Proc. Nati. Acad. Sci. USAVol. 80, pp. 5827-5831, October 1983Biochemistry

A host protein (La) binds to a unique species of minus-sense leaderRNA during replication of vesicular stomatitis virus

(lupus antisera/virus-host interaction/RNA polymerase Ill)

JEFFREY WILUSZ, MICHAEL G. KURILLA, AND JACK D. KEENE*Department of Microbiology and Immunology, Duke University Medical Center, Durham, North Carolina 27710

Communicated by W. K. Joklik, May 31, 1983

ABSTRACT Baby hamster kidney cells infected with the mi-nus-strand RNA virus vesicular stomatitis virus (VSV) were foundto contain three small viral leader RNA species of the minus sense.The longest minus-strand leader RNA was 54 nucleotides long andwas complexed with the host cell La protein that was immuno-precipitated by antisera from patients with systemic lupus ery-*thematosus. The La protein is normally found associated with RNApolymerase Ill transcripts in their unprocessed form. Shorter mi-nus-strand leader RNA species of 45-48 nucleotides were moreabundant but were not associated with the La protein. Unlike theplus-strand leader RNA of VSV, the minus-strand leader RNAswere not detected in the nucleus in any form. The minus-strandleader RNAs accumulated gradually throughout the infection andcould not be found in association with the viral nucleocapsid pro-tein. The sequence required for La protein binding on the 54-nu-cleotide-long minus-strand leader is similar to that at the 3' endof the La protein binding-plus-strand leader RNA and, thus, wepropose a role for the La protein in the replication of VSV.

Vesicular stomatitis virus (VSV) is a minus-strand RNA cyto-plasmic virus that packages RNA polymerase in purified vi-rions. The 42S genomic RNA serves as template for five mono-cistronic, capped, and polyadenylylated mRNAs. Viral RNApolymerase initiates transcription in vivo and in vitro at the 3'end of the genome and sequentially transcribes the genes in theorder 3' N-NS-M-G-L 5' (1). In addition, the polymerase alsosynthesizes a leader RNA from the 3' terminus of the genome.This plus-sense leader RNA has been implicated in the shutoffof host macromolecular synthesis (2, 3) and is transported to thenucleus early in the infection (4). In addition, it may serve asa decision point. for the switch from viral transcription to rep-lication (5). The mechanism by which this switch occurs is un-known. In the process of replication, the virus must synthesizea full-length 42S plus-sense complementary product from thegenomic minus-sense RNA. The 42S plus strand in turn servesas template for two kinds of RNA products: full-length minusstrands for packaging into progeny particles and short minus-strand leader RNAs. The minus-strand leader RNA may serveas an early decision point for synthesis of the genomic minusstrand during replication (5).

Several lines of evidence have suggested a role for host cellfactors in VSV transcription and replication. Host range mu-tants of VSV have been isolated that have altered transcriptiveproperties (6, 7) and extracts from uninfected cells have beenfound to alter the quality and quantity of in vitro transcription(refs. 8 and 9; unpublished data). The nature of these factorsis not understood and whether they interact with the RNA poly-merase, the ribonucleoprotein (RNP) template, or the viraltranscripts has not been determined. Virus-host interactions

affecting transcription may be central to understanding VSV.replication and viral cytopathology.We have recently found that patients with the anti-La pro-

tein specificity of systemic lupus erythematosus produce an-tibodies that react with VSV plus-strand leader RNA (10). TheLa antigen is a 45-kilodalton protein that is transiently boundto unprocessed cellular precursor RNAs that are.products ofRNA polymerase III (11). This protein is.more stably bound tothe viral antigen RNAs of adenovirus and to the Epstein-Barrvirus-encoded RNAs (12). These small viral RNA species arealso transcribed in infected cells by cellular RNA polymeraseIII. Although the La protein is presumed to be largely a nuclearantigen (13), we have detected the La protein-bound VSV plus-strand leader RNA in an extranuclear form (10). These findingssuggested that the La protein may function as a host factor inVSV transcription or replication through interaction with theplus-strand leader RNA. To further examine the role of the Laprotein in VSV replication, we have analyzed interactions withthe minus-strand leader RNA by immunoprecipitation with lu-pus antisera. We were unable to detect significant binding be-tween the La antigen and the minus-strand leader RNAs de-scribed by Leppert and Kolakofsky (14). We unexpectedlydetected a new longer species of minus-strand leader RNA boundto the La protein. Interestingly, this longer transcript has a 3'nucleotide sequence similar to that at the 3' end of the plus-strand leader RNA. We have examined the kinetics of accu-mulation and subcellular localization of the La protein-associ-ated minus-strand leader RNA and propose that the La proteinbinds at a critical decision point for replication of full-lengthplus- and minus-strand RNAs.

MATERIALS AND METHODS

Cells and Viruses. Standard and defective particles of VSV'(Indiana) were grown in baby hamster kidney (BHK) spinnercells as described (15). All infections were done at a multiplicityof infection of 10 plaque-forming units/cell.

Isolation and Immunoprecipitation of Infected Cell RNA.Extracts were prepared according to the method of Lerner etal. (16) and as described (10).

Separation of Nucleus and Cytoplasm. The procedure usedwas a modification of the procedure of Weinberg and Penman(17) as described (4).

Isolation of the 3' Strand Probe of Defective-Interfering(DI) Stem RNA. RNA from purified LT2 defective particles (18)was prepared by lysis of the virus with 0.5% NaDodSO4 andphenol followed by purification of the 31S species on 10-30%sucrose/NaDodSO4 gradients (40,000 rpm for 3 hr in an SW 60

Abbreviations: VSV, vesicular stomatitis virus; RNP, ribonucleoprotein;DI,. defective-interfering; MSL-x, x-nucleotide-long minus-strand leader.* To whom reprint requests should be addressed.

5827

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertise-ment" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Janu

ary

27, 2

020

Proc. Nati. Acad. Sci. USA 80 (1983)

rotor). The RNA was taken up in 10 of 0.4 M NaCl/0. 1%NaDodSO4/0.O1 M-Tris-HCl, pH 7.4, and allowed to self-hv-bridize at 65TC for 1 hr. RNase'T1 was added to 5 units/ml andthe mixture was incubated at 370C for 30 min. Two microgramsof proteinase K was added and this mixture was incubated for20 min at 37TC. The RNA was phenol extracted, ethanol pre-

cipitated, and radiolabeled at its 3' end with cytidine 3,5'-bis([5'-32P]phosphate) and T4 RNA ligase as described (14). The RNAwas phenol extracted, ethanol precipitated, and suspended inloading buffer containing 8 M urea. The sample was heated at90TC for 1 min and electrophoresed on a 5% acrylamide/ureagel at 700 V for 3 hr. The band migrating at the position of about70 bases was excised and eluted to serve as a single-strandedprobe.

Labeled RNA probe derived from the hairpin-type DI par-

ticle (DI 011) was prepared similarly to the DI LT2 RNA exceptthat conditions for nicking were 5 units/ml of RNase T1 in a

total-vol of 0.1 ml in the presence of 60 Ag of tRNA. After 3'labeling, the nicked duplex was suspended in a loading buffercontaining 30% dimethyl sulfoxide, heated at 90TC for 2 min,and electrophoresed on a 5% nondenaturing acrylamide gel at

1,000 V for 10 min and then at 600 V for 18 hr to separate strands.The band specific for the 3' plus-sense strand was excised andeluted..Preparation of RNA Ladders. Terminally labeled DI 011

RNA was incubated at 100°C for 90 min in the presence of 99%formamide as-described (4).

Analysis of 'Minus-Strand Leader RNAs. Five to twentythousand cpm of single-strand 3' DI stem RNA and 20 ,ug oftRNA were added to infected cell RNA samples. The volumewas adjusted to 0.1 ml with 0.01 ,M TrisHCIl/0. 1% NaDodSO4,pH 7.4.. Samples were heated-at'90°C for 1 min, quick cooledon ice, adjusted to 0.6 M NaCl, and allowed to hybridize at 65°C'for 4 hr. Ribonuclease was.added to a final concentration of 10units of T1 and 10 ,g of A/ml and the mixture was incubatedat 37°C for 30 min. Two micrograms'of proteinase K was addedand this .mixture was incubated for 20 min at 37°C. Sampleswere phenol extracted, ethanol precipitated, denatured at 90°Cin 8 M urea loading buffer, and analyzed on acrylamide/ureagels.

RESULTSUnique Minus-Strand Leader RNA Is Bound to the La Pro-

tein. BH.K cells infected with plaque-purified VSV at a mul-tiplicity of 10 were disrupted and immunoprecipitated withvarious antisera from patients with systemic lupus ervthema-tosus according to the method of Lerner etal. (16). The RNPspecificities of lupus antisera for BHK cells have been reportedelsewhere (10). An autoradiogram obtained by probing im-munoprecipitates of RNA from infected cells for viral' RNAscontaining the 5' end of the minus strand is shown in Fig. 1.

The probe was derived by terminally labeling the 3' end of theRNA of DI LT2 (18), isolating the 70-base-long terminal duplex,and separating the strands. The probe, therefore, detectedcomplementary minus-strand RNAs from 70 to 12,000 nucleo-tides long as a band 70 nucleotides long after digestion withRNase Ti and A. Shorter RNA species representing the minus-strand leader RNAs of 45-48 bases, reported by Kolakofsky andco-workers (5), are shown in Fig. 1. These RNAs are similar tothe 45-nucleotide-long DI particle-product RNA synthesized invitro (19). In the lane containing total cell RNA, bands of 45,48, and 54 bases were detected in addition to minus-strand RNAslonger than 70 nucleotides (lane 4). These are abbreviated as

MSL-45, MSL-48, and MSL-54, respectively. Since the nu-

cleases used in the probing protocol fail to cleave at adenylateresidues, -MSL-48 represents any species 46-48 bases long, while

N

70

1 2 3 4 5 6 7 8 9 10

ll1Wt

54 :

48

45 -S

*35

FIG. 1. Immunoprecipitation of RNA from VSV-infected cells byantisera of various specificities. Samples of cells infected for 4 hr wereprepared, immunoprecipitated with antisera, and probed for VSV mi-nus strands. Lanes: 1, probe; 2, DI particle product marker; 3, ladder;4, total cell RNA; 5 and 7-9, lupus antisera of the La, Ro, RNP, and Smspecificities, respectively; 6, anti-VSV serum; 10, negative human serum.The ladder was generated by partial digestion of 3'-labeled defectiveparticle RNA (DI 011) and separated on 20% acrylamide gels as pre-viously described (15). N,.nucleotides.

MSL-54 is 53 or 54 bases long. This limitation in the-probingmethod was described previously (4).

Over the course of 12 separate experiments and-with variousprobing protocols, we have determined that the amounts of thethree leader RNAs in relation to one another are MSL-45/ MSL-48/MSL-54 = 5:2.5:1 (Table 1). In addition, these bands werestable over a 100-fold range of nuclease concentration (data notshown) and with RNA probes of various lengths (see below).When infected cell extracts -were immunoprecipitated with

lupus antisera (La, Ro, RNP, and Sm), only anti-La serum re-acted with minus-strand leader RNPS (Fig. 1). Small amountsof trapping by the immunoprecipitation occasionally-resultedin light background bands with-other antisera. Essentially all ofthe MSL-54 (greater than 95%) was bound to the La proteinwhile only 20-25% of the MSL-48 and 5% of the M.MSL-45 wereprecipitable. Identical patterns were obtained with La antisera

Table 1. Quantitation and protein association ofminus-sense RNAs

% each RNA precipitatedwith antiserum

Relative La Nucleocapsidamount protein protein

MSL-45 5.0 5 9MSL-48 2.5 20 6MSL-54 1.0 >95 7(-)42S 4.2 18 100

Values presented were compiled from several experiments as de-scribed in Fig. 2.

5828 Biochemistry: Wilusz et al.

Dow

nloa

ded

by g

uest

on

Janu

ary

27, 2

020

Proc. Natl. Acad. Sci. USA 80 (1983) 5829

from several-patients. La antisera were not reactive with phenol-extracted RNA and- no VSV-specific- proteins were found tocrossreact with the. La antisera (data not shown). In all im-munoprecipitates described here, samples were probed for thecontent of plus-strand leader RNA. Results of these probingswere identical. to those reported previously (10).

Samples of VSV-infected cells were also immunoprecipitatedwith a polyclonal rabbit antiserum directed against nucleocap-sid and other viral proteins. Unlike the plus-strand leader RNAassayed in these same samples (10), only 5-10% of each minus-strand leader RNA was precipitable (Fig. 1, lane 6). All of theintracellular. minus-strand viral RNAs longer than 70 bases are,however, complexed with the N protein (Table 1). This rep-resents minus-sense 42S RNA (see Fig. 2B), which has beenshown to be in a nucleocapsid. form (20).The relative amounts of minus-strand- leader RNAs 45, 48,

and 54 bases long in total cell RNA, anti-La-precipitated RNA,and anti-VSV-precipitated RNA are shown in Fig. 2A. Thesesamples were hybridized with increasing quantities of probe to.ensure the.presence of excess probe, and analvsis of severalsimilar experiments resulted in the d-ata.presented'in -Table -1.To test whether the 70-base-long probe-failed-to detect other

longer minus-strand leader RNAs, we prepared a single-strand.probe of 1,000 nucleotides. Fig. 2B. shows a probing-of anti-Laand anti-VSV precipitates by using a 1-kb plus-strand RNA probederived from DI 011. The patterns of anti-La- and anti-VSV-precipitable RNAs as well. as the ratios of each of the -minus-strand leader RNAs in each sample were.identical with. the 70-base- and the 1,000-base-long probes. The band'of about 65bases in the anti-La lane-was occasionally seen with probe only.and probably represents the secondary structure described pre-viously for this region (21).We conclude that a unique minus-strand leader RNA of 53

N

AT 1 2

B1 2

p-

or 54 nucleotides is bound at its 3' end to the cellular La pro-tein.. This La-bound RNA is a minority' species among the in-tracellular- minus-strand leader RNAs and only a small per-centage of all the-minus-strand leader RNAs were detected inassociation with the VSV- N protein.

Subcellular Localization of Minus-Strand Leader RNAs. Wereported previously that the- plus-strand leader RNA of VSVappears transiently in the nucleus of infected BiHK cells (4).More recently, we have found- that plus-strand leader RNA isalso bound to the La protein early in the infectious cycle (10).Because the La protein is presumed to be predominantly nu-clear (13), it seemed likely that the nuclear leader RNA wascomplexed with the La protein. Unexpectedly, the nuclear plus-strand leader RNA was not precipitable with La antisera. In-stead, nearly 98% of the cytoplasmic plus-strand leader RNAwas complexed with the La protein. ..

When nuclear and cytoplasmic extracts were similarly ana-lyzed using the protocols outlined in Figs. 1 and 2, no minus-strand leader RNAs were detected in nuclear extracts before orafter precipitation with anti-La sera (Fig. 3). Plus-strand leaderRNA was-present in these same extracts, however, as reportedpreviously (4, 10). Thus; the nuclear localization of plus-strandleader RNA does not appear to result from La protein-associ-ated.transport to the nucleus because MSL-54 also binds the-Laprotein and was not found in the nucleus: It is possible that se-quence differences between the plus- and minus-strand leaderRNAs account for the nuclear association. We cannot, however,rule out differences in rates of degradation..of nuclear leaderRNAs. The finding that all of; the detectable leader-La proteincomplexes are in the cytoplasm. is consistent witha role for theprotein. in- VSV replication; however, we (unpublished data) andothers (22) have found RNA polymerase III precursors asso-ciated with the La protein-in cytoplasmic fractions when usingseveral. different cell fractionation methods.Time of Appearance of La Protein-Bound Minus-Strand

Leader RNAs. Summers and-co-workers (23) have shown thatnucleocapsid production is maximal early in-the infectious cycleand does not- appear to increase progressively throughout thecycle. In another study (10), we have found that plus-strand leaderRNA binds to the. La protein as early as 1 hr after infection. At4-6 hr after infection, a crossover point occurred in which theLa protein-complexed plus-strand leader RNAs decreased rap-idly in relation to the number of N protein-bound plus-strandleader RNAs. By 16 hr after infection, La protein-bound plus-strand leader RNAs were barely detectable. Because the Laprotein bound plus-strand leader RNAs predominate during thetime of maximal viral replication, it was important to determine

A

N

B1 2 1 2

70 . 1

54

4%.YI

.#. Ij _-

FIG. 2. Quantitation of relative amounts of La protein-bound mi-nus-strand leader RNAs by the use of two probes. Infected-cell RNAfrom total (lane T.)-, anti-La (lanes 1)-, or anti-VSV (lanes 2)-precipi-tated extracts were probed by using DI LT2 RNA of 70 bases (A) or DI011 RNA of 1 kilobase (B) and analyzed on 5% acrylamide gels. N, nu-cleotides.

70

544845

FIG. 3. Intracellular localization of minus-strand leader RNAs. Fourhours after infection, cells were separated into nuclear (lanes 1) andcytoplasmic (lanes 2) fractions as described (4), directly phenol ex-tracted' or anti-La precipitated, and extracted and probed for minus-strand leaderRNAs. (A) Total cell RNA.' (B) Anti-La-precipitated RNA.N, nucleotides.

Biochemistry: Wilusz et al.

Dow

nloa

ded

by g

uest

on

Janu

ary

27, 2

020

Proc. Natl. Acad. Sci. USA 80 (1983)

1 2 3 4 5 6 7 8 with VSV proteins (data not shown). It was previously foundthat 100% of the plus-strand leader RNA was bound to N pro-tein at this time. From these findings, we conclude that the Laprotein binds to plus- and minus-strand leader RNA speciesduring the period of maximal VSV RNA replication. Significantdifferences between plus- and minus-strand leader RNAs withrespect to nuclear localization and N protein binding may re-flect separate, as yet unknown, functions of the leader RNAs.__

FIG. 4. Association of the La protein with VSV minus-strand leaderRNAs at various times after infection. Cells infected at a multiplicityof 10 were sonicated and immunoprecipitated with La antisera 1, 2, 3,4, and 16 hr later (lanes 1-5, respectively). RNAwas extracted and probedfor minus-strand leader RNAs by using the DI LT2 70-base-long probe.Lane 7, DI particle product marker. A4-hr sample was also precipitatedwith anti-VSV serum (lane 6). Lane 8, probe only. N, nucleotides.

whether the MSL-54-La protein complexes followed an anal-ogous pattern.An analysis of the MSL-54-La complex over the course of

the infection is shown in Fig. 4. The earliest detectable minus-strand leader RNA precipitable with La antisera appeared 2 hrafter infection. This is consistent with the requirement for priorsynthesis of antigenomic .42S RNA for minus-strand leader RNAproduction. The amount of La protein-bound minus-strand leaderRNA increased by 4 hr and then decreased only slightly by 16hr after infection. As discussed above, significant amounts ofminus-strand leader RNA bound to the nucleocapsid proteincould not be detected. At 16 hr after infection, less than 20%of the minus-strand leader RNAs were detected in association

DISCUSSIONWe have found that the mammalian cell La protein that is boundto RNA products of RNA polymerase III is also bound to a shortminus-sense transcript of VSV. Similar minus-sense leader RNAsthat are about eight nucleotides shorter were not found to as-

sociate with the La protein. Thus, the nucleotide sequence atthe 3' end-of MSL-54 plays a significant role in recognition or

binding of the La protein As shown in Fig. 5, the sequence inthis region is similar to that found at the 3' end of the VSV plus-strand leader RNA. Both leader RNAs are synthesized from theterminal noncoding regions of the VSV genome. Plus-strandleader RNA is generated from the 3' end of the minus strandand represents the entire noncoding region up to the start ofthe N protein gene. Minus-strand leader RNA is generated fromthe 3' end of the replicative full-length plus strand and rep-

resents most of the noncoding 59-base sequence up to the endof the L protein gene polyadenylylation site. The portion of the5' noncoding region of the genome between positions 48 and59 has not previously been found in any VSV transcript.

The function of the VSV leader RNAs is not known. Syn-thesis of the plus-strand leader RNA precedes synthesis of thefive VSV mRNAs. The minus-strand leader RNAs appear to bethe only products synthesized from the full-length plus strandother than the full-length minus strand.. One possible functionof the leader RNAs may involve early decision points in rep-lication. Kolakofsky and co-workers (24) have presented evi-dence that the plus-strand leader RNA contains a nucleationsite for binding of the nucleocapsid (N) protein. Binding of the

a

j50o N |NS | M | G | Li~~~~~~~~~~~~

b'-5' APpACGAA6ACAAACAAACCAUUAUUAUCAUUAAAA66CUCA66A6;AAACtJQJU)-o

d 5' PP ACGAAGACCAC.AAAACCAGAUAAAAAAUAAAAACCACAA6&A6GUCUUAAG6AU-OH5' PPPACGAAGACCACAAAACCAGAUAAAAAAUAAAAACCACAAGA6GGUC-oH

I _

I

a

I3'59

FIG. 5. Nucleotide sequences of the-VSV minus-strand leader RNAs of 45,48, and 54 bases [shown as 46 because the probing method does notdiscriminate adenylates in the probe (4)]. The regions of sequence homology that may be involved in La protein binding at the 3' ends of the plus-and minus-strand leader RNA species are shaded. a, Minus-strand genome; b, plus-strand leader; c, MSL- 54; d, MSL-46 (45/48); e, plus-strandreplicative intermediate.

N

70

54

4845

55830 Biochemistry: Wilusz et al.

"51

Dow

nloa

ded

by g

uest

on

Janu

ary

27, 2

020

Proc. Natl. Acad. Sci. USA 80 (1983) 5831

N protein to the leader RNA is proposed to result in a switchfrom transcription to replication as the plus-'s'trand nucleocapsidis assembled (5). The finding reported here that the RNA-bind-ing La protein interacts at a related sequence near the 3' endof the plus- and minus-strand leader RNAs implicates this pro-tein in VSV replication. However, there is currently no directevidence that the La protein is involved in the VSV replicationcycle. Several lines of evidence suggest that host factors in-teract with the VSV RNA polymerase. Host range viral mutantshave been described that are altered in polymerase tempera-ture sensitivity in BHK-21 and chicken embryo cells (6). In ad-dition, these mutants show temperature sensitivity of growthduring differentiation of murine embryonal carcinoma cells inculture. Other studies have shown that extracts from unin-fected L cells can stimulate viral transcription in vitro (7, 8).Recent work in our laboratory has shown that uninfected BHKcell extracts can suppress the synthesis of short internally in-itiated RNAs during in vitro transcription with isolated viralribonucleocapsids (ref. 9; unpublished data). The specificity ofinteraction of these host cell factors has not been reported. Thedata presented here show that binding of the La protein to theminus-strand leader RNA is sequence specific. However, it ispossible that the binding of the La protein to the 3' ends of theplus- and minus-strand leader RNAs has no influence on VSVreplication but only results by coincidence. The similarity ofthe leader RNAs to RNA polymerase III transcripts might berelated to interaction with the La protein. The presence of a 5'triphosphate and the size of the RNA are not sufficient for bind-ing, however, because MSL-45 and MSL-48 are not stronglybound to the La protein. Whether or not the La protein is in-volved in VSV replication, it has brought to our attention animportant sequence relationship at the 3' end of plus- and mi-nus-strand leader RNAs that is probably central to the viral rep-lication cycle (Fig. 5).

Several functions for the La protein in VSV replication arepossible. (i) The La protein may serve as an in vivo transcriptionattenuator to aid in release of the transcript and to ensure thatadequate levels of viral protein accumulate before the switchto replication takes place. Displacement of the La protein onplus-strand leader RNA by the N protein is consistent with thispossibility (10). As reported here, however, replacement of theLa protein on MSL-54 by the N protein late in the infectiouscycle was not observed (Fig. 4). It is important to note that,because of the indirect measure of leader RNAs by nucleaseprobing, we cannot measure the extent of turnover of any ofthese RNA species. (ii) The La protein is bound in the ceil toprecursor RNAs synthesized by RNA polymerase III. It mayfunction as a transcription faictor or it may have a role in RNAprocessing (11). A processing model for VSV transcription hasbeen proposed but the evidence favoring this mechanism islimited (1, 25). If the La protein is a processing enzyme or tagsRNA precursors for processing in the cell, VSV may have adaptedthis function for mRNA synthesis. It is, however, unlikely thatthe La protein is a processing enzyme or transcription factor forVSV transcription unless it is associated with packaged virions

because VSV transcripts are synthesized in vitro.The finding of plus-strand leader RNA in nuclear fractions

and our inability to detect minus-strand leader RNAs in the samefractions suggests that the La protein is not responsible for leaderRNA transport to the nucleus. In addition, plus-strand leaderRNA has been implicated in the shutoff of host macromolecularsynthesis (2, 3). It will be important to determine whether Laprotein-bound leader RNAs or plus-strand nuclear leader RNAsare involved in the inhibition of host RNA or protein synthesis.

We thank Gale McCarty and Marylou Bembe for providing antisera,J. Steitz for providing preprints of her unpublished work, and S. Ship-man for typing the manuscript. This work was supported by U. S. PublicHealth Service Grant P01 CA30246. J.W. is the recipient of a pre-doctoral fellowship from the National Science Foundation, and M. G. K.was supported by Medical Scientist Training Grant GM07171. J. D. K.is the recipient of a Faculty Research Award from the American CancerSociety and a Nanaline Duke Faculty Scholarship.

1. Banerjee, A. K., Abraham, G. & Colonno, R. J. (1977)J. Gen. Vi-rol. 34, 1-8.

2. McGowan, J. J., Emerson, S. U. & Wagner, R. R. (1982) Cell 28,325-333.

3. McGowan, J. J. & Wagner, R. R. (1981)J. Virol. 38, 356-367.4. Kurilla, M. G., Piwnica-Worms, H. & Keene, J. D. (1982) Proc.

Nati. Acad. Sci. USA 79, 5240-5244.5. Leppert, M., Rittenhouse, L., Perrault, J., Summers, D. F. &

Kolakofsky, D. (1979) Cell 18, 735-747.6. Pringle, C. R. (1978) Cell 15, 597-606.7. Szilagyi, J. F. & Pringle, C. R. (1975)J. Virol. 16, 927-936.8. Ball, L. A. & White, C. N. (1978) Virology 84, 479-495.9. Piwnica-Worms, H. & Keene, J. D. (1983) Virology 125, 206-218.

10. Kurilla, M. G. & Keene, J. D. (1983) Cell, in press.11. Rinke, J. & Steitz, J. A. (1982) Cell 29, 149-159.12. Rosa, M. D., Gottlieb, E., Lerner, M. R. & Steitz, J. A. (1981)

Mol. Cell. Biol. 1, 785-796.13. Hendrick, J. P., Wolin, S. L., Rinke, J., Lerner, M. R. & Steitz,

J. A. (1981) Mol. Cell. Biol. 1, 1138-1149.14. Leppert, M. & Kolakofsky, D. (1980)J. Virol. 35, 704-709.15. Keene, J. D., Schubert, M., Lazzarini, R. A. & Rosenberg, M.

(1978) Proc. Natl. Acad. Sci. USA 75, 3225-3229.16. Lerner, M. R., Andrews, N. C., Miller, G. & Steitz, J. A. (1981)

Proc. Natl. Acad. Sci. USA 78, 805-809.17. Weinberg, R. A. & Penman, S. (1968) J. Mol. Biol. 38, 289-304.18. Keene, J. D., Lazzarini, R. A. & Chien, I. M. (1981) Proc. Natl.

Acad. Sci. USA 78, 2090-2094.19. Emerson, S. U., Dierks, P. M. & Parsons, J. T. (1977)1. Virol. 23,

708-716.20. Soria, M., Little, S. P. & Huang, A. S. (1974) Virology 61, 270-

280.21. Schubert, M., Keene, J. D., Herman, R. C. & Lazzarini, R. A.

(1980)J. Virol. 34, 550-559.22. Hashimoto, C. & Steitz, J. A. (1983) J. Biol. Chem. 258, 1379-1382.23. Simonsen, C. C., Batt-Humphries, S. & Summers, D. F. (1979)

J. Virol. 31, 124-132.24. Blumberg, B. M., Giorgi, C. & Kolakofsky, D. (1983) Cell 32, 559-

567.25. Lazzarini, R. A., Schubert, M. & Chien, I. M. (1981) in The Rep-

lication of Negative Strand Viruses, eds. Bishop, D. H. L. &Compans, R. W. (Elsevier/North-Holland, New York), pp. 749-757.

Biochemistry: Wilusz et al.

Dow

nloa

ded

by g

uest

on

Janu

ary

27, 2

020