Mieth M, et al. Serum concentrations of DKK-1crease in patients with multiple myeloma responding to anti-eloma treatment. Eur J Haematol 2009;82:31–8.n KS, Sethi G, Chao TH, et al. Salinosporamide A (NPI-0052)tentiates apoptosis, suppresses osteoclastogenesis, and inhibitsasion through down-modulation of NF-κB regulated geneducts. Blood 2007;110:2286–95.vrski I, Krebbel H, Wildemann B, et al. Proteasome inhibitorsrogate osteoclast differentiation and osteoclast function. Biochemphys Res Commun 2005;333:200–5.ngming H, Jian H. Bortezomib inhibits maturation and function ofteoclasts from PBMCs of patients with multiple myeloma by
wnregulating TRAF6. Leuk Res 2009;33:115–22.issy P, Andersen TL, Lund T, Kupisiewicz K, Plesner T, Delaisse JM.lse treatment with the proteasome inhibitor bortezomib inhibits




ost200

27. PraIndbre

28. BoOvJ B

29. GlainJ B

30. Rataten

31. Zhresco202

32. Pration

33. Oymamy

34. CrewitCa

35. Sczompre200

36. Enageins

37. Ya(VElog20

38. Whteace

39. Temydis

40. EdincproAm

41. Prascrsta25

42. Prasiostr20

43. Grura9:1

44. RotheceTh

45. Loizapa

46. PrDetasgro20

47. Ba


www.a

Do


eoclast resorptive activity in clinically relevant conditions. Leuk Res8;32:1661–8.tap J, Wixted JJ, Gaur T, et al. Runx2 transcriptional activation ofian hedgehog and a downstream bone metastatic pathway inast cancer cells. Cancer Res 2008;68:7795–802.uxseinML,MyersKS,ShultzKL,DonahueLR,RosenCJ,BeamerWG.ariectomy-induced bone loss varies among inbred strains of mice.one Miner Res 2005;20:1085–92.tt V, Canalis E, Stadmeyer L, Bouxsein ML. Age-related changestrabecular architecture differ in female and male C57BL/6J mice.one Miner Res 2007;22:1197–207.jagopalan S, Lu L, Yaszemski MJ, Robb RA. Optimal segmen-ion of microcomputed tomographic images of porous tissue-gineering scaffolds. J Biomed Mater Res A 2005;75:877–87.ou XL, Qin XR, Zhang XD, Ye LH. Downregulation of Dickkopf-1 isponsible for high proliferation of breast cancer cells via losingntrol of Wnt/β-catenin signaling. Acta Pharmacol Sin 2010;31:–10.tap J, Lian JB, SteinGS.Metastatic bone disease: role of transcrip-factors and future targets. Bone 2010 [Epub ahead of print].

ajobi BO, Garrett IR, Gupta A, et al. Stimulation of new bone for-tion by the proteasome inhibitor, bortezomib: implications foreloma bone disease. Br J Haematol 2007;139:434–8.sta S, Sessa C, Catapano CV, et al. Phase I study of bortezomibh weekly paclitaxel in patients with advanced solid tumours. Eur Jncer 2008;44:1829–34.hmid P, Kuhnhardt D, Kiewe P, et al. A phase I/II study of borte-ib and capecitabine in patients with metastatic breast cancerviously treated with taxanes and/or anthracyclines. Ann Oncol8;19:871–6.

gel RH, Brown JA, Von Roenn JH, et al. A phase II study of singlent bortezomib in patients with metastatic breast cancer: a singletitution experience. Cancer Invest 2007;25:733–7.ng CH, Gonzalez-Angulo AM, Reuben JM, et al. Bortezomib
LCADE) in metastatic breast cancer: pharmacodynamics, bio-ical effects, and prediction of clinical benefits. Ann Oncol06;17:813–7.
tioofRe

acrjournals.org


ang PG, Gamradt SC, Gates JJ, Lieberman JR. Effects of the pro-some inhibitor bortezomib on osteolytic human prostate cancerll metastases. Prostate Cancer Prostatic Dis 2005;8:327–34.rpos E. Bortezomib directly inhibits osteoclast function in multipleeloma: implications into the management of myeloma boneease. Leuk Res 2008;32:1646–7.wards CM, Lwin ST, Fowler JA, et al. Myeloma cells exhibit anrease in proteasome activity and an enhanced response toteasome inhibition in the bone marrow microenvironment in vivo.J Hematol 2009;84:268–72.tap J, Javed A, Languino LR, et al. The Runx2 osteogenic tran-iption factor regulates matrix metalloproteinase 9 in bone meta-tic cancer cells and controls cell invasion. Mol Cell Biol 2005;:8581–91.tap J, Imbalzano K, Underwood J, et al. Ectopic Runx2 expres-n in mammary epithelial cells disrupts formation of normal aciniucture: implications for breast cancer progression. Cancer Res09;69:6807–14.eenberg JI, Cheresh DA. VEGF as an inhibitor of tumor vessel mat-tion: implications for cancer therapy. Expert Opin Biol Ther 2009;347–56.land CL, Dineen SP, Lynn KD, et al. Inhibition of vascular endo-lial growth factor reduces angiogenesis and modulates immunell infiltration of orthotopic breast cancer xenografts. Mol Cancerer 2009;8:1761–71.pez-Knowles E, Zardawi SJ, McNeil CM, et al. Cytoplasmic local-tion of β-catenin is a marker of poor outcome in breast cancertients. Cancer Epidemiol Biomarkers Prev 2010;19:301–9.evidi S, Maroni P, Matteucci E, Broggini M, Bendinelli P,siderio MA. Interaction between human-breast cancer metas-is and bone microenvironment through activated hepatocytewth factor/Met and β-catenin/Wnt pathways. Eur J Cancer10;46:1679–91.rnes GL, Javed A, Waller SM, et al. Osteoblast-related transcrip-n factors Runx2 (Cbfa1/AML3) and MSX2 mediate the expression
bone sialoprotein in human metastatic breast cancer cells. Cancers 2003;63:2631–7.




Documents

A Proteasome Inhibitor, Bortezomib, Inhibits Breast Cancer … · 2019-04-30 · proteasome inhibitor used to treat multiple myeloma, has a potent anabolic effect on bone (4–9)