A Parent-Specific Hybridization Assay for Quantifying Therapeutic Oligonucleotides and siRNA in Biological SamplesG. A. Tremblay, P. R. Oldfield and A. J. BartlettCharles River Laboratories Preclinical Services Montreal Inc., 22022 Transcanadienne, Senneville, Quebec, Canada H9X 3R3Patent pending application no. 61258046

AbstractPurpose. Investigational oligonucleotide medicines (OMDs) are currently investigated atthe preclinical and clinical stages. Hybridization enzyme immunosorbent assay (ELISAs)used for determining OMDs in complex biological mixtures include sandwich, ligation,cutting and competitive assays. The cutting assay is, in principle, selective for the full-length (parent) OMD. However, the selectivity for parent is limited by the specificity of thenuclease used, since N-1 metabolites may also be detected. On the other hand, theligation assay determines the parent OMD that is intact at the 3'-end, but fails todiscriminate against 5'-end truncated products. A hybridization assay was developed tocircumvent the specificity limitations of current assay formats.

Methods. The parent-specific hybridization method is carried-out in a microtiter platesystem and no prior purification of biological samples is required. Hybridization of theprobes, ligation and detection are performed in a distinctive combination to allow forhighly specific discrimination; the method is designed to quantify only those OMDs thathave both the 5'- and 3'-ends intact.

Results. An siRNA sequence test system was implemented. Mock (N-1) metabolites withone nucleotide truncated at the 5'-end or one nucleotide truncated at the 3'-end were notdetectable at three QC levels. The standard curve and QC concentrations of the full-length analyte were within 10% of the theoretical concentrations in mouse plasma.Different oligonucleotide and matrix combinations documented the hybridization assay.

Conclusion. Active pharmaceutical ingredient (API) parent oligonucleotide compounds,and not metabolites, are detected using the parent-specific hybridization assay. Themethod can be adapted to different OMDs and test systems.

ww

w.c

rive

r.co

m

11/2009

AA

PS

, Los

Ang

eles

, CA

Methods s2B is a phosphodiester oligodeoxynucleotide with the sequence of a

published siRNA3. All oligonucleotides are DNA and have 5'-OH and 3'-OH unlessotherwise stated. All oligonucleotides were purified by HPLC.s2B: gcctcagcacgtacctctatt

s2B 5' N-1: cctcagcacgtacctctatts2B 3' N-1: gcctcagcacgtacctctats2B template probe: NH2-gaatagcgaaatagaggtacgtgctgaggcggattcacg-NH2Ligation probe 1: PO4-tcgctattc-[Biotin-TEG]Ligation probe 2: [Digoxigenin]-cgtgaatcc

Mouse, monkey or human plasma (K2EDTA) were from Bioreclamation Inc.Oligonucleotides were obtained from IDT Inc. The PNK was purchased from NewEngland Biolabs whereas T4 DNA ligase was from USB. Anti-DIG HRP was fromRoche Inc. QuantaBlu and HBC Neutravidin-coated plates were from Pierce Inc.

IntroductionWhether at the discovery, preclinical or clinical stages, bioanalysis for the determinationof investigational oligonucleotide (OGN) therapeutics in biological matrices is performedusing hybridization assays1. They include sandwich, competitive, ligation2 and nuclease-based3 methods.

At this time, there appears to be no hybridization assay that is specific only for parent(full-length) test OGNs. Indeed metabolites short of 1, 2 or more nucleotides over the full-length product (FLP) will also be detected.

It was thought to be of great benefit to develop a method to determine FLPs, which haveboth 5'- and 3'-ends intact. The ligation reaction was thought to be well suited for thispurpose, considering the considerable specificity of T4 DNA ligase. Ligation howevercannot occur at the 5'-end since most OGN therapeutics bear 5' hydroxyls instead ofphosphate moieties which are required for ligation.

As a workaround, we have developed a dual ligation-hybridization assay based on 1/ thereaction of polynucleotide kinase (PNK) adding a phosphate group to 5' hydroxyls and, 2/ the workability of a bi-enzymatic reaction mixture consisting of recombinant PNK andDNA ligase from phage T4.

5’PO4

5’OH 3’OH

5’NH2 3’NH2

+

+

T4 Polynucleotide Kinase

T4 DNA Ligase

Wash-off Un-Ligated Metabolites

Single Step Reaction on Solid Support

Denature & Anneal

- Bind to Microtiter Plate via Biotin - Wash-off Unbound Oligonucleotides and Matrix

Test Oligonucleotide:

Template Probe:

Biotinylated 1st Ligation Probe:

Quantification of the Full-Length (Parent) Test Oligonucleotide

Ligation site 2

DIG-labeled 2nd Ligation Probe:

3’OH

5’PO4

5’OH

Biotin

Ligation site 1

Secondary Antibody / Signaling

3’OH 5’PO4

3’OH 5’PO4

Figure 1: Schematic representation of the dual ligation-hybridization assay.

Process

• The dual ligation-hybridization assay workflow is depicted in Figure 1. The template probe is fully complementary to the test OGN, in addition to having extensions on either side of the test OGN-hybridizing portion that are complementary to ligation Probes 1 and 2.

• Ligation Probe 1 is biotinylated for immobilization to a solid support and synthesized with a phosphate for ligation onto the 3'-end of the test article in a similar way to the ligation-hybridization assay2. The template probe is blocked with amines at both ends to prevent spurious ligation products. Ligation Probe 2has a free 3' hydroxyl and is modified with 5' digoxigenin (DIG) for downstream signaling.

• Firstly, a biological sample containing the test OGN is mixed with the template probe and ligation Probe 1. This hybridization mixture is denatured (90ºC / 8 min.) and annealed at room temperature for 30-45 min, followed by immobilization to a streptavidin-coated 96-well plate. The wells are then washedin order to remove matrix components and unbound material.

• The bi-enzymatic reaction, consisting of a phosphorylation and a ligation reaction, is initiated in the presence of ligation Probe 2. Whereas only the ligation reaction is necessary at the 3'-end of the test OGN, the recessed 5'-end of the immobilized test OGN-template probe duplex requires to be phosphorylated by PNK prior to ligation onto the 3'-end of ligation Probe 2.

• After bi-enzymatic processing (ca. 1h 30 min), the plates are washed with waterto remove un-ligated probes at the 3' and 5'-end sides of the template probe. Therefore, in order for the DIG to be covalently linked to the plate, both ends of the test OGN must have ligated the 5'-end of the test OGN having been phosphorylated by PNK prior to ligation.

• Signaling is carried-out using an anti-DIG-HRP conjugate and a fluorescent HRPsubstrate.

Results Standard curve

• A representative calibration curve obtained with the dual ligation-hybridization assay is shown in Figure 2.

• The analyte, s2B, is a 21-nucleotide long DNA OGN that is the positive strandof a published siRNA3. The matrix used in this curve for all results reported is mouse plasma with a K2EDTA anticoagulant.

• The curve working range was 0.12 nM (0.8 ng/mL) to 4.5 nM (28 ng/mL) using a linear regression model. The range and overall behavior of the curve is similarto what is achieved using the more traditional ligation-hybridization assay.

Specificity for the parent compound

• To assess the specificity of the dual ligation assay for the parent compound relative to metabolites, (Figure 3) the signal generated at different concentrations for the FLP of s2B versus s2B truncated by 1 nucleotide at either the 3' or the 5'-end (3' N-1 or 5' N-1 metabolites) were compared.

• A relatively low interference (≤4%) was observed with the 3' metabolite only, for concentrations above 4.5 nM (Figure 3). Lower concentrations were below the lower limit of quantitation (LLOQ) for the 3' metabolite, whereas no interference was detected for the 5' metabolite (all data points <LLOQ).

• Metabolites shorter than 1 nucleotide have not been tested. Nonetheless, it is safe to assume that there will be less interference with shorter metabolites since T4 DNA ligase will be less likely to join nucleotides that are farther fromeach other.

Reliance on the bi-eenzymatic reaction

• Next we wanted to verify that the two reactions of phosphorylation and ligationare necessary for the FLP to be detected. In Figure 4, when the enzymatic reaction is carried-out with either of the individual enzymes, no signal was detected above the LLOQ. For a signal above background to be generated, both T4 PNK and T4 DNA ligase need to be present.

• This demonstrates that the reaction is occurring as schematized in Figure 1, where a bi-enzymatic reaction takes place. Figure 4 also demonstrates that there is no background coming from un-reacted compounds and that the washing conditions satisfactorily eliminate un-ligated OGN.

Validation parameters: precision and accuracy, specificity, prozone effect anddilution linearity

• We have evaluated validation parameters for s2B with the dual ligation assay. Generally speaking, the assay performed with comparable results in mouse, monkey and human plasma (K2EDTA).

• In Table 1, the intra-assay precision and accuracy demonstrates that we can reproducibly determine the test OGN within 10% accuracy in mouse plasma.

• As shown in Table 2, the assay was specific for s2B within ±25% of the theoretical concentration in five different lots of mouse plasma. Therefore the dual ligation assay can quantify a test OGN irrespective of individuals' variations.

• No interference was observed in all matrices tested (mouse, human, monkey) and there was no detectable prozone effect when tested at a concentration ca.100-fold the upper limit of quantitation (ULOQ) in mouse plasma.

• In Figure 6, the s2B test OGN was serially diluted in mouse plasma and analyzed using the dual ligation assay. We demonstrated that the recovery is linear over the range analyzed.

Versatility with the phosphorothioate chemistry

• The ligation-hybridization assay typically works with a variety of OGN chemistries including DNA, RNA and phosphothioates2 (PS); T4 DNA ligase is permissive to a variety of nucleic acid chemistries.

• However, since PNK has been reported to be inhibited by fully modified or chimeric PS OGN4, we wanted to verify whether or not the dual ligation-hybridization assay will work for this chemistry.

• Consequently, we compared the signal generated with the dual ligation assay performed for the phosphodiester s2B versus a fully PS s2B in mouse plasma.Surprisingly, the dual ligation assay is permissive for PS OGN (Figure 5). In fact it is at the upper end of the curve that we begin to see an inflexion, perhaps because the inhibition of PNK by PS is manifesting at higher concentrations of PS OGN.

Oligonucleotide Concentration in Mouse Plasma (nM) § Intra-Assay Precision & Accuracy (n=3)

Theoretical Measured CV (%) Recovery (%) Low QC 0.375 0.412 9.2 110.0 Mid QC 2.400 2.506 3.5 104.4 High QC 4.500 4.433 13.3 98.5

§ Both 5’ and 3’ (N-1) truncated sequences were <LLOQ and therefore undetected.

Concentration (nM)

0.01 0.1 1 10 100100

1000

10000

100000

Figure 2: Representative calibration curve with the s2B test OGN in mouse plasma.

0

5000

10000

15000

20000

25000

30000

35000

40000

45000

50000

0 1 2 3 4 5 6 7 8

Concentration (nM)

Rel

ativ

e Fl

uore

scen

ce (R

FU)

+PNK +Ligase+PNK -Ligase-PNK +Ligase

Figure 4: Reliance of the dual ligation assay on PNK and T4 DNA ligase enzymes.

0

5000

10000

15000

20000

25000

30000

35000

40000

45000

50000

0 1 2 3 4 5 6 7 8

Concentration (nM)

Rel

ativ

e Fl

uore

scen

ce (R

FU)

Full-length product

5' N-1 metabolite

3' N-1 metabolite

0

5000

10000

15000

20000

25000

30000

35000

0 1 2 3 4 5 6 7 8

Concentration (nM)

Rel

ativ

e Fl

uore

scen

ce (R

FU)

PhosphodiesterPhosphorothioate

Recovery of s2B

Recovery Independent lots of mouse plasma

Spiked (0.25 nM) (% theoretical)

Lot #1 0.28 111.2 Lot #2 0.27 106.7 Lot #3 0.31 124.0 Lot #4 0.28 113.3 Lot #5 0.28 110.1

Average: 0.28 113.1

Conclusion A dual ligation-hybridization assay has been developed that is highly specific for theparent test OGN and without detection of metabolites.

The dual ligation assay relies on a bi-enzymatic reaction comprising DNA ligase andpolynucleotide kinase from phage T4. We have shown that both enzymes arenecessary for the dual ligation assay to detect a test OGN.

The specificity of the dual ligation assay for the parent compound is supported by thecapacity to discriminate against N-1 metabolites both at the 5' and 3'-ends. Weobserved a low unspecific background (≤4% at the upper end the curve) coming fromthe ligation over a one nucleotide-gap at the 3'-end of the test OGN and nobackground coming from the 5'-end.

With the added advantage of specificity for the FLP, overall the dual ligation assayperformed similarly to the ligation-hybridization assay, and notably from theperspective of OGN chemistry versatility. Validation parameters including intra-assayprecision and accuracy, matrix specificity, dilution linearity and prozone effectdemonstrated the robustness and reproducibility of the dual ligation assay.

One advantage of chromatography and electrophoresis (CGE) over hybridizationassays are in separating parent OGN and metabolites, where individual species areseparated as peaks in function of size and/or change. The dual ligation assay can bemodified for determining parent as well as shortmers simply by designing theappropriate (N-x) template probes complementary to each individual species. Similarly,another application for the dual ligation assay is to determine the purity of test OGNsthat are not amenable to analysis either by HPLC or CGE. Template probes aresynthesized that will detect 5' N-1, N-2, N-3, etc. synthesis aborts whose signal will becompared to that of the FLP (unpublished results).

Finally, we envisage that a dual ligation assay can be developed for multiplexingcomplex OGN indications, for example using the Luminex technology platform, byusing different bead-coupled ligation probes complementary to their correspondingtest OGN-specific template probe.

References 1.Tremblay, G.A. and Oldfield, P.R. 2009. Bioanalysis of siRNA and oligonucleotide therapeutics in

biological fluids and tissues. Bioanalysis. 1(3), 595-609.2.Baker BF, Yu Z, Leed JM. 2002. Development of an ultrasensitive noncompetitive hybridization-ligation

enzyme-linked immunosorbent assay for the determination of phosphorothioate oligodeoxynucleotide in plasma. Anal Biochem. 304(1): 19-25.

3.Overhoff, M., Wünsche, W. and Sczakiel, G. 2004. Quantitative detection of siRNA and single-stranded oligonucleotides: relationship between uptake and biological activity of siRNA Nucleic Acids Res. Vol. 32, No. 21, e170.

4.Teasdale, R.M., Matson, S.J., Fisher, E. and Krieg, A.M. 1994. Inhibition of T4 polynucleotide kinase activity by phosphorothioate and chimeric oligodeoxynucleotides. Antisense Res Dev. 4 (4): 295-97.

Figure 5: Versatility of the dual ligation assay comparing phosphorothioate and phosphodiester variants of the testoligonucleotide.

Table 2: Specificity assessment of s2B in five different lots of pooled mouse plasma (K2EDTA)

R2 = 0.9997

0

1

2

3

4

5

6

7

0 0.002 0.004 0.006 0.008 0.01 0.012

Dilution-1

Con

cent

ratio

n (n

M)

Figure 6: Dilution linearity assessment of s2B in mouse plasma.

Figure 3: Specificity of the dual ligation assay for the parent compound (full-length product) evaluated againstthe 5' N-1 metabolite and the 3' N-1 metabolite.

Table 1: Intra-Assay Precision & Accuracy of s2B in Mouse Plasma (K2EDTA)