A Membrane-Associated Protein, FliX, Is Required for an ... · MATERIALS AND METHODS Materials. Oligonucleotides were obtained from either Operon Technologies (Alameda, Calif.) or

JOURNAL OF BACTERIOLOGY,0021-9193/98/$04.0010

Apr. 1998, p. 2175–2185 Vol. 180, No. 8

Copyright © 1998, American Society for Microbiology

A Membrane-Associated Protein, FliX, Is Required for anEarly Step in Caulobacter Flagellar AssemblyCHRISTIAN D. MOHR,* JOANNA K. MACKICHAN, AND LUCY SHAPIRO

Department of Developmental Biology, Beckman Center, Stanford University School of Medicine,Stanford, California 94305-5427

Received 17 November 1997/Accepted 17 February 1998

The ordered assembly of the Caulobacter crescentus flagellum is accomplished in part through the organi-zation of the flagellar structural genes in a regulatory hierarachy of four classes. Class II genes are the earliestto be expressed and are activated at a specific time in the cell cycle by the CtrA response regulator. In orderto identify gene products required for early events in flagellar assembly, we used the known phenotypes of classII mutants to identify new class II flagellar genes. In this report we describe the isolation and characterizationof a flagellar gene, fliX. A fliX null mutant is nonmotile, lacks a flagellum, and exhibits a marked cell divisiondefect. Epistasis experiments placed fliX within class II of the flagellar regulatory hierarchy, suggesting thatFliX functions at an early stage in flagellar assembly. The fliX gene encodes a 15-kDa protein with a putativeN-terminal signal sequence. Expression of fliX is under cell cycle control, with transcription beginningrelatively early in the cell cycle and peaking in Caulobacter predivisional cells. Full expression of fliX was foundto be dependent on ctrA, and DNase I footprinting analysis demonstrated a direct interaction between CtrA andthe fliX promoter. The fliX gene is located upstream and is divergently transcribed from the class III flagellargene flgI, which encodes the basal body P-ring monomer. Analysis of the fliX-flgI intergenic region revealed anarrangement of cis-acting elements similar to that of another set of Caulobacter class II and class III flagellargenes, fliL-flgF, that is also divergently transcribed. In parallel with the FliL protein, FliX copurifies with themembrane fraction, and although its expression is cell cycle controlled, the protein is present throughout thecell cycle.

Midway through the Caulobacter cell cycle, the transcriptionof a cascade of flagellar genes is initiated, culminating in theconstruction of a single flagellum at one pole of a predivisionalcell. The flagellum is comprised of three subassemblies (Fig.1). The basal body, the most complex subassembly, spans thecell envelope and consists of (i) a compound ring in the innermembrane that is part of the flagellar motor, (ii) a rod thatspans the cell wall, and (iii) stabilizing rings. The other sub-assemblies are a cell surface-associated hook and a long extra-cellular filament. Assembly of the substructures occurs in acell-proximal–to–cell-distal order, accomplished, in part, bythe organization of the flagellar structural genes in a regulatoryhierarachy of four classes (6, 8, 34, 36, 55). The temporalexpression of these classes of genes reflects the order in whichthe gene products are assembled into the growing structure(10, 21, 45).

Class II genes (Fig. 1) are the earliest flagellar genes to beexpressed (54). Mutations in these genes result in the cessationof class III and IV flagellar gene expression and a concomitantincrease in the expression of other class II genes (34, 55). ClassII genes encode (i) early structural components of the flagel-lum, including FliF, the protein monomer of the MS-ring (22,36); (ii) components of the flagellum-specific export pathwayrequired for the export of rod, hook, and filament proteins (19,28, 41, 47, 58); and (iii) transcription factors such as RpoN(s54) and the response regulator FlbD, which are required forthe expression of class III and IV flagellar genes (2, 4, 5, 40, 52,53). Class II flagellar genes have conserved promoter elements

and are activated at a defined time in the Caulobacter cell cycle.With at least three class II gene promoters, PfliL, PfliQ, and PfliF,the activation of transcription is controlled by the CtrA re-sponse regulator (13, 39). CtrA is a global regulatory proteinwhich also mediates the control of the initiation of chromo-some replication and chromosomal DNA methylation at spe-cific time points in the cell cycle (13, 39).

Strains with mutations in class II flagellar genes, in additionto being nonmotile, exhibit aberrant cell division, resulting inthe formation of abnormally long filamentous cells (5, 12, 19,57, 58). This cell division defect suggests that early events inflagellar biogenesis may function as a morphological check-point for cell cycle progression. In order to understand howflagellar biogenesis is coupled to the cell cycle, as well as toidentify additional gene products required for early events inflagellar assembly, we used the known phenotypes of class IImutants to identify new flagellar genes. Here we describe theisolation and characterization of a gene, fliX, encoding a mem-brane protein required for flagellar assembly and normal celldivision. Epistasis experiments indicate that fliX is a class IIflagellar gene, suggesting that FliX functions at an early stagein flagellar biogenesis. We show that transcription of fliX isunder cell cycle control, being expressed prior to the activationof class III flagellar genes, that full expression is dependent onctrA (as is the case with other class II genes), and that CtrAinteracts directly with the fliX promoter. The fliX gene is lo-cated upstream and is divergently transcribed from the class IIIflagellar gene flgI, which encodes the basal body P-ring mono-mer. This is the second example of a divergent promoter ar-rangement involving class II and class III flagellar operons.The conserved architecture of cis-acting elements within theseintergenic regions may play a role in controlling the timing offlagellar gene expression during the cell cycle.

* Corresponding author. Mailing address: Department of Develop-mental Biology B300, Beckman Center, Stanford, CA 94305-5427.Phone: (650) 723-5685. Fax: (650) 725-7739. E-mail: [email protected].

2175

on January 15, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

MATERIALS AND METHODS

Materials. Oligonucleotides were obtained from either Operon Technologies(Alameda, Calif.) or the Beckman Center protein and nucleic acid facility atStanford University. DNA-modifying enzymes, including restriction endonucle-ases, S1 nuclease, DNase I, and T4 polynucleotide kinase, were obtained fromBoehringer Mannheim and New England Biolabs. [35S]Trans-Label (L-methio-nine, L-cysteine) was obtained from ICN Biomedicals, and [g-32P]ATP wasobtained from Amersham. Sequencing was performed with a Thermosequenasecycle sequencing kit from Amersham Life Science. Horseradish peroxidase con-jugated to goat anti-rabbit immunoglobulin G was purchased from BoehringerMannheim. Immobilon-P membranes were purchased from Millipore, and aRenaissance chemiluminescence kit was purchased from DuPont NEN. Forma-lin-fixed staphylococcus A cells (Immunoprecipitin) were purchased from LifeTechnologies (BRL). Other reagents were purchased from Sigma Chemical Co.

Bacterial strains, plasmids, and growth conditions. Bacterial strains and plas-mids used in this work are described in Table 1. The fliX null strain was maderecombination deficient as previously described (32). Caulobacter crescentusNA1000 and mutant strains were grown at 30°C in either peptone-yeast extract(PYE) medium or M2 minimal glucose medium (14). C. crescentus culturescontaining plasmids were supplemented with 1 mg of tetracycline per ml. PYEagar (1.5% agar) was supplemented with nalidixic acid (20 mg/ml), tetracycline (2mg/ml), or kanamycin (20 mg/ml) as necessary. PYE swarm plates contained0.25% agar. Escherichia coli TG-1 and S17-1 were grown at 37°C in Luria-Bertanibroth supplemented with ampicillin (50 mg/ml), tetracycline (10 mg/ml), or gen-tamicin (20 mg/ml). Plasmids complementing the fliX null strain (LS2821) wereobtained by subcloning fragments from cosmid pCM1 into the broad-host-rangeplasmid pMR4. Complementing plasmid subclones and plasmid-borne transcrip-tional fusions were introduced into C. crescentus cells by mating with E. colidonor strain S17-1.

Generation of an fliX null strain. The fliX null strain was generated by randomtransposon mutagenesis. The suicide plasmid pSUP202 carrying transposon Tn5was introduced into C. crescentus LS107 by conjugation as previously described(15). Cultures of mutagenized cells were plated directly into swarm agar platescontaining kanamycin to select for transposon-mediated antibiotic resistance. C.crescentus strains with mutations in class II flagellar genes, in addition to beingnonmotile, exhibit defects in cell division, often giving rise to long filamentouscells. Cultures of cells which failed to form swarms on swarm agar were examinedfor cell division defects by light microscopy. Nonmotile cells exhibiting the

filamentous phenotype were then tested for restoration of motility with cosmidscontaining known C. crescentus flagellar genes. One of the strains with nonmotilecells was complemented to motility with cosmid pCM1, which carries the flagellarflgI locus (26, 32). The Tn5 insertion in this strain was transduced into strainNA1000 (selecting for Kmr) to generate strain LS2821 (fliX::Tn5).

Electron microscopy. Bacterial cultures were grown in PYE medium at 30°C toan optical density at 600 nm (OD600) of 0.6, transferred to a sterile 1.5-mlmicrocentrifuge tube, and concentrated by gentle centrifugation. The superna-tant was removed, and the pellets were resuspended in the residual liquid. Theconcentrated cell suspension was transferred to a Formvar-coated grid andstained with uranyl acetate. Grids were examined in a Phillips model EM300electron microscope.

DNA sequencing. DNA sequencing was carried out by the dideoxynucleotidechain termination method (44), with single- or double-stranded DNA as thetemplate. The sequencing ladder used to determine the transcriptional start siteof fliX was generated with plasmid pCM4 as the template and the syntheticoligonucleotide FliX2 (59 TCGACCGATCCAACGCCGGT 39) correspondingto nucleotides 1203 to 1184 relative to the fliX 11A transcriptional start site.The sequencing reaction used to determine the transcriptional start site of flgIwas generated with plasmid pCM5 as the template and the synthetic oligonucle-otide FlgI1 (59 TCGAGGCTCTGCTTGGTCAT 39), which corresponds to nu-cleotides 1241 to 1222 relative to the flgI 11A transcriptional start site. Se-quence compilation was carried out with the Genetics Computer Group packageof the University of Wisconsin (9); for database searching, we employed theBLAST algorithm.

Promoter expression. DNA fragments were inserted into the multiple-cloningsite of the pRKlac290 vector to generate transcriptional fusions to lacZ. b-Ga-lactosidase activity was assayed as described by Miller (30), with cells beinggrown in PYE medium plus tetracycline. Assays were done in triplicate on aminimum of two independent cultures. In order to examine the pattern ofexpression of the fliX and flgI promoters during the cell cycle, strains harboringplasmid-borne fliX and flgI transcriptional fusions to lacZ were synchronized bygradient centrifugation as previously described (16). At various time pointsduring the cell cycle, 1-ml aliquots of cells were incubated for 5 min with 15 mCiof [35S]Trans-Label, centrifuged, and frozen on dry ice. Cells were lysed andimmunoprecipitated as described previously (32). The immunoprecipitated pro-teins were separated on sodium dodecyl sulfate (SDS)–10% polyacrylamide gels

FIG. 1. Diagram of the C. crescentus flagellum. The name of each structure is accompanied by its gene designation(s). The structure of the C-ring complex is adaptedfrom that proposed for the Salmonella typhimurium basal body (18). The genes encoding structural proteins are grouped into one of the three known flagellar geneclasses (II, III, and IV), which together comprise the flagellar regulatory hierarchy (6, 8, 34, 55). Arrows indicate positive regulation (1) in which the transcription ofgenes within a class requires the expression of the gene products of the preceding class. The regulatory cascade is initiated by the class I gene product, CtrA, in responseto as yet unidentified cell cycle cues (39). Class II gene products include proteins comprising early structural components of the flagellum (FliF), proteins which functionin the flagellum-specific export pathway, and the transcription factors FlbD and RpoN (s54). FlbE is the cognate histidine kinase for FlbD (50).

2176 MOHR ET AL. J. BACTERIOL.


.org/D

ownloaded from

http://jb.asm.org/

and visualized by autoradiography. Quantification was done with a MolecularDynamics PhosphorImager with ImageQuant software.

S1 nuclease protection analysis. RNA was isolated from C. crescentus NA1000via standard protocols (43). Double-stranded end-labeled probes for S1 nucleaseassays were generated as described previously (43). Labeled probes (105 cpm)were mixed with RNA (40 or 80 mg), ethanol precipitated, and resuspended in S1hybridization solution {60% formamide, 40 mM PIPES [piperazine-N,N9-bis(2-ethanesulfonic acid)] (pH 6.4), 400 mM NaCl, 1 mM EDTA (pH 8)}. The nucleicacids were denatured at 85°C for 10 min and then allowed to hybridize overnightat 50°C. S1 nuclease digestion and product preparation were carried out asdescribed previously (43). The protected fragments were run alongside sequenc-ing ladders generated with plasmids pCM4 and pCM5 as templates and syntheticoligonucleotide primers whose 59 ends corresponded to the 59 ends of the labeledprobes, thus permitting direct comparison.

DNase I footprinting analysis. The His-CtrA fusion protein used for DNase Ifootprinting analysis was purified as described previously (39). The DNA probesused for DNase I footprinting analysis were generated by digestion with BspEI(292 relative to the fliX 11A transcriptional start site), dephosphorylation withalkaline phosphatase, and phosphorylation with [g-32P]ATP (50 mci) catalyzed byT4 polynucleotide kinase. Following digestion with a second restriction endonu-clease, the end-labeled fragments were gel purified. Probes (approximately 5 3104 cpm) were incubated with different amounts of His-CtrA in a 200-ml reactionmixture containing 20 mM Tris-HCl [pH 7.4], 100 mM KCl, 5 mM MgCl2, 1 mMCaCl2, 2 mM dithiothreitol, 5% glycerol, 50 mg of bovine serum albumin per ml,and 4 mg of calf thymus DNA per ml. The reaction mixtures were incubated at23°C for 10 min to allow complex formation, followed by a 3-min digestion of theDNA-protein complex with 60 ng of DNase I. The digestion was stopped by the

addition of 10 ml of 0.5 M EDTA, and the labeled DNA fragments were isolatedwith a QIAquick PCR purification kit (Qiagen) according to the manufacturer’sinstructions. The products of DNase I digestion were separated on sequencinggels in parallel with a sequencing ladder generated with the 22-mer oligonucle-otide FliX1 (59 CAGTCGCCGAGACACCCCCCGT 39) extending from 182 to161 relative to the fliX 11A transcriptional start site.

Production of a His-tagged FliX protein and generation of polyclonal antisera.The fliX-coding region was amplified by PCR with the following primers: FliX4-EcoRI (59 TCGGATGAAGAATTCCAGCACG 39) and FliX5-HindIII (59 CCCTGGCCTGAAGCTTGGCCA 39). The resulting 420-bp fragment was digestedwith EcoRI and HindIII and ligated into pET-21b (Novagen), creating plasmidpCM17. The resulting plasmid generates an in-frame fusion between an N-terminal T7 epitope tag, the cloned fliX fragment, and a C-terminal His tag.Expression of FliX-His from the T7 promoter was induced in E. coli BL21 (DE3)by addition of 1 mM IPTG (isopropyl-b-D-thiogalactopyranoside). A 250-mlculture was grown at 37°C in Luria-Bertani broth to an OD600 of 0.6, and cellswere harvested by centrifugation 3 h after induction. The cell pellet was dissolvedin ice-cold binding buffer (20 mM Tris-HCl [pH 7.9], 5 mM imidazole, 0.5 MNaCl) and lysed by sonication. Following centrifugation (20,000 3 g for 15 min),FliX-His was purified from the supernatant fraction by chromatography on HisBind resin (Novagen) according to the manufacturer’s instructions. Columnfractions containing FliX-His were pooled, concentrated with Centricon 10 Mi-croconcentrator tubes (Amicon), and used directly to immunize rabbits. Immu-nization and sampling of the serum were performed by the Berkeley AntibodyCompany.

Western blot analysis. Western blots on SDS-polyacrylamide gel electrophore-sis (PAGE)-separated gels were performed as previously described (23). Blots

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid Genotype or description Reference or source

StrainsC. crescentus

NA1000 syn-1000 16LS107 syn-1000 bla-6 Dickon AlleyLS800 rec-526 (pKM3001) 37LS1218 syn-1000 DfliF 22LS1917 syn1000 flgI::Tn5 32LS2195 syn-1000 ctrA401 39LS2821 syn-1000 fliX::Tn5 This workLS2996 rec526 fliX::Tn5 This workSC508 flaS153 (DfliQR) 24SC1117 flbN194::Tn5 str-152 10SC1131 fliLM196::Tn5 57

E. coliTG1 F9 lacIq proA1B1 lacZDM15 supE44 7S17-1 Integrated RP4-2, Tc::Mu, Km::Tn7 46

PlasmidspCM1 pLAFR5-derived cosmid containing flgI 32pCM2 5.3-kb SacI fragment containing flgI subcloned from pCM1 into pSKII1 32pCM9 800-bp PstI fragment subcloned from pCM2 into pRKlac290 This workpCM10 800-bp PstI fragment subcloned from pCM2 into pRKlac290 This workpCM11 5.3-kb SacI fragment containing flgI and fliX subcloned from pCM2 into pMR4 This workpCM12 1.3-kb SacI/XhoI fragment containing fliX subcloned from pCM2 into pMR4 This workpCM13 600-bp NlaIII fragment containing fliX subcloned from pCM2 into pMR4 This workpCM14 400-bp PstI/NlaIII fragment containing truncated fliX subcloned from pCM2 into pMR4 This workpCM15 613-bp PstI/XhoI fragment containing the fliX-flgI intergenic region subcloned from

pCM2 into pSKII(1)This work

pCM16 613-bp PstI/XhoI fragment containing the fliX-flgI intergenic region subcloned frompCM2 into pSKII(2)

This work

pCM17 fliX cloned as a 420-bp EcoRI/HindIII fragment (generated by PCR) into pET21b This workpCM18 1.1-kb PstI fragment containing dksA subcloned from pCM1 into pSKII(1) This workpRKlac290 lacZ transcriptional fusion vector, Tetr IncP1 replicon, mob1 20pMR4 Broad-host-range vector, Tetr C. Mohr and R. RobertspSKII(1) Cloning and single-stranded phagemid StratagenepSKII(2) Cloning and single-stranded phagemid StratagenepET21b Ampr vector with T7 promoter for protein overexpression and generation of carboxyl-

terminal polyhistidine tagNovagen

pKM3001 Pseudomonas aeruginosa recA-containing fragment in the broad-host-range vectorpCP13 (Tetr)

27

VOL. 180, 1998 EARLY FLAGELLAR GENE IN C. CRESCENTUS 2177


.org/D

ownloaded from

http://jb.asm.org/

were probed with primary antiserum at a dilution of 1:5,000 and then with thesecondary antibody (goat anti-rabbit immunoglobulin G; Boehringer Mannheim)at a 1:10,000 dilution. Generation and use of antisera to the C. crescentus CcrM,flagellin, and FlgH proteins have been described previously (23, 48). Westernblots were developed with a Renaissance chemiluminescence kit (DuPont NEN)according to the manufacturer’s instructions. Protein standards were prestainedSDS-PAGE low-range standards (Bio-Rad).

Analysis of cellular localization of FliX. C. crescentus cultures were harvestedby centrifugation at an OD600 of 0.6 to 0.8. Cell lysis and separation of membranefractions from soluble proteins by differential centrifugation were performed asdescribed previously (23). Following centrifugation, the supernatant fraction wasconcentrated in Centricon 10 Microconcentrator tubes (Amicon). To preparethe extracellular protein fraction, a 100-ml sample of culture (OD600 5 0.6) wascentrifuged at 7,000 3 g for 20 min. The culture supernatant was then passedthrough a 0.45-mm-pore-size filter. Proteins were precipitated from the super-natant by addition of ammonium sulfate to 50% saturation at 4°C. Precipitatedmaterial was collected by centrifugation at 8,000 3 g for 20 min. The pellet waswashed with 70% ethanol, dried under vacuum, and resuspended in 1 ml of 10mM Tris (pH 7.5)–1 mM EDTA.

Nucleotide sequence accession numbers. The nucleotide sequence of the fliX-flgI locus has been previously described (26) and assigned GenBank accession no.M91448. The dksA sequence has been deposited in the GenBank database underaccession no. AFO34413.

RESULTS

Isolation and complementation of the fliX null mutant. Inorder to screen for new class II flagellar genes, nonmotilemutants were generated by Tn5 mutagenesis and then exam-ined for defects in cell division (see Materials and Methods). Atotal of 13 nonmotile mutants exhibiting the filamentous phe-notype were generated and examined further. To determine ifthe mutations were in known flagellar loci, we first attemptedto complement the motility defect using cosmids containingknown flagellar genes. Three of the mutants were not comple-mented, and several new class II flagellar genes were identified(31, 47). One of the strains, LS2821, whose cells were nonmo-tile, had no visible flagella, and exhibited a marked cell divisiondefect (Fig. 2), was complemented by cosmid pCM1, previ-ously shown to contain flgI, a class III flagellar gene encodingthe structural protein of the basal body P-ring (26, 32).

Southern blot hybridization analysis (data not shown) de-fined the site of Tn5 insertion in LS2821 to within a 240-bp PstIfragment located upstream of flgI (Fig. 3). Based on the pre-viously published sequence of the flgI region (26), we identifiedtwo open reading frames (ORFs) upstream and oriented in thedirection opposite to that of flgI (Fig. 3). The site of Tn5insertion in LS2821 is within the first ORF, which we desig-nated fliX, based on its requirement for flagellar assembly andon epistasis experiments that placed it within the flagellar hi-erarchy (see below). Plasmid pCM13, containing a 620-bpNlaIII fragment encoding only fliX, complemented both themotility defect and the cell division phenotype of LS2821 (Fig.2 and 3). To confirm that an intact fliX gene was required forcomplementation, plasmid pCM14, bearing a deletion whichlacked 260 bp of the 39 end of fliX, was constructed. Thisplasmid failed to complement either the motility or the celldivision phenotype of LS2821 (Fig. 3). To rule out possiblepolar effects, as well as the possibility that complementation bypCM13 containing the intact gene was due to chromosomalintegration of the fliX-complementing DNA, complementationexperiments were carried out with both LS2821 and LS2996, afliX rec double mutant background. No observable differencein complementation results were observed with the two strains.

Identification of the fliX and dksA ORFs. The fliX ORFbegins at nucleotide 874 and ends at nucleotide 440 of thepublished sequence of the flgI region (26). A potential ribo-some binding site (GGAG) is located 7 bp upstream of theputative ATG start codon. The nucleotide sequence of fliXencodes a putative protein of 144 amino acids (Fig. 4A) with a

predicted molecular mass of 14.5 kDa. The fliX gene producthas no significant similarity to proteins in current databases.The N-terminal region of FliX has characteristics of signal-peptide sequences (38), including a charged amino terminusand a potential signal peptidase cleavage site (Gly-X-Ser 1).The most probable cleavage site for the putative signal peptideis between amino acids 24 and 25. Hydrophobicity analysis

FIG. 2. Electron micrographs of C. crescentus NA1000 and the fliX null strainLS2821. (A) Strain NA1000 showing normal swarmer, stalked, and predivisionalcells. (B) LS2821 (fliX::Tn5) lacking flagella and forming filamentous cells. (C).LS2821 complemented with plasmid pCM13.



.org/D

ownloaded from

http://jb.asm.org/

showed that FliX has two hydrophobic domains (Fig. 4B). Thefirst region, from residues 31 to 52, constitutes a typical alpha-helical transmembrane domain, suggesting that FliX may be anintegral membrane protein.

A second ORF, located adjacent to fliX, was designateddksA based on the similarity of its predicted protein product toDksA homologs from other organisms (Fig. 4C). Homology tothe N termini of known dksA gene products was detected indatabase searches with the published sequence of the flgI re-gion (26). This homology extended to the SacI site located atposition 1 of the published sequence, suggesting that the re-mainder of the dksA gene extended downstream of the SacIsite. A 1.1-kb PstI fragment with the SacI site located approx-imately midway in the fragment was subcloned from cosmidpCM1, and the complete nucleotide sequence of dksA wasdetermined on both strands. The putative dksA initiationcodon is located 208 bp downstream of the fliX terminationcodon. The dksA gene appears to be transcribed from its ownpromoter based on the activity of reporter fusions with thedksA-fliX intervening region (31). The C. crescentus DksA pro-tein is 45% identical to the Haemophilus influenzae and E. coliDksA proteins (Fig. 4C). The dksA gene was originally iden-tified in E. coli as a multicopy suppressor of the temperature-sensitive growth of a dnaK null strain (25). More recently, dksAhas been identified as a multicopy suppressor of mutations inthe chromosome-partitioning gene mukB (56), in the periplas-mic protease tsp (3), and in the origin of replication of plasmidpCS101 (35). In E. coli the dksA gene has been shown to benonessential (25). Insertional inactivation of the C. crescentusdksA gene has no observable affect on motility, growth, or celldivision under normal growth conditions (31).

Placement of the fliX gene in class II of the flagellar regu-latory hierarchy. Epistasis experiments were performed in or-der to determine the position of fliX within the flagellar regu-latory hierarchy. The nonmotile and aberrant cell divisionphenotypes of the fliX null strain are consistent with a muta-tion in a class II flagellar gene. Mutations in class II flagellargenes typically result in an increased expression of other classII flagellar genes and a dramatic reduction in the expression ofclass III and IV flagellar genes (34, 55). In order to analyze the

effect of the fliX mutant on flagellar gene expression, transcrip-tional fusions of representative class II, III, and IV flagellargene promoters to lacZ were introduced into LS2821(fliX::Tn5) on low-copy-number plasmids and b-galactosidaseactivity was measured and compared to that of NA1000. Theexpression of class II promoters was elevated in LS2821, whilethat of class III and IV promoters was dramatically reduced(Table 2), consistent with the phenotype expected of a class IIflagellar mutant.

Conversely, we examined the effect of known flagellar mu-tants on fliX expression. An 800-bp PstI fragment extending200 bp into the fliX coding region and 400 bp into the flgIcoding region was cloned into pRKlac290, yielding recombi-nant plasmids pCM9 and pCM10, with the two possible orien-tations of the PstI insertion. The pCM9 construct places lacZunder the control of the fliX promoter, while the pCM10 con-struct places lacZ under the control of the promoter for theclass III flagellar gene flgI. The pCM9 and pCM10 constructsintroduced into strain NA1000 produced approximately 1,700and 700 U of b-galactosidase, respectively. As shown in Table3, the fliX::lacZ fusion (pCM9) showed elevated expression inclass II flagellar mutants and was relatively unaffected by mu-tations in class III flagellar genes, as expected for the expres-sion of a class II flagellar gene. In contrast, expression of theflgI::lacZ fusion (pCM10) was dramatically reduced in class IIflagellar mutants and increased roughly twofold in class IIIflagellar mutants, the expected expression pattern for a classIII flagellar gene.

A number of class II flagellar genes have been shown to beunder transcriptional regulation by the CtrA response regula-tor (39). We therefore tested the activity of the fliX::lacZfusion in strain LS2195, which contains a temperature-sensitivemutation in ctrA (39). Two hours after a shift to the nonper-missive temperature, b-galactosidase activity was reduced byover 50% (Table 3). A similar reduction in activity of the classIII flgI-lacZ fusion was most likely indirect, due to the block inflagellar class II gene expression.

The transcription of class II flagellar genes is activated mid-way through the cell cycle, prior to the activation of class IIIand then class IV flagellar genes. To test the relative time of

FIG. 3. Complementation analysis of LS2821. (A) Genetic and restriction map of the C. crescentus chromosomal region upstream of flgI (26) and plasmidscomplementing (1) or not complementing (2) the motility and cell division phenotypes of LS2821. The triangle represents the site of Tn5 insertion in LS2821 asdetermined by Southern blot analysis (data not shown). Abbreviations: H, HindIII; S, SacI; N, NlaIII; P, PstI; X, XhoI.



.org/D

ownloaded from

http://jb.asm.org/

fliX transcriptional activation, swarmer cells were isolated fromcultures of NA1000 containing either pCM9 (fliX::lacZ) orpCM10 (flgI::lacZ) and allowed to progress synchronouslythrough the cell cycle. At 15-min intervals, samples were pulse-labeled with [35S]Trans-Label for 5 min and cell extracts wereimmunoprecipitated with anti-b-galactosidase antibody. As an

internal control, samples of the same cell extracts were alsoimmunoprecipitated with antibodies to the class IV flagellarfilament proteins. Both fliX::lacZ and flgI::lacZ exhibited tem-poral regulation, with fliX transcription initiating somewhatbefore flgI relative to the flagellin internal control (Fig. 5). fliXpromoter expression began between 0.3 and 0.4 division unitsand peaked in the predivisional cell, similar to that reportedfor other class II flagellar genes (36, 41, 49, 58). The expressionof flgI began between 0.4 and 0.5 division units, slightly laterthan that of fliX, consistent with the time of activation of otherclass III flagellar promoters (10, 22, 32).

Thus, the phenotype of the fliX mutant, the results of theepistasis experiments, and the time of fliX transcriptional ac-tivation relative to those of other flagellar genes leads to theconclusion that fliX is a class II flagellar gene and that the fliXgene product is likely to be required at an early stage in flagel-lar assembly.

Mapping the transcriptional start sites for fliX and flgI. S1nuclease protection assays were used to determine the fliX andflgI transcriptional start sites (Fig. 6). The 568-bp probe used

FIG. 4. (A) Predicted amino acid sequence of FliX. The possible signal peptide sequence is underlined, and the cleavage site is indicated by a vertical arrow.Numbers indicate amino acids. (B) Hydrophobicity plot of the FliX protein. The graph was generated by the Hydrophobicity Plot program in the DNA Strider package.Negative values indicate hydrophilic regions, and positive values indicate hydrophobic regions. (C) Alignment of C. crescentus (Cc) DksA with the homologs from E.coli (Ec) (25) and H. influenzae (Hi) (17). Asterisks indicate identical amino acids.

TABLE 2. Flagellar gene expression in the fliX null strain LS2821

Class Promoterb-Galactosidase activity (U)

NA1000 LS2821

II fliF 1,169 3,274fliLM 968 2,738fliQ 1,194 3,429

III flgH 675 160flgI 243 55

IV fljL 1,941 218



.org/D

ownloaded from

http://jb.asm.org/

for mapping the fliX transcriptional start site was end labeledat the SalI site located 158 bp into the fliX coding sequence.The 600-bp probe used for mapping the transcriptional startsite of flgI was end labeled at the XhoI site located 212 bp intothe flgI coding region. To define precisely the ends of theprotected transcripts, DNA sequencing reactions were per-formed with primers whose 59 ends matched the 59 ends of thelabeled probes. Two products of equal intensities, correspond-ing to two transcriptional start points, were consistently seen inS1 nuclease experiments with either the fliX or the flgI pro-moter probe (Fig. 6). The length of the protected fragmentscorresponding to the fliX transcript indicated that the tran-scriptional start sites (11A and 11B) (Fig. 6) are located 45and 43 bp, respectively, upstream of the fliX initiation codon.The lengths of the protected fragments corresponding to theflgI transcript indicated that the transcriptional start sites 11Aand 11B (Fig. 6) are located 29 and 27 bp, respectively, up-stream of the flgI initiation codon. The distance between thefliX and flgI transcriptional start sites (11A) is 158 bp (Fig.7B).

DNase I footprinting analysis of the CtrA binding site in thefliX promoter. Class II flagellar genes are driven by a uniqueclass of promoters which contain a conserved DNA motif rec-ognized by the CtrA response regulator (39). Examination ofthe fliX promoter region revealed a sequence, centered around235, which matched seven of nine bases of the consensus CtrAbinding site (TTAA-N7-TTAAC) (Fig. 7B). The CtrA bindingmotif is typically located in the 235 regions of other class IIflagellar promoters (39). To determine if CtrA recognizes thissite and binds directly to the fliX promoter, DNase I footprint-ing studies were performed with a purified His-CtrA fusionprotein. The His-CtrA fusion protein has previously beenshown to bind the class II fliQ promoter, at a region overlap-ping the CtrA binding motif (39). In the presence of CtrA, asingle protected region of 17 bp, partially overlapping the bind-ing motif, was observed. This region extended from positions231 to 247 relative to the fliX 11A transcriptional start site(Fig. 7A and B). These results, and the finding that transcrip-tion of fliX is decreased in a strain bearing a ctrA401 allele,suggest that CtrA plays a direct role in the regulation of fliXtranscription.

Analysis of the fliX-flgI intergenic region revealed a number

of other potential cis-acting regulatory elements (Fig. 7B andC). Overlapping the CtrA binding site within the fliX promoteris the first of two ftr (flagellar transcriptional regulation) ele-ments. The ftr elements are binding sites for the transcriptionalactivator FlbD and are typically present in pairs approximately100 bp upstream of the transcriptional start sites for class IIIflagellar genes (4, 33, 51, 53). Sequences at 224 and 212 of theflgI promoter conform to the consensus sequence for s54-dependent promoters typically found in other class III flagellargenes (53). Between this sequence and the ftr elements is aconsensus binding site for integration host factor. The pres-ence and arrangement of regulatory elements within the fliX-flgI intergenic region is similar to those of the fliL-flgF inter-

FIG. 5. Patterns of fliX and flgI transcription during the cell cycle. Swarmercells from cultures of NA1000 containing either pCM9 (fliX::lacZ) or pCM10(flgI::lacZ) were isolated and allowed to progress synchronously through the cellcycle. At 15-min intervals, a portion of the culture was removed and proteinswere pulse-labeled with [35S]Trans-Label. (A) Results of immunoprecipitation of35S-labeled b-galactosidase from strains carrying either pCM9 (fliX::lacZ) orpCM10 (flgI::lacZ) and of 35S-labeled flagellar filament proteins, followed byelectrophoresis on an SDS–10% polyacrylamide gel and autoradiography. Theflagellin proteins were monitored as an internal control and indicator for thequality of cell synchrony. Shown are flagellins recovered from cells carrying theflgI::lacZ fusion. Flagellin proteins recovered from the cells carrying thefliX::lacZ fusion gave nearly identical immunoprecipitation and quantificationprofiles. The cell types present at each time point, monitored microscopically, arerepresented schematically above the graphs and the autoradiograms. (B) Quan-tification of the data in panel A with a Molecular Dynamics PhosphorImager,reported as the percentage of maximal expression for each protein. The durationof the cell cycle was approximately 150 min. Filled boxes represent expression ofthe fliX::lacZ fusion, open boxes represent expression of the flgI::lacZ fusion, andfilled circles represent expression of flagellin. The Roman numerals in paren-theses indicate the flagellar class for each gene (fliX, flgI) or protein (flagellins)examined.

TABLE 3. Effects of flagellar gene mutations on fliX andflgI transcriptiona

Strain(temp, °C) Mutant gene Class

b-Galactosidase activity(U) with:

pCM9(fliX::lacZ)

pCM10(flgI::lacZ)

NA1000 1,683 683

LS1917 flgI III 1,577 1,400SC1117 flgH III 1,474 1,211

LS1218 fliF II 3,870 26SC1131 fliM II 3,727 30SC508 fliQR II 4,834 31LS2821 fliX II 4,051 68

LS2195 (28) ctrA401 I 1,065 745LS2195 (37) ctrA401 I 300 157

a Plasmids pCM9 (fliX::lacZ) and pCM10 (flgI::lacZ) were mated into strainNA1000, flagellar class II and III mutants, and strain LS2195 containing atemperature-sensitive mutation in ctrA (39). b-Galactosidase activity was mea-sured as described in Materials and Methods and compared to that of NA1000.



.org/D

ownloaded from

http://jb.asm.org/

genic region (29), which controls the class II fliLM operon andthe class III flgFGDH flagellar operon (Fig. 7C).

FliX is a membrane protein that is present throughout thecell cycle. A polyhistidine-tagged FliX protein was overex-pressed, purified, and used to generate antibodies. The FliX

antibody recognized a protein of 15 kDa (Fig. 8A) which issimilar in size to the 14.5-kDa protein predicted from the fliXnucleotide sequence. The fliX null strain LS2821 completelylacks the 15-kDa protein, which was restored when the fliXgene was provided in trans on the complementing plasmid

FIG. 6. S1 nuclease mapping of the flgI and fliX transcriptional start sites. The lanes labeled G, A, T, and C show the products of the sequencing reactions that usedoligonucleotide primers with 59 sequences matching the labeled ends of the S1 nuclease probes. Lanes labeled 1 and 2 contained labeled probe hybridized to 40 and80 mg of C. crescentus total RNA, respectively. The identified transcriptional start sites (11A and 11B) are indicated next to the sequence.

FIG. 7. (A) Footprinting analysis of His-CtrA at the fliX promoter. An end-labeled BspEI-PstI fragment containing sequences from 292 to 1220 (relative to the11A transcriptional start site) of the fliX promoter was incubated in the presence or absence of CtrA and then digested with DNase I as described in Materials andMethods. The triangle indicates increasing concentrations of His-CtrA (10, 20, and 40 mg). The minus signs indicate that no protein was added, and the asterisk indicatesa hypersensitive site. (B) Nucleotide sequence of the fliX-flgI intergenic region showing 210 and 235 regions for fliX and flgI as well as the CtrA binding site andpotential cis-acting regulatory elements. Numbers are given relative to the 11A transcriptional start sites. The nucleotide sequence is shown from 59 to 39 in thedirection of transcription of flgI. Boldface nucleotides denote the consensus CtrA binding site, and ftr denotes the potential binding sites for the transcriptional activatorFlbD. Double-underlined sequences at 224 and 212 of the flgI promoter conform to the consensus sequence for s54-dependent promoters. Overlined is the conservedbinding site for integration host factor (IHF). Arrows indicate the transcriptional start sites determined by S1 nuclease analysis. (C) Comparison of the organizationof cis-acting elements in the fliX-flgI (26) and fliL-flgF (29, 53) intergenic regions. Arrows denote transcriptional start sites.



.org/D

ownloaded from

http://jb.asm.org/

pCM13 (Fig. 8A, lanes 2 and 3). Elevated levels of the 15-kDaprotein were observed in protein extracts from the class II fliFand fliQR flagellar mutants (Fig. 8A, lanes 4 and 5), as wasexpected from the expression analysis of the fliX promoter(Table 3).

Cell-type-specific proteolysis has been shown to play an im-portant role in maintaining asymmetry in the predivisional cell.The McpA chemoreceptor (1) and FliF flagellar motor protein(22), for example, are specifically degraded during the transi-tion from swarmer to stalked cell. In contrast, the flagellarFlgH ring protein and the FliL protein are present throughoutthe cell cycle (23, 32). In order to examine FliX protein levelsduring the cell cycle, cell extracts were prepared from samplesof synchronous cultures at several times during the cell cycleand assayed by Western blot analysis with anti-FliX antibodies.As controls, the extracts were also assayed with anti-FliF oranti-McpA antibodies. As previously shown, the FliF andMcpA proteins are turned over during the transition from

swarmer to stalked cells (Fig. 8B). In contrast, the steady-statelevel of the FliX protein remains constant (Fig. 8B), suggestingthat FliX is not turned over during the cell cycle, even thoughits synthesis is under temporal control (Fig. 5).

The N-terminal region of FliX contains a putative cleavablesignal sequence, followed by a hydrophobic transmembranedomain, suggesting that FliX might function extracytoplasmi-cally. To determine the cellular location of the FliX protein,cell extracts from strain NA1000 were separated into cytoplas-mic, membrane, and extracellular fractions and Western blotanalysis with anti-FliX antibody was used to detect the proteinsin these fractions. As a control for the purity of the fractions,each sample was also probed with antisera to the cytoplasmicCcrM DNA methyltransferase (48), the outer membrane L-ring protein, FlgH (23), and the predominantly extracellularflagellins. FliX was found almost exclusively in the membranefraction, although a small but detectable amount was also seenin the cytoplasmic fraction (Fig. 8C).

FIG. 8. Western blot characterization of FliX. (A) Western blot analysis of the FliX protein in NA1000 and flagellar mutants. Equal amounts of protein fromwhole-cell extracts were separated by SDS–12% PAGE and immunoblotted with anti-FliX antibody. Lanes: 1, NA1000; 2, LS2821 (fliX::Tn5); 3, LS2821 complementedwith plasmid pCM13; 4, LS1218 (fliF mutant); 5, SC508 (fliQR mutant). (B) FliX protein levels throughout the cell cycle. Swarmer cells isolated from a culture ofNA1000 were suspended in fresh medium and allowed to progress through the cell cycle. At 15-min intervals, 1-ml aliquots were removed. Equal amounts of totalprotein from each time point were separated by SDS-PAGE and immunoblotted with antisera to FliX, FliF, and McpA proteins. Shown schematically above theautoradiograms are the cell types present at each time point as determined by light microscopy. (C) Subcellular localization of the FliX protein. Cell extracts from strainNA1000 were fractionated into membrane, cytoplasmic, and extracellular fractions as described in Materials and Methods. Equal amounts of protein from each fractionand a whole-cell control were separated by SDS-PAGE and blotted onto polyvinylidene difluoride membranes. Membranes were probed separately with polyclonalantisera to FliX, the CcrM DNA methyltransferase, the FlgH flagellar ring protein, and C. crescentus flagellins.



.org/D

ownloaded from

http://jb.asm.org/

DISCUSSION

We have isolated and characterized fliX, a gene required forflagellar assembly and normal cell division in C. crescentus.Epistasis experiments place fliX in class II of the flagellarregulatory hierarchy, indicating that the fliX gene productfunctions at an early stage in flagellar biogenesis. The obser-vations that FliX copurifies with the membrane fraction andthat the FliX predicted amino acid sequence has a potentialN-terminal signal sequence and at least one transmembranedomain indicate that FliX functions either in or in associationwith the membrane. In Caulobacter, the only flagellar proteinsother than FliX that possess N-terminal signal sequences arethe protein monomers for the P- and L-rings (11, 26). The P-and L-ring proteins are presumed to be exported across thecytoplasmic membrane to their respective destinations in thecell envelope via the general secA-dependent pathway. Thisexport is in contrast to that of the axial rod, hook, and filamentsubunit proteins, which do not have cleaveable signal se-quences and are exported by a flagellum-specific export appa-ratus (28). The presence of an N-terminal signal sequencesuggests that FliX may use the same pathway as the P- andL-ring proteins for translocation to the membrane. The func-tion of FliX in the cell envelope has not been determined.Although the genes encoding the known substructures of theflagellum have been identified (Fig. 1), it is possible that FliXfunctions as a transient component of the flagellum that isrequired for the assembly process. FliX may contribute to thetargeting or assembly of the P- and L-ring protein monomers atthe cell pole. Immunolocalization and coimmunoprecipitationstudies with the anti-FliX antibodies are under way to furtherelucidate the role of FliX.

A hallmark of the flagellar regulatory hierarchy in Cau-lobacter is the sequential activation of the genes required toassemble the flagellum. It has recently been shown that thecues which initiate flagellar biogenesis at a specific time in thecell cycle are mediated through the signal transduction re-sponse regulator CtrA, by regulating the transcriptional activ-ity of class II flagellar genes (39). We have shown that fliXexpression is activated at the same time in the cell cycle asother class II genes and that its full expression is dependent onCtrA, which interacts directly with the fliX promoter. We pro-pose that in vivo, the temporal control of fliX expression duringthe Caulobacter cell cycle is mediated directly through bindingand transcriptional activation by CtrA.

While the CtrA protein regulates the transcription of class IIflagellar genes, the FlbD response regulator mediates the tran-sition from early to late flagellar gene expression by activatingclass III and IV flagellar genes (4, 40, 52, 53). We have shownthat the class II fliX gene and the class III flgI gene are diver-gently transcribed and that their transcriptional start sites areseparated by a 158-bp intergenic region. We have demon-strated that the intergenic region mediates the cell cycle con-trol of fliX and flgI expression. Analysis of this region revealednot only the presence of a CtrA binding motif but also twoFlbD binding sites, termed ftr (Fig. 7B). This arrangement ofcis-acting elements is similar to that of another set of class IIand class III flagellar genes, fliL-flgF, that is also divergentlytranscribed (see Fig. 7C). We have recently demonstrated thatCtrA binds to the class II fliL promoter in vitro (42). A directinteraction between FlbD and the flgI and flgF promoters hasnot yet been demonstrated. However, Wu et al. (53) haveshown that flgI and flgF promoter fragments, with the ftr ele-ments intact, can be transcriptionally activated by FlbD, indi-cating that FlbD binds to the ftr elements to control flgI andflgF expression. The fliX-flgI and fliL-flgF intergenic regions,

therefore, appear to be important control sites for both theinitiation of flagellar biogenesis by CtrA and the transitionfrom early to late flagellar gene expression mediated by FlbD.

Does the regulatory control exerted on the fliX-flgI andfliL-flgF intergenic regions reflect a functional relationship be-tween the products of these divergent transcription units? Theclass II fliLM operon encodes FliL, a membrane protein ofunknown function, and FliM, a flagellar switch protein. Theclass III flgF operon encodes the basal body rod proteins andFlgH, the L-ring monomer. We have previously shown that theFlgH protein is expressed, but unstable, in a flgI null strain(32), suggesting that the assembly of FlgI into the P-ring andFlgH into the L-ring is coordinately controlled. In an attemptto establish a similar relationship between fliX and the prod-ucts of the fliLM operon, we examined FliL and FliM proteinlevels in LS2821, the fliX null strain. We found that FliL andFliM were present in the fliX null strain, indicating that theabsence of FliX does not affect the stability of these proteins(31). Alternatively, the regulatory control exerted on the fliX-flgI intergenic region may reflect a functional relationship be-tween FliX and FlgI. For example, if FliX has a role in theassembly of the periplasmic FlgI P-ring monomers, then theregulatory control of the fliX-flgI intergenic region would en-sure that FliX synthesis occurs prior to that of FlgI, its targetsubstrate.

ACKNOWLEDGMENTS

We thank members of the Shapiro lab for critical readings of themanuscript.

This work was supported by National Institutes of Health grant GM32506/5120MZ.

REFERENCES

1. Alley, M. R., J. R. Maddock, and L. Shapiro. 1993. Requirement of thecarboxyl terminus of a bacterial chemoreceptor for its targeted proteolysis.Science 259:1754–1757.

2. Anderson, D. K., N. Ohta, J. Wu, and A. Newton. 1995. Regulation of theCaulobacter crescentus rpoN gene and function of the purified sigma 54 inflagellar gene transcription. Mol. Gen. Genet. 246:697–706.

3. Bass, S., Q. Gu, and A. Christen. 1996. Multicopy suppressors of Prc mutantEscherichia coli include two HtrA (DegP) protease homologs (HhoAB),DksA, and truncated RlpA. J. Bacteriol. 178:1154–1161.

4. Benson, A. K., G. Ramakrishnan, N. Ohta, J. Feng, A. J. Ninfa, and A.Newton. 1994. The Caulobacter crescentus FlbD protein acts at ftr sequenceelements both to activate and to repress transcription of cell cycle-regulatedflagellar genes. Proc. Natl. Acad. Sci. USA 91:4989–4993.

5. Brun, Y. V., and L. Shapiro. 1992. A temporally controlled sigma-factor isrequired for polar morphogenesis and normal cell division in Caulobacter.Genes Dev. 6:2395–2408.

6. Bryan, R., D. Glaser, and L. Shapiro. 1990. A genetic regulatory hierarchy inCaulobacter development. Adv. Genet. 27:1–31.

7. Carter, P., H. Bedouelle, and G. Winter. 1985. Improved oligonucleotidesite-directed mutagenesis using M13 vectors. Nucleic Acids Res. 13:4431–4443.

8. Champer, R., A. Dingwall, and L. Shapiro. 1987. Cascade regulation ofCaulobacter flagellar and chemotaxis genes. J. Mol. Biol. 194:71–80.

9. Devereux, D., P. Hableri, and O. Smithies. 1984. A comprehensive set ofsequence analysis programs for the VAX. Nucleic Acids Res. 12:387–395.

10. Dingwall, A., J. D. Garman, and L. Shapiro. 1992. Organization and orderedexpression of Caulobacter genes encoding flagellar basal body rod and ringproteins. J. Mol. Biol. 228:1147–1162.

11. Dingwall, A., J. W. Gober, and L. Shapiro. 1990. Identification of a Cau-lobacter basal body structural gene and a cis-acting site required for activa-tion of transcription. J. Bacteriol. 172:6066–6076.

12. Dingwall, A., W. Y. Zhuang, K. Quon, and L. Shapiro. 1992. Expression ofan early gene in the flagellar regulatory hierarchy is sensitive to an interrup-tion in DNA replication. J. Bacteriol. 174:1760–1768.

13. Domian, I. J., K. C. Quon, and L. Shapiro. 1997. Cell type-specific phos-phorylation and proteolysis of a transcriptional regulator controls the G1-to-S transition in a bacterial cell cycle. Cell 90:415–424.

14. Ely, B. 1991. Genetics of Caulobacter crescentus. Methods Enzymol. 204:372–384.

15. Ely, B., and R. H. Croft. 1982. Transposon mutagenesis in Caulobactercrescentus. J. Bacteriol. 149:620–625.



.org/D

ownloaded from

http://jb.asm.org/

16. Evinger, M., and N. Agabian. 1977. Envelope-associated nucleoid from Cau-lobacter crescentus stalked and swarmer cells. J. Bacteriol. 132:294–301.

17. Fleischmann, R. D., M. D. Adams, O. White, R. A. Clayton, E. F. Kirkness,A. R. Kerlavage, C. J. Bult, J. Tomb, B. A. Dougherty, J. M. Merrick, K.McKenney, G. Sutton, W. Fitzhugh, C. Fields, J. D. Gocayne, J. Scott, R.Shirley, L. Liu, A. Glodek, J. M. Kelley, et al. 1995. Whole-genome randomsequencing and assembly of Haemophilus influenzae Rd. Science 269:496–512.

18. Francis, N. R., G. E. Sosinsky, D. Thomas, and D. J. DeRosier. 1994.Isolation, characterization, and structure of bacterial flagellar motors con-taining the switch complex. J. Mol. Biol. 235:1261–1270.

19. Gober, J. W., C. H. Boyd, M. Jarvis, E. K. Mangan, M. F. Rizzo, and J. A.Wingrove. 1995. Temporal and spatial regulation of fliP, an early flagellargene of Caulobacter crescentus that is required for motility and normal celldivision. J. Bacteriol. 177:3656–3667.

20. Gober, J. W., and L. Shapiro. 1992. A developmentally regulated Cau-lobacter flagellar promoter is activated by 39 enhancer and IHF bindingelements. Mol. Biol. Cell 3:913–926.

21. Hahnenberger, K. M., and L. Shapiro. 1987. Identification of a gene clusterinvolved in flagellar basal body biogenesis in Caulobacter crescentus. J. Mol.Biol. 194:91–103.

22. Jenal, U., and L. Shapiro. 1996. Cell cycle-controlled proteolysis of a flagel-lar motor protein that is asymmetrically distributed in the Caulobacter pre-divisional cell. EMBO J. 15:2393–2406.

23. Jenal, U., J. White, and L. Shapiro. 1994. Caulobacter flagellar function, butnot assembly, requires FliL, a non-polarly localized membrane proteinpresent in all cell types. J. Mol. Biol. 243:227–244.

24. Johnson, R. C., and B. Ely. 1979. Analysis of nonmotile mutants of thedimorphic bacterium Caulobacter crescentus. J. Bacteriol. 137:627–634.

25. Kang, P. J., and E. A. Craig. 1990. Identification and characterization of anew Escherichia coli gene that is a dosage-dependent suppressor of a dnaKdeletion mutation. J. Bacteriol. 172:2055–2064.

26. Khambaty, F. M., and B. Ely. 1992. Molecular genetics of the flgI region andits role in flagellum biosynthesis in Caulobacter crescentus. J. Bacteriol. 174:4101–4109.

27. Kokjohn, T. A., and R. Miller. 1987. Characterization of the Pseudomonasaeruginosa recA analog and its protein product: rec-102 is a mutant allele ofthe P. aeruginosa PAO recA gene. J. Bacteriol. 169:1499–1508.

28. Macnab, R. 1996. Flagella and motility, p. 123–145. In F. C. Neidhardt, R.Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S.Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichiacoli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press,Washington, D.C.

29. Marques, M. V., and J. Gober. 1995. Activation of a temporally regulatedCaulobacter promoter by upstream and downstream sequence elements.Mol. Microbiol. 16:279–289.

30. Miller, J. H. 1972. Experiments in molecular genetics, p. 352–355. ColdSpring Harbor Laboratory, Cold Spring Harbor, N.Y.

31. Mohr, C. Unpublished data.32. Mohr, C. D., U. Jenal, and L. Shapiro. 1996. Flagellar assembly in Cau-

lobacter crescentus: a basal body P-ring null mutation affects stability of theL-ring protein. J. Bacteriol. 178:675–682.

33. Mullin, D., S. Minnich, L. S. Chen, and A. Newton. 1987. A set of positivelyregulated flagellar gene promoters in Caulobacter crescentus with sequencehomology to the nif gene promoters of Klebsiella pneumoniae. J. Mol. Biol.195:939–943.

34. Newton, A., N. Ohta, G. Ramakrishnan, D. Mullin, and G. Raymon. 1989.Genetic switching in the flagellar gene hierarchy of Caulobacter requiresnegative as well as positive regulation of transcription. Proc. Natl. Acad. Sci.USA 86:6651–6655.

35. Ohkubo, S., and K. Yamaguchi. 1997. A suppressor of mutations in theregion adjacent to iterons of pSC101 ori. J. Bacteriol. 179:2089–2091.

36. Ohta, N., L. S. Chen, D. A. Mullin, and A. Newton. 1991. Timing of flagellargene expression in the Caulobacter cell cycle is determined by a transcrip-tional cascade of positive regulatory genes. J. Bacteriol. 173:1514–1522.

37. O’Neill, E. A., R. H. Hynes, and R. A. Bender. 1985. Recombination deficientmutant of Caulobacter crescentus. Mol. Gen. Genet. 198:275–278.

38. Pugsley, A. P. 1993. The complete general secretory pathway in gram-neg-ative bacteria. Microbiol. Rev. 57:50–108.

39. Quon, K. C., G. T. Marczynski, and L. Shapiro. 1996. Cell cycle control byan essential bacterial two-component signal transduction protein. Cell 84:83–93.

40. Ramakrishnan, G., and A. Newton. 1990. FlbD of Caulobacter crescentus is ahomologue of the NtrC (NRI) protein and activates sigma 54-dependentflagellar gene promoters. Proc. Natl. Acad. Sci. USA 87:2369–2373.

41. Ramakrishnan, G., J. L. Zhao, and A. Newton. 1991. The cell cycle-regulatedflagellar gene flbF of Caulobacter crescentus is homologous to a virulencelocus (lcrD) of Yersinia pestis. J. Bacteriol. 173:7283–7292.

42. Reisenauer, A. Unpublished data.43. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a

laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.

44. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.

45. Shapiro, L. 1995. The bacterial flagellum: from genetic network to complexarchitecture. Cell 80:525–527.

46. Simon, R., U. Piefer, and A. Puhler. 1993. A broad host range mobilizationsystem for in vivo genetic engineering: transposon mutagenesis in gramnegative bacteria. Bio/Technology 1:784–790.

47. Stephens, C., C. Mohr, C. Boyd, J. Maddock, J. Gober, and L. Shapiro. 1997.Identification of the fliI and fliJ components of the Caulobacter flagellar typeIII protein secretion system. J. Bacteriol. 179:5355–5365.

48. Stephens, C., A. Reisenauer, R. Wright, and L. Shapiro. 1996. A cell cycle-regulated bacterial DNA methyltransferase is essential for viability. Proc.Natl. Acad. Sci. USA 93:1210–1214.

49. Stephens, C. M., and L. Shapiro. 1993. An unusual promoter controls cell-cycle regulation and dependence on DNA replication of the CaulobacterfliLM early flagellar operon. Mol. Microbiol. 9:1169–1179.

50. Wingrove, J. A., and J. Gober. 1996. Identification of an asymmetricallylocalized sensor histidine kinase responsible for temporally and spatiallyregulated transcription. Science 274:597–601.

51. Wingrove, J. A., and J. W. Gober. 1994. A sigma 54 transcriptional activatoralso functions as a pole-specific repressor in Caulobacter. Genes Dev.8:1839–1852.

52. Wingrove, J. A., E. K. Mangan, and J. W. Gober. 1993. Spatial and temporalphosphorylation of a transcriptional activator regulates pole-specific geneexpression in Caulobacter. Genes Dev. 7:1979–1992.

53. Wu, J., A. K. Benson, and A. Newton. 1995. Global regulation of a sigma54-dependent flagellar gene family in Caulobacter crescentus by the transcrip-tional activator FlbD. J. Bacteriol. 177:3241–3250.

54. Wu, J., and A. Newton. 1997. Regulation of the Caulobacter flagellar genehierarchy; not just for motility. Mol. Microbiol. 24:233–239.

55. Xu, H., A. Dingwall, and L. Shapiro. 1989. Negative transcriptional regula-tion in the Caulobacter flagellar hierarchy. Proc. Natl. Acad. Sci. USA 86:6656–6660.

56. Yamanaka, K., T. Mitani, T. Ogura, H. Niki, and S. Hiraga. 1994. Cloning,sequencing, and characterization of multicopy suppressors of a mukB mu-tation in Escherichia coli. Mol. Microbiol. 13:301–312.

57. Yu, J., and L. Shapiro. 1992. Early Caulobacter crescentus genes fliL and fliMare required for flagellar gene expression and normal cell division. J. Bac-teriol. 174:3327–3338.

58. Zhuang, W. Y., and L. Shapiro. 1995. Caulobacter FliQ and FliR membraneproteins, required for flagellar biogenesis and cell division, belong to a familyof virulence factor export proteins. J. Bacteriol. 177:343–356.



.org/D

ownloaded from

http://jb.asm.org/

Documents

A Membrane-Associated Protein, FliX, Is Required for an ... · MATERIALS AND METHODS Materials. Oligonucleotides were obtained from either Operon Technologies (Alameda, Calif.) or