286 Chiang Mai J. Sci. 2014; 41(2)

Chiang Mai J. Sci. 2014; 41(2) : 286-297http://epg.science.cmu.ac.th/ejournal/Contributed Paper

A Phylogenetic Analysis of Thai Hedychium(Zingiberaceae) and Development of SCAR Markerfor Hedychium flavescens Carey ex RoscoeRatchuporn Suksathan [a,d], Somboon Anuntalabhochai* [b], Arunothai Jampeetong [c],Siriwoot Sookkhee [e] and Sunee Chansakaow [a][a] Department of Pharmaceutical Sciences, Faculty of Pharmacy, Chiang Mai University,

Chiang Mai 50200,Thailand.[b] Biotechnology Unit, University ofPhayao, Muang, Phayao, 56000, Thailand.[c] Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200, Thailand.[d] Queen Sirikit Botanic Garden, P.O.Box 7, Mae Rim, Chiang Mai, 50180, Thailand.[e] Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailand.*Author for correspondence; e-mail: soanu.1@gmail.com

Received: 17 September 2012Accepted: 11 February 2013

ABSTRACTHigh annealing temperature rapid amplified polymorphic DNA (HAT-RAPD) was

used as the screening method for identification of 23 Thai Hedychuim species. From 16 arbitraryprimers, a total of 2,112 distinct polymorphic band patterns were generated. To understandthe relationship among Hedychium samples and three other genera of Zingiberaceae, aphylogenetic tree was generated from highly polymorphic data obtained from PCRamplification of DNA samples using character state data. The important character for eachclade was discussed. The unique band (519 bp) that only present in H. flavescens, a valuablespecies for horticulture importance and source of natural products, was obtained from theprimer OPAG-19 and selected for sequencing and conversion to the more reproducibleand robust sequence characterized amplified region (SCAR) marker specific to H. flavescens.These techniques for species identification and characterization provides a morphologicallyindependent test to verify relatedness and provide species information particularly for caseswhere such identification was previously impossible to obtain, for instance, in case ofmorphologically indistinguishable rhizome or vegetative parts in off-season or dormancy period.

Keywords: Hedychium J. K nig, Hedychium flavescens Carey ex Roscoe, HAT-RAPD, SCARmarkers1. INTRODUCTION

The genus Hedychium J. K nig(Zingiberaceae) comprises about 80 speciesof which approximately 23 are found inThailand [1-3]. Most species are fragrantand some species are widely cultivated

for ornamental purposes [1]. The chemicalconstituents of Hedychium, their ethnobotanicaluses and biological activities, have beenreported [4-5]. Monoterpenes are abundantin Hedychium [6], while terpenes are well-

Chiang Mai J. Sci. 2014; 41(2) 287

known compounds for aromatic ingredientsand antimicrobial properties [7]. Hedychium ispopular for both ornamental and medicinalpurposes, as well as a source of naturalperfume which is safer than syntheticcompounds. H. flavescens provides yellow-white showy flowers with a pleasant smell;moreover, it has been used for medicinalpurposes [8]. Its rhizome oil was found tocontain the highest monoterpene contentand showed the strongest antimicrobialactivity compared to H. coronarium, H. spicatumvar. acuminatum and H. venustum [4]. In addition,crude extract from leaves of H. flavescens gavethe strongest antibacterial and antioxidanteffect compared to 13 other species ofHedychium (Suksathan, unpublished results).This information underlines the potential ofH. flavescens in pharmacy and the perfumeindustry besides being ornamental plants.Hedychium, however, comprises perennialrhizomatous herbs with mostly distinctdormancy periods flowering once a year.Furthermore some species have very similarmorphological forms, i.e., leaf (H. flavescensvs terrestrial Hedychium species), inflorescenceand flower (H. flavescens vs H. coronariumcomplex). The species are therefore easilymisidentified.

Randomly amplified polymorphic DNA(RAPD) is a molecular technique using aPCR-based method, which does not requireprevious sequence information of thegenome to be studied. In a RAPD assay, ashort, usually ten nucleotides long, arbitraryprimer is used, which generally anneals withmultiple sites in different regions of thegenome and amplifies several genetic locisimultaneously. This technique is simple,relatively inexpensive and has been employedto analyze the intra-and intergeneric [9-10]genetic diversity of plants includingspecies and variety identification. The RAPDtechnique can detect DNA segments present

in individual samples to infer geneticrelationships between different samples.A serious shortcoming of RAPD is, however,inconsistency of banding patterns due tohigh sensitivity to reaction conditions [11].To mitigate this problem, high-annealing-temperature RAPD (HAT-RAPD) techniquehas been developed to provide morereproducibility by increasing the temperaturefor the primer annealing step above 46°Cinstead of 35-38°C in RAPD reactions [9].This form of genomic analysis allows arandom sampling of the complete genometo provide information about phenotypictraits of interest. The phylogenetic diversityreferring to relatedness among plant sampleshave been noted by scoring the presence orabsence of HAT-RAPD polymorphic bandsin the amplified products and constructionof dendrograms by measure of genomicpolymorphism. Dendrograms generatedfrom the analysis were compared withknown background data for each plantsamples. HAT-RAPD has successfully beenutilized to study genetic diversity of plantsand DNA patterns of interest for instance,Musa [10], Litchi chinensis, Dimocarpus longan,Peuraria [11], Curcuma [12], basil cultivars [13],and Ficus [14]. Furthermore, the presence orabsence of an amplified band can be used asa distinguishing unique character of thatspecies or clade of species. Then sequencecharacterized amplified region (SCAR)markers [15] can be developed to producereliable unique PCR-based results fromthe polymorphic HAT-RAPD markers.The SCAR marker method is similar to theRAPD method but uses longer primers(18-24 bases) to increase the specificity ofthe primers. The results are less sensitive tochanges in reaction conditions and aresignificantly more reproducible. SCARmarker has successfully been utilizedto characterize a variety of plant specific

288 Chiang Mai J. Sci. 2014; 41(2)

phenotypes referring to the characteristicband from gel-electrophoresis result [15].Such a methodology has been successfullydemonstrated in a characterization of severalplants in many areas such as agriculture andtaxonomy in Curcuma [12] Ficus [14] lycheecultivars [16] longan cultivars [17] and Thaifragrant rice mutants [18]. In addition, thismethod has been used for detection ofpapaya seed adulteration in traded blackpepper powder [19] and discrimination ofArtemisia herbs from other dried leaves asmedicinal material in traditional Koreanmedicine markets [20].

HAT-RAPD markers used as an initialscreen for characterization of the relatednessamong thirty-five Hedychium samples andthese characters were then used to generatea dendrogram upon which morphologicalversus genomic characters are compared.Consequently, DNA band of interest wasdetermined unique SCAR marker which candistinguish single lineage of H. flavescens.The identification of species-specific DNAmarkers for Hedychium to allow for theirproper identification during all developmentalstages would be of immense importancefor ornamental plant markets. In addition,

phylogenetic study would reflect therelatedness of plants in the same group inboth morphological characters and chemicalproperties.

The purpose of this study is to: (1)develop an algorithm to identify bothconserved and polymorphic bands generatedwith each arbitrary primer; (2) assembleHAT-RAPD marker polymorphic data andcompute genetic diversity and relatedness ofplant samples visible in a dendrogram;(3) develop unique SCAR marker fromcharacteristic HAT-RAPD band, which candistinguish a single lineage of H. flavescens.

2. MATERIALS AND METHODS2.1 Plant Materials

Thirty-five samples (23 species) ofHedychium and three other Zingiberaceaemembers as outgroup; Curcuma comosa Roxb.,Zingiber sp. and Amomum biflorum Jack, werecollected from living collection of QueenSirikit Botanic Garden, Chiang Mai, Thailand.Their voucher specimens are deposited inQueen Sirikit Botanic Garden Herbarium(QBG). The name list and specimenherbarium number of each sample are shownin Table 1.

Table 1. Collection data for the investigated Hedychium species.No Voucher Scientific name Distribution Habit Inflo.-br. flo./br. flo.form Note1 MTW1157 H. neocarneum 1 N, NE t NI >1 0 La2 MTW1225 H. neocarneum 2 N, NE t NI >1 0 La3 MTW1514 H. coccineum 3 N t NI >1 0 La4 MTW1122 H. coccineum 2 N t NI >1 0 La5 MTW1513 H. coccineum 1 N t NI >1 0 La6 MTW770 H. coccineum var. 1 N t NI >1 0 La7 MTW1510 H. aureum 1 N/S e NI 1 +/-0 -8 MTW162 H. aureum 2 N/S e NI 1 +/-0 -9 MTW606 H. tomentosum N/NE/S e NI 1 * Lf10 MTW1523 H. glabrum N/S e NI 1 0 La11 MTW1528 H. cf. poilanii N/S e NI 1 0 -12 Maknoi51 H. gomezianum N/S e NI 1 0 -13 MTW1526 H. pauciflorum 1 N/ NE e NI 1 0 La14 MTW765 H. forrestii 2 N t NI >1 * La15 MTW1267 H. forrestii 1 N t NI >1 * La16 MTW1532 H. pauciflorum 2 N/ NE e NI 1 0 La17 R.Spanuchat09-1 H. coronarium 1 C t I >1 * La18 MTW1155 H. coronarium 2 C t I >1 * La19 MTW1516 H. coronarium var.chrysoleucum C t I >1 * La

Chiang Mai J. Sci. 2014; 41(2) 289

Table 1. Continued.No Voucher Scientific name Distribution Habit Inflo.-br. flo./br. flo.form Note20 MTW1524 H. cf. gracillimum N e I 1 * -21 MTW675 H. ximengense N/S t I >1 0 La22 R.Spanuchat 09-2 H. stenopetalum 1 N/NE t NI >1 0 La23 MTW1120 H. stenopetalum 2 N/NE t NI >1 0 La24 MTW1401 H. spicatum N t / e NI 1 * La25 MTW198 H. flavescens 1 C t I >1 * La26 MTW175 H. flavescens 2 C t I >1 * La27 MTW1519 H. ellipticum 4 N/NE st I 1 * -28 MTW462 H. ellipticum 3 N/NE st I 1 * -29 MTW1517 H. ellipticum 2 N/NE st I 1 * -30 MTW1520 H. ellipticum 1 N/NE st I 1 * -31 Suksathan3019 H. khaomaenense N/S e I 1-2 0 La32 MTW750 H. biflorum N/S e NI >1 0 La33 MTW1150 H. speciosum N/S t NI >1 0 La34 MTW1534 H. villosum 1 N/NE/S t / e NI >1 0 La35 Suksathan 1574 H. villosum 2 N/NE/S t / e NI >1 0 La

Distribution of Hedychium in Thailand: N= North, NE= North-East, S= South, and C= cultivated throughout Thailand;Plant habit: t= Terrestrial, st= Sub-terrestrial or growing mainly on rock or well drain slopes, e= Epiphytic/Epilithic;Inflorescence-bract: NI= not imbricate, I= imbricate; Floral morphology: *= filament shorter than labellum,0= filament longer than labellum; La= labellum apex 2-cleft, Lf= lower leaf tomentose, Numbers after scientific namesrefer to the different collections of the same species.

2.2 DNA Preparation and HAT-RAPDReaction to Construct Dendrogram

To isolate total genomic DNA for theanalysis, young leaves were ground to a finepowder in liquid nitrogen and the DNAextraction were carried out by following themethod of Doyle and Doyle (1990). DNAwas obtained after incubating groundplant samples in CTAB extraction buffer (4%(w/v) CTAB, 1.4 M NaCl, 20 mM EDTA,100 mM Tris-HCl pH 8.0, 1% (w/v)polyvinylpolypyrrolidone, and 0.1% (v/v)β-mercaptoethanol) at 65°C for 60 min,followed by RNase treatment and phenolextraction. A hundred milligrams of DNAwas amplified using decamer primers ofarbitrary sequence (Operon Technologies,Almeda, California) following the highannealing temperature rapid amplifiedpolymorphic DNA (HAT-RAPD) protocol[9]. Briefly, the PCR reaction used a totalvolume of 20 μl containing 10X Taq buffer(Fermentas, USA), 2 mM MgCl2 (Fermentas,USA), 2 mM each dNTP (Fermentas, USA),0.5 unit of Taq DNA polymerase (Fermentas,USA), 10 ng of DNA template, and 2.5 μM10-base primers (Operon technologies, USA)

using 16 randomly chosen decamer primers(Table 2). This 20 μl solution was thenamplified in an MJ MiniTM Personal ThermalCycler (Biorad, USA) using the followingcycling profile: 94°C for 2 min, followed by35 cycles of denaturation at 94°C for 45 s,annealing at 48°C for 45 s, and extension at72°C for 1 min, followed by a final extensionat 72°C for 10 min. After the thermal cyclingprogram had finished, the PCR productsalong with a known standard, either a100-bp ladder or a PstI-digested lambdaDNA, were separated by 2% agarose gelelectrophoresis, stained with ethidiumbromide, and photographed under UVillumination. To confirm the electrophoreticpatterns, every PCR was repeated twiceunder the same conditions of compositionand reaction volume. Only bands which werereproduced on two separate runs wereconsidered in this analysis. The conservedand polymorphic bands amplified by a givenprimers (Table 2) were treated as a unitcharacter where the fragments were scoredas either present (1) or absent (0) for eachof the primer accession combinations. Forthirty-eight plant samples, the character state

290 Chiang Mai J. Sci. 2014; 41(2)

data set of all banding patterns generatedfrom the 16 primers, were used to constructUPGMA dendrogram by PAUP* 4 software[22] using distance analysis with bootstrapped1000-fold. The Hedychium species with high

biological properties (ex. antibacterial andantioxidant activities),was then subjected tofind the unique DNA fragments to be furtheridentified and ultimately characterized using aSCAR marker.

Table 2. List of primers and their sequence used in HAT-RAPD, number of fragmentsand the fragment size range.

Primer name

1. OPF-052. OPN-163. OPQ-124. OPX-035. OPX-11

6. OPAA-117. OPAA-148. OPAE-159. OPAE-19

10. OPAG-0311. OPAG-1012. OPAG-1813. OPAG-1914. OPAI-1515. OPAJ-1416. OPAV-16

Sequence (5’——3’)

CCGAATTCCCAAGCGACCTGAGTAGGGCACTGGCGCAGTGGGAGCCTCAGACCCGACCTGAACGGGCCAATGCCTGGACCGACAGTCCCT

TGCGGGAGTGACTGCCCGACGTGGGCATACAGCCTCGGTTGACACAGCCCACCGATGCTGGACAAGGACC

Total

Total number ofamplified fragment

21116721590813471032521062191109117991323232

2,817

Number ofpolymorphic

fragment135167695443198652181062191109114191209196

2,112

Fragment sizerange (bp.)

250-800500-800

450-1,200500-1,200500-1,100250-1,000350-700

250-1,100700-1,700350-1,200450-1,500250-500

500-1,700350-700

250-1,700500-1,200250-1,700

2.3 Development of SCAR PrimerA unique band approximately 519 bp in

length represented only in the naturalproduct important, H. flavescens, was thenpurified using the QIAquick Gel Extractionkit (QIAGEN) and then ligated into pTZ57Rvector (Fermentas, USA) and transformedinto E. coli DH5α competent cells usingthe electroporation technique [23]. In orderto check for specificity of the chosen regionfor SCAR marker production, this DNAfragment was labeled with DIG-High prime(Roche Applied Science) following themanufacturers recommended procedure thenused as a probe to hybridize to HAT-RAPD

markers of all samples using the standardSouthern blot method. This fragment wasthen sequenced by sequencing lab (1st Base,Malaysia) and the pair of SCAR primerswas designed containing 16-24 bases, whichwere then synthesized by 1st Base, Malaysia.Using these newly designed SCAR primerswith the above mentioned PCR conditionswith slightly modification: 94°C for 2 min,followed by 27 cycles of denaturation at 94°Cfor 45 s, annealing at 72°C for 30 s, andextension at 72°C for 45 sec, followed by afinal extension at 72°C for 5 min., and anincreased annealing temperature of 72°Cto reduce template mismatches. Finally, the

Chiang Mai J. Sci. 2014; 41(2) 291

PCR products were again visualized in 2%agarose gels stained with ethidium bromide.

3. RESULTSUsing a total of 16 different decamer

primers to randomly amplify genomicDNA from 38 samples (23 species) and other3 Zingiberaceae members, approximately 2,

112 distinct polymorphic band profileswere produced with fragments rangingin molecular size from 250-1,700 basepairs (Table 2). Representative HAT-RAPD,in particular the primer OPAG-19,produced a unique candidate band at amolecular size about 519 base pairs(Figure 1A).

Figure 1. PCR-based electrophoretic profiles and hybridization patterns. (1A) HAT-RAPD patterns of 35 Hedychium samples and 3 outgroups obtained by amplificationwith arbitrary primer OPAG-19. The HAT-RAPD marker HFAG-19519 specific toH. flavescens is indicated by an arrow. (1B) Hybridization of the cloned and DIG-labelled HAT- RAPD fragment HFAG-19519 (arrow) to a Southern blot of the HAT-RAPD gel. (M= Lambda DNA/ PstI marker, 1-2= H. neocarneum, 3-5= H. coccineum,6= H. coccineum var.1, 7-8= H. aureum, 9= H. tomentosum, 10= H. glabrum, 11= H.cf. poilanii, 12= H. gomezianum, 13,16= H. pauciflorum, 14= H. forrestii 2, 15= H.forrestii 1, 17-18= H. coronarium, 19= H. coronarium var. chrysoleucum, 20= H. cf.gracillimum, 21= H. ximengense, 22-23= H. stenopetalum, 24= H. spicatum,25-26= H. flavescens, 27-30= H. ellipticum, 31= H. khaomaenense, 32= H. biflorum, 33= H. speciosum,34-35= H. villosum, 36= Zingiber sp., 37= Curcuma comosa, 38= Amomum biflorum).

3.1 Phylogenetic RelationshipThe HAT-RAPD markers of the 2, 112

loci generated by 16 primers (Table 2) wereused as character state constructing aUPGMA dendrogram using distance analysisby PAUP* 4 software with bootstrapped1000- fold [22]. The outgroup consisted of

three genera, Curcuma, Zingiber, and Amomum,of the same family. The resulting dendrogram(Figure 2) provided an additional test of therelationship between the 35 Hedychium samples(23 species). Five informal groups with twosub-group are recognized as follows:

292 Chiang Mai J. Sci. 2014; 41(2)

Figure 2. Dendrogram illustrating genetic relationships among 35 samples of Hedychium,with Curcuma comosa, Zingiber sp. and Amomum biflorum, as outgroup within the family.This dendrogram was constructed from character state data, 2,112 HAT-RAPDpolymorphic bands which were generated by 16 primers, by PAUP*4 software usingdistance analysis with bootstrapped 1000-fold. The internal nodes display the bootstrapvalues. (Distribution of Hedychium in Thailand: N= North, NE= North-East, S= South,C= cultivated throughout Thailand; Inflorescence-bract; NI= not imbricate,I= imbricate; Plant habit: t= Terrestrial, st= Sub-terrestrial or growing mainly on rock or welldrain slopes, e= Epiphytic/ Epilithic; Floral morphology: *= filament shorter than labellum,0= filament longer than labellum; Numbers after scientific names refer to the differentcollections of the same species.

Group A: Includes six species and threevarieties distributed in Northern and North-Eastern Thailand. Common characters of thisgroup are the terrestrial life form, inflorescensewith many flowers per bract, and 2-cleftslabellum. Hedychium coronarium and H. flavescensare commonly cultivated throughout Thailand.This group can be divided in 2 sub-groups:

Sub-group A1: Includes four species and twovarieties, inflorescense-bracts are not imbricateor imbricate and characterized by the filamentwhich is shorter than the 2-clefts labellum(except H. stenopetalum).

Sub-group A2: Includes two species and onevariety, inflorescense-bracts are not imbricateand characterized by the filament being longerthan 2-clefts labellum.

Group B: Includes one species distributedin Northern Thailand. Common charactersof this group are epiphytic or epilithic,inflorescense-bracts are not imbricate, the bractsubtends only one flower, the filament is longerthan 2-clefts labellum.

Group C: Includes five species fromNorthern, North-Eastern and SouthernThailand. They are terrestrial, epiphytic orepilithic, inflorescense-bracts are not imbricateor imbricate and inflorescense have 1-manyflowers per bract, the filament is longer than2-clefts labellum.

Group D: Includes two species distributedin Northern and North-Eastern Thailand. Thespecies are sub-terrestrial or growing mainlyon rock or well drain slopes, epiphytic or

Chiang Mai J. Sci. 2014; 41(2) 293

epilithic, the bracts are imbricate with 1 flowerper bract, and the filament is shorter thanlabellum, labellum apex is not 2-clefts.

Group E: Includes five species in Northern,North-Eastern and Southern Thailand.They are epiphytic or epilithic, theinflorescense-bracts are not imbricate with1 flower per bract, and labellum apex is not2-clefts (except H. glabrum).

Group F: Includes one species fromNorthern Thailand, which is terrestrial,epiphytic or epilithic. The inflorescense-bracts are not imbricate with 1 flower perbract, the filament is shorter than 2-clefts labellum.

3.2 Conversion of RAPD Markers toSCARs

As a proof of principle, one species-specific HAT-RAPD marker was initiallyselected for transformation into the morerobust SCAR marker. For the decamerprimer OPAG-19, the band approximately519 base pairs in size which amplified forH. flavescens was initially chosen and thensuccessfully cloned into the pTZ57R vector.The fragments sizes analyzed and checkedby EcoRI digestion methods were similar tothe original HAT-RAPD marker in Figure 1A.After sequencing of this DNA fragment andperforming a genomic search in GenBank,the sequence was not found to be recorded.This sequence was then used to design aSCAR primer pair (Figure 3).

Figure 3. Sequence of the selected clone named HFAG-19519. Underlined segmentsshow the annealing position of the arbitrary primer (OPAG-19). Arrows indicate theposition of primers for amplifying the sequence-characterized amplified region (SCAR)markers. A pair of SCAR primers were designed based on the forward.

The cloned marker, HFAG-19519 wasDIG-labeled for probe analysis andhybridized to the blotted HAT-RAPD gel.The hybridization signal corresponded tothe expected HAT-RAPD band, indicatingthat the cloned marker (HFAG-19519) wasderived from the amplified HAT-RAPDproduct and therefore the initial HAT-RAPDband was not a false positive (Figure 1B).

Therefore, this cloned marker (HFAG-19519)was chosen to be converted to a SCARmarker. The cloned marker (HFAG19) wassequenced and showed neither an openreading frame nor homology with otherknown coding sequences (Figure 3). Usingthis sequence, two SCAR primers weredeveloped (Table 3) where each primer wasdesigned to contain 22 base pairs from some

294 Chiang Mai J. Sci. 2014; 41(2)

parts of the original 10-mer RAPD primerfollowed by the next internal bases and

contained only internal bases of theamplified sequence.

Table 3. The sequence-specific oligonucleotide primers derived from the cloned HAT-RAPD fragment of H. flavescens (HFAG-19519).

SCAR primera 5’ to 3’ Sequenceb

HFAG-19 F519 CCC GGG GTA CTT ACA GTT GAG CHFAG-19 R519 CGG TTG AGC TTG TTG GGA ATC C-

3.3 Amplification using SCAR PrimersTo test the specificity of this SCAR

primer pair, the genomic DNA of the 35Hedychium samples (23 species) and outgroupwere amplified with the primer pair, the

a The letter and numbers preceding the F (Forward) and R (Reverse) refer to the progenitorprimerb SCAR primers of 22 oligonucleotides were designed from HFAG-19519 RAPD fragment

single band of the same size as theprogenitor RAPD fragment (519 bp) wasamplified by SCAR primer pair, HFAG-19 F519/ HFAG-19 R519 in only thechosen species H. flavescens (Figure 4).

Figure 4. SCAR amplification from genomic DNA of 35 Hedychium samples andoutgroup using 22-mer sequence-specific primer pair HFAG-19 F519/ HFAG-19 R519.The unique amplification of a single SCAR marker in lane 1-2 for the H. flavescensshows that unique species can be characterized at molecular size of 519 bp. (M= GeneRulerTM 100 bp DNA ladder plus, 1-2= H. flavescens, 3-4= H. neocarneum,5-7= H.coccineum, 8= H. coccineum var.1, 9-10= H. aureum, 11= H. tomentosum, 12= H.glabrum, 13= H. cf. poilanii, 14= H. gomezianum, 15,18= H. pauciflorum, 16= H.coronarium var. 1, 17= H. forrestii, 19-20= H. coronarium, 21= H. coronarium var.chrysoleucum, 22= H. cf. gracillimum, 23= H. ximengense, 24-25= H. stenopetalum,26= H. spicatum, 27-30= H. ellipticum, 31= H. khaomaenense, 32= H. biflorum, 33= H.speciosum, 34-35= H. villosum, 36= Zingiber sp., 37= Curcuma comosa, 38= Amomumbiflorum)

Chiang Mai J. Sci. 2014; 41(2) 295

4. DISCUSSION4.1 Phylogenetic Relationship

The sixteen decamer primers used in thisstudy provide sufficient distinct bandinginformation to generate a dendogram whichupholds the basic morphological classespresented above. More importantly thisbanding information can be obtainedinexpensively and rapidly using basic gelelectrophoresis. The result from this analysisshows that there are some characters, such as,habit, number of flower per bract, labellumshape and distribution pattern, whichdistinguish each group. According to none ofbasal support of the dendrogram (Figure 2),it would be premature at the very least to implythat it represents an evolutionary cladogramof the genus Hedychium from this study eventhough the tree is silimar to previous studiessuggested by Wongsuwan (2010), Wood etal. (2000), and Gao et al. (2008) using ITSsequence data and SRAP markers respectively.This study includes, however, limitted samplesof Hedychium species (only species found inThailand), as the focus of this study was notprimarily on the phylogenetic questions, it isprematurely to make firm conclusions on theexact relationship of the species.

Group A comprises of terrestrial speciesmost of which have larger leaves, stemsand flowers compared to all other groups.In addition, their bracts support many flowers,resulting in high yield of oils and extracts.Furthermore, plants in group A do notpossess a dormancy period and displayhigh antibacterial and antioxidant content(Suksathan, unpublished results). For thesereasons, the plants in group A have a highpotential for a plant market. H. flavescens is amember of sub-group A1 and is cultivatedthroughout Thailand. It has fragrant flowers,high monoterpene content and great capacitiesfor antimicrobial [4,6] and antioxidantproperties (Suksathan, unpublished results).

4.2 SCAR Primers Specific toH. flavescens

To further characterize Hedychiumspecies using SCAR primers, the SCAR markermethodology provides a phenotypicallyindependent molecular based characterupon which to classify and detect distinctspecies of Hedychium. As a proof ofprinciple for developing a genomiccharacterization for the complete set ofHedychium species, the methodologydescribed above demonstrates that H.flavescens can be clearly distinguished usingmolecular markers, and that the broadrange of generated bands provide amplesource sequences to generate additionalspecies or clade specific SCAR marker.

5. CONCLUSIONSThe genetic relationship of the sampled

species found in the current study isgenerally consistent with previous accounts[7, 24-25]. The obtained tree is usefulfundamental information to support plantbreeding as the guideline for plant selectionprocess for morphological traits andphytochemical compounds of interestsbecause the relationship among species inthe same group may reflect their similarchemical profiles. The results also providecomplimentary information of thephylogeny of Hedychium in Thailand.Furthermore, the SCAR marker presentedin this study shows a unique amplificationDNA fragment pattern distinguishing H.flavescens from 36 other samples of testedZingiberaceae members. Using this SCARmarker, it is possible to characterize H.flavescens which allows this species to berapidly identified at all developmentalstages even without flowers, which arenormally essential for plant identification.It could be also used as the tool for verificationof ornamental Hedychium rhizomes in

296 Chiang Mai J. Sci. 2014; 41(2)

plant markets. In addition, other SCARmarkers could be further developed for otherHedychium species and their hybrids.

ACKNOWLEDGEMENTSThis work was supported by the grants

from Department of PharmaceuticalScience, the Faculty of Pharmacy and theGraduate School, Chiang Mai University,Chiang Mai, Thailand and NUI-RC(NSTDA University Industry ResearchCollaboration) in the National Science andTechnology Development Agency(NSTDA). The authors would like tothank Prof. Dr. Benjavan Rerkasem, Assoc.Prof. Dr. Sansanee Jamjod andCMUPNlab members for kindlysupporting for laboratory facilities, Dr.Axel Dalberg Poulsen, Natural HistoryMuseum, University of Oslo for generalsuggestion, Queen Sirikit Botanic Garden,Chiang Mai, Thailand for providing plantssamples and Mr. Methee Wongnak forpreparing plant materials.

REFERENCES

[1] Larsen K. and Larsen S.S., Gingers ofThailand, Queen Sirikit BotanicGarden, Chiang Mai, 2006.

[2] Wood T.H., Whitten W.M. and WilliamsN.H., Phylogeny of Hedychium andrelated genera (Zingiberaceae) based onITS sequence data, Edinb. J. Bot., 2000;57: 261-270.

[3] Sirirugsa P. and Larsen K., The genusHedychium (Zingiberaceae) inThailand, Nord. J. Bot., 1995; 15(3):301-304.

[4] Sabulal B., George V., Dan M. andPradeep N.S., Chemical composition andantimicrobial activities of the essential oilsfrom the rhizomes of four Hedychiumspecies from South India, J. Essent. OilRes., 2007; 19: 93-97.

[5] Kala C. P., Ethnomedicinal botany ofthe Apatani in the eastern Himalayanregion of India, J. Ethnobiol. Ethnomed.,2005; 1(11): 1-8.

[6] Dan M., Sabulal B., George V. andPushpangadan P., Studies on the rhizomeoils from four Hedychium species ofSouth India: A chemotaxonomicapproach, Gard. Bull. Singapore, 2007;59(1&2): 57-64.

[7] Uribe S., Ramirez J. and Pena A., Effectsof beta-pinene on yeast membranefunctions, J. Bacteriol., 1985; 161(3):1195-1200.

[8] Jiang H.S., Hedychium J.K nig: Floraof China, Vol. 24, Science Press,Beijing, 2000; 370-377.

[9] Anuntalabhochai S., Chandet R.,Chiangda J. and Apavatjrut P., Geneticdiversity within Lychee (Litchi chinensisSonn.) based on RAPD analysis. ActaHort., 2000; 575: 253-259.

[10] Ruangsuttapha S., Eimert K., Schr derM.B., Silayoi B., Denduangboripant J.and Kanchanapoom K., Molecularphylogeny of banana cultivars fromThailand based on HAT-RAPDmarkers, Genet. Resour. Crop. Evol., 2007;54: 1565-1572.

[11] Wangspa R., Cutler R.W., SitthipromS., Chundet R., Dumampai N. andAnuntalabhochai S., DNA fingerprintdatabase of some economicallyimportant Thai plants: Litchi chinensisSonn., Dimocarpus longan Lour., andPeuraria spp., ScienceAsia, 2005; 31:145-149.

[12] Apavatjrut P., Anuntalabhochai S., SiriugsaP. and Alisi C., Molecular markers in theidentification of some early floweringCurcuma L. (Zingiberaceae) species. Ann.Bot., 1999; 84: 529-534.

Chiang Mai J. Sci. 2014; 41(2) 297

[13] Labra M., Miele M., Ledda B., GrassiF., Mazzei M. and Sala F.,Morphological characterization,essential oil composition and DNAgenotyping of Ocimum basilicum L.cultivars, Plant Sci., 2004; 167: 725-731.

[14] Anuntalabhochai S., Phromthep W.,Sitthiphrom S., Chundet R. and CutlerR.W., Phylogenetic diversity of Ficusspecies using HAT-RAPD markers as ameasure of genomic polymorphism,The Open Agric. J., 2008; 2: 62-67.

[15] Paran I. and Michelmore R.W.,Development of reliable PCR-basedmarkers linked to downy mildewresistance genes in lettuce, Theor. Appl.Genet., 1993; 85: 985-993.

[16] Cutler R.W., Chundet R., Handa T. andAnuntalabhochai S., Development ofsequence characterized DNA markerslinked to a temperature dependence forflower induction in lychee (Litchi chinensisSonn.) cultivars, Sci. Hortic., 2006a.;107 (3): 264-270.

[17] Sitthiphrom S., Chundet R. andAnuntalabhochai S., Investigation ofgenetic relationship and hybriddetection in longan (Dimocarpuslongan Lour.) by high annealingtemperature RAPD, Acta Hort., 2005;665: 161-169.

[18] Sangwijit K., Thangsunan P., CutlerR. and Anuntalabhochai S.Development of SCAR marker forThai fragrant rice (Oryza sativa L. var.indica cv. Pathumthani 1) mutantsinduced by low energy ion beam,Chiang Mai J. Sci., 2012; 39(4): 545-553.

[19] Dhanya K., Syamkumar S.andSasikumar B., Development andapplication of SCAR marker for thedetection of papaya seed adulterationin traded black pepper powder, FoodBiotechnol., 2009; 23(2): 97-106.

[20] Lee M.Y., Doh E.J., Park C.H., KimY.H., Kim E.S., Ko B.S. and Oh S.E.,Development of SCAR marker fordiscrimination of Artemisia princepsand A. argyi from other Artemisiaherbs, Biol. Pharm. Bull., 2006; 29(4):629-633.

[21] Doyle J.J. and Doyle J.L., A rapidDNA isolation procedure for smallquantities of fresh leaf tissue,Phytochem., 1990; 19: 11-15.

[22] Swofford D. L., PAUP*. PhylogeneticAnalysis Using Discrete CharacterStates with Bootstrapping values (*andOther Methods). Version 4. SinauerAssociates, Sunderland, Massachusetts,2003.

[23] Calvin N.M. and Hanawalt P.C.,High-efficiency transformation ofbacterial cells by electroporation, J.Bacteriol., 1988; 170: 2796-2801.

[24] Wongsuwan P., Taxonomy andMolecular Study of Genus Hedychium(family Zingiberaceae) in Thailand.MSc Thesis, Khon Kaen University,Thailand, 2010.

[25] Gao L., Liu N., Huang B. and HuaX., Phylogenetic analysis and geneticmapping of Chinese Hedychium usingSRAP markers, Sci. Hortic., 2008; 117(4):369-377.