9

A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei

Download PDF Report

Upload
dinhmien
View
217
Download
1

Embed Size (px)

Citation preview

Page 1: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei

Page 2: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei

Page 3: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei

Page 4: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei

Page 5: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei

Page 6: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei

Page 7: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei

Page 8: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei

Page 9: A Prediction Approach to Well Logging.dl.ifip.org/db/conf/ifip12/iip2004/HeLSHS04.pdf · Title: A Prediction Approach to Well Logging. Author: Qing He, Ping Luo, Zhongzhi Shi, Yalei

Lecture 9: Branch Prediction, Dependence Speculation, and Data Prediction

Lecture 9: Branch Prediction, Dependence Speculation, and Data Prediction

Documents

Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction

Tutorial 11 RNA Structure Prediction. Introduction – RNA secondary structure RNAfold – RNA secondary structure prediction TargetScan – microRNA prediction

Documents

Agent-Grid Intelligence Platform for Collaborative Working … · 2006. 6. 3. · 2006-6-3 AGrIP-SELMAS Zhongzhi Shi 13 Reasoning in DL 1) Subsumption 2) consistency ... Module Interface

Agent-Grid Intelligence Platform for Collaborative Working … · 2006. 6. 3. · 2006-6-3 AGrIP-SELMAS Zhongzhi Shi 13 Reasoning in DL 1) Subsumption 2) consistency ... Module Interface

Documents

Linear Prediction Problem: Forward Prediction Observing Predict Backward Prediction Observing Predict

Linear Prediction Problem: Forward Prediction Observing Predict Backward Prediction Observing Predict

Documents

Bioinformatics. Sequence information Mapping information Phenotypic information Literature Prediction programs -Gene prediction -Promotor prediction -Functional

Bioinformatics. Sequence information Mapping information Phenotypic information Literature Prediction programs -Gene prediction -Promotor prediction -Functional

Documents

Prediction Markets 2018columns.virtualprivatelibrary.net/Prediction_Markets_2018_Dec17_Co… · Prediction Markets 2018 ... 17

Prediction Markets 2018columns.virtualprivatelibrary.net/Prediction_Markets_2018_Dec17_Co… · Prediction Markets 2018 ... 17

Documents

Protein Tertiary Structure Prediction. Protein Structure Prediction & Alignment Protein structure Secondary structure Tertiary structure Structure prediction

Protein Tertiary Structure Prediction. Protein Structure Prediction & Alignment Protein structure Secondary structure Tertiary structure Structure prediction

Documents

Distributed Classification in Peer-to-Peer Networks Ping Luo, Hui Xiong, Kevin Lü, Zhongzhi Shi Institute of Computing Technology, Chinese Academy of Sciences

Distributed Classification in Peer-to-Peer Networks Ping Luo, Hui Xiong, Kevin Lü, Zhongzhi Shi Institute of Computing Technology, Chinese Academy of Sciences

Documents

Commodity Price Prediction using An Artificial Prediction Market based Approach · · 2017-09-07Commodity Price Prediction using An Artificial Prediction Market based Approach July

Commodity Price Prediction using An Artificial Prediction Market based Approach · · 2017-09-07Commodity Price Prediction using An Artificial Prediction Market based Approach July

Documents

Assessment of prediction error of risk prediction models

Assessment of prediction error of risk prediction models

Documents

Drug Response Prediction as a Link Prediction Problem

Drug Response Prediction as a Link Prediction Problem

Documents

Earthquake Prediction and Earthquake Damage Prediction

Earthquake Prediction and Earthquake Damage Prediction

Documents

RNA Structure Prediction Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction

RNA Structure Prediction Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction

Documents

Prediction of protein disorder - aidanbudd.github.io · IDP prediction and other 1D prediction methods Secondary structure prediction methods Coil is an ordered, irregular structural

Prediction of protein disorder - aidanbudd.github.io · IDP prediction and other 1D prediction methods Secondary structure prediction methods Coil is an ordered, irregular structural

Documents

Approaches to Skin Sensitisation Prediction...Defined approach prediction vs in vivo outcome LLNA n = 174 Acc = 73% no cat cat no at no at Under-prediction Over-prediction Under-prediction

Approaches to Skin Sensitisation Prediction...Defined approach prediction vs in vivo outcome LLNA n = 174 Acc = 73% no cat cat no at no at Under-prediction Over-prediction Under-prediction

Documents

Prediction Market Uses (Other Than Prediction) - Bitcoin Hivemindbitcoinhivemind.com/papers/3_PM_Applications.pdf · 2020-04-14 · Prediction Market Uses (Other Than Prediction)

Prediction Market Uses (Other Than Prediction) - Bitcoin Hivemindbitcoinhivemind.com/papers/3_PM_Applications.pdf · 2020-04-14 · Prediction Market Uses (Other Than Prediction)

Documents

Gene prediction. Gene Prediction: Computational Challenge aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatg ctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgc

Gene prediction. Gene Prediction: Computational Challenge aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatg ctaatgcatgcggctatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgc

Documents

Classification and Prediction. What is classification? What is prediction? Issues regarding classification and prediction Classification by decision

Classification and Prediction. What is classification? What is prediction? Issues regarding classification and prediction Classification by decision

Documents

Decadal prediction of sustainable agricultural and forest management - Earth system prediction differs from climate prediction

Decadal prediction of sustainable agricultural and forest management - Earth system prediction differs from climate prediction

Environment

Lucia R. Wu HHS Public Access Sherry X. Chen Yalei Wu

Lucia R. Wu HHS Public Access Sherry X. Chen Yalei Wu

Documents

Gene prediction in flies ● Background ● Gene prediction pipeline ● Resources

Gene prediction in flies ● Background ● Gene prediction pipeline ● Resources

Documents

Prediction Markets 2020columns.virtualprivatelibrary.net/Prediction_Markets...Prediction Markets 2020 ... 20

Prediction Markets 2020columns.virtualprivatelibrary.net/Prediction_Markets...Prediction Markets 2020 ... 20

Documents

Bo Wang Wenpin Jiao Qijia Tian Zhongzhi Shi Lab of Intelligent Information Processing Institute of Computing Technology Chinese Academy of Sciences, China

Bo Wang Wenpin Jiao Qijia Tian Zhongzhi Shi Lab of Intelligent Information Processing Institute of Computing Technology Chinese Academy of Sciences, China

Documents

ICT Innovation and Application (ICIIA2007) · International Conference on ICT Innovation and Application (ICIIA2007) Zhongzhi Shi shizz@ics.ict.ac.cn Institute of Computing Technology

ICT Innovation and Application (ICIIA2007) · International Conference on ICT Innovation and Application (ICIIA2007) Zhongzhi Shi [email protected] Institute of Computing Technology

Documents

Prediction Markets 2018 - VirtualPrivateLibrarywhitepapers.virtualprivatelibrary.net/Prediction Markets.pdfPrediction Markets 2018 White Paper Link Compilation ... enric/papers/prediction-markets-ArgMAS.pdf

Prediction Markets 2018 - VirtualPrivateLibrarywhitepapers.virtualprivatelibrary.net/Prediction Markets.pdfPrediction Markets 2018 White Paper Link Compilation ... enric/papers/prediction-markets-ArgMAS.pdf

Documents

Data Mining: Classification. Classification and Prediction zWhat is classification? What is prediction? zIssues regarding classification and prediction

Data Mining: Classification. Classification and Prediction zWhat is classification? What is prediction? zIssues regarding classification and prediction

Documents

Prediction of New Observations - ETH Z...Content • Introduction • Prediction of Mixed Effects • Prediction of Future Observation • Principles of Prediction – Prediction Process

Prediction of New Observations - ETH Z...Content • Introduction • Prediction of Mixed Effects • Prediction of Future Observation • Principles of Prediction – Prediction Process

Documents

Classification and Prediction - SRM · PDF file1 Classification and Prediction • What is classification? What is prediction? • Issues regarding classification and prediction •

Classification and Prediction - SRM · PDF file1 Classification and Prediction • What is classification? What is prediction? • Issues regarding classification and prediction •

Documents

An Efficient Data Indexing Approach on Hadoop using Java ... · Java Persistence API Yang Lai, Shi Zhongzhi To cite this version: Yang Lai, Shi Zhongzhi. An Efficient Data Indexing

An Efficient Data Indexing Approach on Hadoop using Java ... · Java Persistence API Yang Lai, Shi Zhongzhi To cite this version: Yang Lai, Shi Zhongzhi. An Efficient Data Indexing

Documents

Advancing Climate Prediction Science – Decadal Prediction

Advancing Climate Prediction Science – Decadal Prediction

Technology