Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
1
Applied and Environmental Microbiology (17-May-12) 1
Manuscript for review (Original paper) 2
3
A Gene-Targeting System for Pleurotus ostreatus: Demonstrating the 4
Predominance of Versatile-Peroxidase (mnp4) by Gene Replacement 5
6
Tomer M. Salame, Doriv Knop, Dana Tal, Dana Levinson, Oded Yarden, and 7
Yitzhak Hadar* 8
9
Department of Plant Pathology and Microbiology, The Robert H. Smith Faculty of 10
Agriculture, Food and Environment, The Hebrew University of Jerusalem, Rehovot 11
76100, Israel 12
13
*For correspondence: E-mail:[email protected]; 14
Tel. (+972) 8 948 9935; Fax (+972) 8 946 8785. 15
16
Running title: KU IN PLEUROTUS: INACTIVATION OF VERSATILE-17
PEROXIDASE 18
19
20
21
22
23
Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.01234-12 AEM Accepts, published online ahead of print on 25 May 2012
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
2
ABSTRACT 24
Pleurotus ostreatus (the oyster mushroom) and other white-rot filamentous 25
basidiomycetes are key players in the global carbon cycle. P. ostreatus is also a 26
commercially important edible fungus with medicinal properties, and important for 27
biotechnological and environmental applications. Efficient gene targeting via 28
homologous recombination (HR) is a fundamental tool for facilitating 29
comprehensive gene function studies. Since the natural HR frequency in Pleurotus 30
transformations is low (2.3%), transformed DNA is predominantly integrated 31
ectopically. To overcome this limitation, a general gene-targeting system was 32
developed by producing a P. ostreatus PC9 homokaryon Δku80 strain, using 33
carboxin resistance complemented by the development of a protocol for hygromycin 34
B resistance protoplast-based DNA transformation and homokaryon isolation. The 35
Δku80 strain exhibited exclusive (100%) HR in the integration of transforming 36
DNA, providing high efficiency of gene targeting. Furthermore, the Δku80 strains 37
produced showed a phenotype similar to the wild-type PC9 strain, with similar 38
growth fitness, ligninolytic functionality and capability of mating with the 39
incompatible strain PC15 to produce a dikaryon which retained its resistance to the 40
corresponding selection and was capable of producing typical fruiting bodies. The 41
applicability of this system is demonstrated by inactivation of the versatile-42
peroxidase (VP) encoded by mnp4. This enzyme is part of the ligninolytic system of 43
P. ostreatus, being one of the nine members of manganese-peroxidase (MnP) gene 44
family, and is the predominantly expressed VP in Mn2+-deficient media. mnp4 45
inactivation provided a direct proof that it encodes a key VP responsible for the 46
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
3
Mn2+-dependent and Mn2+-independent peroxidase activity under Mn2+-deficient 47
culture conditions. 48
49
Keywords 50
Homologous recombination; Gene replacement; Knockout; Transformation; Ku; 51
Nonhomologous end joining (NHEJ); Hygromycin B resistance; Carboxin resistance; 52
Manganese-Peroxidase (MnP); Versatile-Peroxidase (VP); Lignin 53
54
INTRODUCTION 55
The genus Pleurotus comprises a group of edible ligninolytic mushrooms with 56
medicinal properties and important biotechnological and environmental applications (2). 57
The cultivation of Pleurotus spp., which has expanded in the past few years, is gaining 58
worldwide economic importance for the food industry. Pleurotus ostreatus (the oyster 59
mushroom) ranks second in the world market of industrially produced mushrooms. 60
Nutritionally, it has a unique flavor and aromatic properties and it is considered to be rich 61
in protein, fiber, carbohydrates, vitamins and minerals. Pleurotus spp. produce various 62
bioactive secondary metabolites which are of medical interest, exhibiting hematological, 63
antiviral, antitumor, antibiotic, antibacterial, hypocholesterolemic and 64
immunomodulatory activities (34). Pleurotus is a saprophyte in the wild, where it grows 65
readily on a variety of organic substrates as a decomposer, playing a key role in the 66
global carbon cycle. As a white-rot basidiomycete, one of the most important applied 67
aspects of Pleurotus spp. is related to the use of their ligninolytic system for the 68
bioconversion of woody materials and agricultural wastes into valuable products for 69
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
4
animal feed and other food products, as well as for the biodegradation of 70
organopollutants, xenobiotics and industrial contaminants (2, 34, 37). 71
Until recently, genetic manipulation and breeding of this organism was restricted 72
by a lack of knowledge about its genomic structure. In 2009, the complete genome 73
sequence of P. ostreatus was released by JGI (United States Department of Energy, 74
Office of Science, Joint Genome Institute; http://genome.jgi-psf.org (8)), providing a 75
comprehensive map for the design of gene function analyses. Identification of the genetic 76
basis of Pleurotus substrate colonization and fruiting induction would help expand the 77
range of agricultural wastes amenable to conversion using this fungus and might also 78
help improve the production of bioactive compounds. In addition, a number of 79
quantitative trait loci controlling growth rate (22), industrial quality and productivity have 80
been identified, and genomic studies would enable analysis of these genes' structures and 81
mechanisms of function. 82
The ability to manipulate P. ostreatus gene expression is an invaluable tool for the 83
dissection of gene functionality in this fungus. Honda and co-workers (13, 14) developed 84
a protoplast-based polyethylene glycol and calcium salt (PEG-CaCl2)-mediated method 85
for transformation and recombinant gene expression in P. ostreatus, based on the 86
homologous drug-resistant marker cassette Cbxr, which confers dominant resistance to 87
the systemic fungicide carboxin. This system has since been used for the homologous 88
expression of recombinant Mn2+-dependent peroxidase (mnp3) and versatile-peroxidase 89
(mnp2) genes (15, 39). However, homologous recombination (HR) has been shown to 90
occur only rarely, making gene-knockout studies difficult (13–16, 31). 91
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
5
Considering this limitation, we implemented a reverse-genetics strategy based on 92
gene silencing by RNA interference (RNAi). Knockdown of mnp3, one of the nine genes 93
comprising the mnp gene family, provided direct evidence for this family's relevance to 94
the functionality of the P. ostreatus ligninolytic system. Nevertheless, silencing via this 95
approach also resulted in ‘off-target’ effects on the expression of other mnp genes, which 96
limited the ability to pinpoint the relevance of a single gene (31, 32). Addressing this 97
question directly would require the production of specific homokaryon mnp-knockout 98
strains. 99
The availability of the genome sequence and the fact that the fungus is amenable 100
to genetic modifications make P. ostreatus accessible for comprehensive functional 101
genomics studies. To do so in a specific manner, HR of the transforming DNA is required 102
for gene-targeted procedures such as gene disruption and gene replacement. However, 103
DNA integration in filamentous fungi in general, and in Pleurotus in particular, is mainly 104
driven by nonhomologous end joining (NHEJ), resulting in ectopic integration of the 105
transformed DNA, and only a low frequency (0.1-5%) of site-specific recombination 106
(13–16, 20, 26, 31). Furthermore, the current Pleurotus protoplast-based DNA 107
transformation protocols are cumbersome, and at best produce only a few dozen 108
transformants per transformation (13–16, 31). To overcome this limitation, a general 109
gene-targeting system, with high rates of HR, is necessary to allow effective analysis of 110
gene function. 111
The most common approach to creating an efficient gene-targeting system in 112
filamentous fungi is to generate mutant strains impaired in their NHEJ mechanism. 113
Ku70/Ku80 is a DNA-binding heterodimer that forms a multiprotein complex with the 114
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
6
DNA-dependent protein kinase (DNA-PKcs), the DNA ligase IV-XRCC4 complex and 115
the exonuclease Artemis, thereby activating the NHEJ pathway. The NHEJ pathway has 116
been successfully impaired in a large number of filamentous fungi via disruption of either 117
ku70 or ku80 homologs. To date, ku-disruption strains from more than 20 different 118
species (a majority of which are Ascomycetes) have been generated, showing 119
significantly increased homologous recombination frequency (between 50% and 100%) 120
(4, 20, 24–26, 38). 121
This report describes the production and characterization of a P. ostreatus PC9 122
homokaryon Δku80 strain, using carboxin-resistance and hygromycin B-resistance as 123
dominant selectable markers. This strain exclusively exhibits HR during the integration 124
of transforming DNA, thus providing high-efficiency gene targeting when used as a 125
background strain for transformation. The applicability of this system is demonstrated by 126
inactivation of the versatile-peroxidase (VP) encoding gene mnp4. 127
128
MATERIALS AND METHODS 129
Fungal and bacterial strains and growth conditions. Pleurotus ostreatus 130
monokaryon strain PC9 (Spanish Type Culture Collection accession number 131
CECT20311), which is a protoclone derived by dedikaryotization of the commercial 132
dikaryon strain N001 (Spanish Type Culture Collection accession number CECT20600), 133
was used throughout this study (23). In addition, the corresponding incompatible 134
monokaryon strain PC15 (Spanish Type Culture Collection accession number 135
CECT20312) was used in mating trials. Fungal strains were grown and maintained in 136
YMG medium [1% w/v glucose, 1% w/v malt extract (Difco), 0.4% w/v yeast extract 137
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
7
(Difco)] (14) or GP medium [2% w/v glucose, 0.5% w/v peptone (Difco), 0.2% yeast 138
extract (Difco), 0.1% w/v K2HPO4, 0.05% w/v MgSO4·7H2O]; Mn2+ was added as 139
MnSO4 as specified (15, 31). When required, 1.5% (w/v) agar was added to the 140
appropriate medium. Liquid cultures were maintained in stationary 100-ml Erlenmeyer 141
flasks containing 10 ml media. Cultures were incubated at 28°C in the dark. The 142
inoculum for all growth conditions was one disk (5 mm diameter) of mycelium obtained 143
from the edge of a freshly grown colony in solid culture and positioned at the center of 144
the Petri dish or flask. The azo dye Orange II [4-(2-hydroxy-1-145
naphthylazo)benzenesulfonic acid sodium salt], fungicide carboxin (Sigma-Aldrich) and 146
antibiotic hygromycin B (Alexis Biochemicals) were added to a final concentration of 147
100 mg/l, 2 mg/l (LD50 = 0.16 mg/l) and 100 mg/l (LD50 = 7 mg/l), respectively, as 148
specified. The selective compounds nourseothricin (Werner BioAgents), 149
phosphinothricin, neomycin (Sigma-Aldrich), phleomycin and zeocin (InvivoGen) were 150
added as specified. Escherichia coli JM109 cells (Promega) were used for standard 151
cloning procedures according to the manufacturer's protocol. 152
Nucleic acid manipulation and analyses. Molecular manipulations were carried 153
out on the basis of standard protocols as described by Sambrook et al. (33). Genomic 154
DNA was extracted from culture biomass first ground with dry ice in a Cryogenic Tissue 155
Grinder (BioSpec Products), and with the DNeasy Plant Mini Kit (Qiagen). PCR was 156
performed in an Eppendorf Mastercycler Gradient Thermocycler using Phusion High-157
Fidelity PCR Master Mix (Finnzymes), with the primers detailed in Table 1. Isolation and 158
purification of DNA fragments from agarose gel or PCR amplification was performed 159
using the Wizard SV Gel and PCR Clean-Up System (Promega). Cloning into plasmids 160
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
8
was performed using the pGEM-T Vector System II (Promega). Plasmid DNA was 161
purified using the QIAprep Spin Miniprep Kit (Qiagen). DNA endonuclease restriction 162
was performed with restriction enzymes from Fermentas. DIG-labeled DNA probes were 163
used for Southern blotting (Fig. 1, Table 1) according to the DIG system procedures 164
(Roche Applied Science). Total RNA was extracted from culture biomass first ground 165
with dry ice in a Cryogenic Tissue Grinder, then homogenized with QIA shredder spin 166
columns (Qiagen) and RNA was purified from the lysate using the RNeasy Plus Mini Kit 167
(Qiagen). cDNA was synthesized using SuperScript III First-Strand Synthesis System for 168
RT-PCR (Invitrogen). Comparative gene expression was evaluated by semi-quantitative 169
reverse transcription PCR (RT-PCR) with the primers detailed in Table 1. DNA 170
fragments, plasmid inserts and RT-PCR amplicons were fully sequenced at the Center for 171
Genomic Technologies of the Hebrew University of Jerusalem. 172
Construction of transforming DNA: ku80-replacement cassettes. The flanking 173
DNA (2 kb 5' and 3') of ku80 was amplified from genomic DNA, and the carboxin-174
resistance cassette (Cbxr) from plasmid pTM1 (13), using primers ku80PF and cbxF-175
ku80PR, cbxR-ku80TF and ku80TR, and ku80PR-cbxF and ku80TF-cbxR, for the 5' 176
flank, 3' flank and Cbxr cassette, respectively (Table 1). The resulting amplicons were 177
fused together using the double-joint (fusion) PCR technique (26, 42) to produce a ku80-178
replacement cassette (TMS6), which was cloned to produce plasmid pTMS6 (Fig. 1A). 179
The flanking DNA (2 kb 5' and 3') of ku80 and a 1.7-kb fragment comprising the 180
promoter region of the β-tubulin gene (3, 31) were amplified from genomic DNA, and the 181
hygromycin B-resistance gene (hph) coding sequence (CDS) from plasmid pCSN44 (36), 182
using primers ku80PF and btubPF-ku80PR, hygR-ku80TF and ku80TR, ku80PR-btubPF 183
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
9
and hygF-btubPR, and btubPR-hygF and ku80TF-hygR for the 5' flank, 3' flank, β-184
tubulin promoter and hph CDS, respectively (Table 1). The resulting amplicons were 185
fused together using the double-joint PCR technique to produce a ku80-replacement 186
cassette (TMS14), which was cloned to produce plasmid pTMS14 (Fig. 2A). The fusion 187
between the β-tubulin promoter and the hph CDS was designated hygromycin B-188
resistance cassette (Hygr) (Fig. 2A). The flanking DNA (2 kb 5' and 3') of mnp4 (3, 30, 189
31) were amplified from genomic DNA, and the Hygr cassette from plasmid pTMS14, 190
using primers mnp4PF and hygF-mnp4PR, hygR-mnp4TF and mnp4TR, mnp4PR-hygF 191
and mnp4TF-hygR for the 5' flank, 3' flank and Hygr, respectively (Table 1). The 192
resulting amplicons were fused together using the double-joint PCR technique to produce 193
a mnp4-replacement cassette (TMS10), which was cloned to produce plasmid pTMS10 194
(Fig. 3A). 195
Fungal transformation. Transformation was performed based on the PEG-CaCl2 196
protocol previously adapted for P. ostreatus (13, 14, 31). Either carboxin or hygromycin 197
B were used as selection markers, and resistance was conferred via introduction of the 198
carboxin-resistance cassette (Cbxr) (Fig. 1A) or the hygromycin B-resistance cassette 199
(Hygr) (Fig. 2A, Fig. 3A). Competent protoplasts were produced by digestion of 200
vegetative mycelium of P. ostreatus from YMG liquid culture with lytic enzymes. The 201
lytic enzyme solution consisted of 2% (w/v) Lysing enzymes from Trichoderma 202
harzianum (Sigma-Aldrich, product number L1412) and 0.05% (w/v) Chitinase from 203
Trichoderma viride (Sigma-Aldrich, product number C8241) in 0.5 M sucrose as an 204
osmotic stabilizer. The protoplasts were washed (by centrifugation at 450g, 8 min, 4°C) 205
in STC solution (18.2% w/v sorbitol, 50 mM Tris-HCl pH 8.0, 50 mM CaCl2, 0.5 M 206
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
10
sucrose), and adjusted to a final concentration of 5 × 107 protoplasts/ml. Then, 2 ml 207
protoplasts was mixed with 100 µl transforming DNA (300 ng/µl), 150 µl heparin 208
solution (Sigma-Aldrich) (5 mg dissolved in 1 ml STC solution), and 300 µl single-strand 209
λ phage carrier DNA (Fermentas) (500 µg/ml, after denaturation at 95°C for 5 min and 210
immediate transfer to ice). After 40 min of incubation on ice, 10 ml PTC solution (40% 211
w/v PEG#4000, 50 mM Tris-HCl pH 8.0, 50 mM CaCl2, 0.5 M sucrose) was added, and 212
the mixture was incubated for 20 min at room temperature. For transformation performed 213
using carboxin selection, the mixture was then plated on selective solid YMG 214
regeneration medium, containing 0.5 M sucrose and carboxin at a final concentration of 2 215
mg/l. For transformation performed using hygromycin B selection, the mixture was 216
plated on solid YMG regeneration medium containing 0.5 M sucrose, and left to 217
regenerate overnight. Subsequently a medium overlay containing hygromycin B was 218
applied, obtaining a final concentration of 150 mg/l. Transformants were isolated after 10 219
days of incubation at 28°C. Transformant stability was verified by three successive 220
transfers (inoculated from the edge of a 10-day-old colony) to solid medium without the 221
selection drug, and then returning the transformant to solid culture conditions in which 222
the selective drug was present. 223
Phenotypic characterization. Culture biomass production was measured as dry 224
weight (oven-dried to constant weight at 65°C) in liquid YMG. Mycelial linear growth 225
rate was determined by measuring the position of the advancing mycelial front (leading 226
hyphae) in solid YMG culture. Laccase and Mn2+-peroxidase (MnP) activities were 227
measured in liquid GP culture amended with 27 µM of Mn2+, whereas versatile-228
peroxidase (VP) activity was measured in Mn2+-deficient culture, after filtration of the 229
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
11
culture fluids through GF/A glass microfiber filter paper (Whatman) and treatment with 230
cOmplete, EDTA-free Protease Inhibitor Cocktail Tablets (Roche) according to the 231
manufacturer's instructions. Enzyme assays were carried out according to Grinhut et al. 232
(9). Briefly, enzymatic activity assays were conducted in a 1-ml cuvette at 35°C, using a 233
BioMate 3 spectrophotometer (Thermo Spectronic). Laccase activity was determined 234
using 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS) (Sigma-Aldrich) as 235
the substrate. Oxidation of ABTS was measured by monitoring absorbance at 436 nm 236
(A436) (ε = 29.3 mM−1 cm−1). The reaction mixture contained 0.5 mM ABTS and 100 mM 237
citrate buffer (pH 3.0). MnP and VP activities were determined using phenol red (Sigma-238
Aldrich) as the substrate. Oxidation of phenol red was measured by monitoring the A610 (ε 239
= 22.0 mM−1 cm−1). The reaction mixture contained 0.1 mM MnSO4, 0.1 mM H2O2, 240
0.01% (w/v) phenol red, 25 mM lactate, 0.1% (w/v) bovine serum albumin, 20 mM 241
sodium succinate buffer (pH 4.5), and after incubation, 80 mM NaOH. Activity in the 242
absence of either MnSO4, H2O2 or both, was measured to establish specific peroxidase 243
activity. One unit (U) of enzymatic activity was defined as the amount of enzyme that 244
catalyzes the formation of 1.0 μmol of product per minute per milliliter of culture filtrate. 245
Enzyme activities are expressed as units per milligram of culture biomass. The assays 246
were performed in at least three technical replicates. Orange II decolorization capacity 247
was estimated in GP cultures amended with Orange II. In solid culture, this was based on 248
the visually decolorized area, as measured from the center of the inoculation point. In 249
liquid culture, 200 µl media were centrifuged (4720g, 10 min, room temperature) and 250
mixed with 800 µl phosphate buffer (0.1 M, pH 7.0), and the Orange II concentration in 251
the media was quantified according to the absorption reading of the solution at λmax 483 252
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
12
nm, using a BioMate 3 spectrophotometer according to a standard curve. Noninoculated 253
medium amended with Orange II was used as a control (31). Mating trials were 254
performed by inoculating the tested strain and PC15, placed 4 cm apart in a Petri dish 255
containing solid YMG medium. The plate was then incubated at 28°C in the dark for 256
approximately 14 days, until the two mycelia formed a large contact zone. A piece of 257
mycelium was cut from the contact zone, placed on a new culture plate, allowed to grow 258
for 7 days, and its morphology examined under the microscope for the presence or 259
absence of true clamp connections indicating dikaryons or monokaryons, respectively 260
(21, 23). In vitro production of fruiting bodies was evaluated by subjecting the cultures to 261
a photoperiod regime of 12 h light/12 h dark, and incubating at 28°C (1). Light and 262
fluorescence microscopy were performed with a Zeiss Axioscope microscope equipped 263
with a Nikon DXM1200F digital camera. For calcofluor white staining, samples were 264
treated with a solution of 10 µg/ml calcofluor (Sigma-Aldrich) prior to observation by 265
fluorescence microscopy using the appropriate filter (excitation, 395 to 440 nm, and 266
emission, 470 nm) (5). 267
268
RESULTS 269
Production and characterization of P. ostreatus PC9 homokaryon strain 270
Δku80. To create an efficient gene-targeting system in P. ostreatus, HR frequency in the 271
PC9 strain had to be enhanced (Table 2). The NHEJ pathway was therefore inactivated 272
by disrupting the P. ostreatus ku80 gene homolog. 273
The P. ostreatus PC9 genome database was searched to identify the Ku70 and 274
Ku80 homologs, using BLASTP analysis against Neurospora crassa Mus-51 and Mus-52 275
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
13
proteins, respectively (26). The candidate P. ostreatus genes encoding the predicted Ku70 276
and Ku80 homologs, JGI genome (PC9 v1.0) protein IDs 86980 and 85252, respectively, 277
were both determined as single hits against Mus-51 and Mus-52, respectively 278
(http://genome.jgi-psf.org/PleosPC9_1/PleosPC9_1.home.html). 279
A gene-replacement cassette targeted at HR with ku80 CDS, from its translation 280
start site (ATG) to stop site (TAG), was constructed by fusing the carboxin-resistance 281
cassette (Cbxr) (13) to 2 kb 5' and 3' DNA flanking ku80, to produce TMS6, which was 282
also cloned to produce plasmid pTMS6 (see Materials and Methods, Fig. 1A). Both the 283
plasmid (pTMS6) and the linear cassette (TMS6, PCR product) were used, separately, for 284
transformation of the wild-type PC9 strain (Fig. 1A), and carboxin-resistant colonies 285
were isolated. 286
About 1000 transformants (collected from four independent transformation 287
experiments) were subcultured, and genomic DNA was extracted from about 300 288
transformants to determine, by PCR, whether ku80 had been replaced by the Cbxr 289
cassette. Primers in this PCR were designed to positions outside the targeted gene, ku80, 290
and inside the Cbxr cassette (see Recombination probe in Fig. 1A, representative PCR 291
results in Fig. 1B and primers in Table 1). Seven carboxin-resistant transformants 292
contained the Cbxr cassette replacing ku80 (Fig. 1B), equal to 2.3% HR frequency in the 293
wild-type PC9 strain background (Table 2). 294
Next, these seven transformants were screened for the presence of 295
nontransformed nuclei (indicative of being heterokaryons) by PCR with primers 296
amplifying a region within the ku80 CDS which was targeted for replacement by the Cbxr 297
cassette (see Homokaryon probe in Fig. 1A, representative PCR results in Fig. 1C and 298
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
14
primers in Table 1). Three of the seven transformants were found to be homokaryons in 299
which HR had occurred at the ku80 locus (Table 2). From this point on, these 300
transformants were grown without antibiotic selection. 301
After subculturing at least three times, DNA was extracted from the homokaryon 302
strains and screened by Southern blot hybridization analysis to confirm the absence of 303
ectopic integrations of the transformation cassette. Genomic DNA was digested with 304
either BglII, EcoNI or StyI and probed with a DIG-labeled DNA probe corresponding to 305
the Southern probe amplicon (see Southern probe in Fig. 1A and primers in Table 1). A 306
distinctive pattern of bands for either BglII, EcoNI or StyI, of 7195, 8118, 2537 and 4146, 307
2227, 3059 bp was produced from the wild-type PC9 strain and the Δku80 strains, 308
respectively. This analysis confirmed that ku80 replacement was the result of a single 309
integration event in all three transformants (Table 2). These analyses also confirmed that 310
both the plasmid (pTMS6) and the linear cassette (TMS6) used for transformation 311
produce Δku80 homokaryon strains without ectopic integrations. 312
One of these transformants, designated 20b (isolated from transformation with the 313
linear TMS6 cassette), was chosen for further work and designated P. ostreatus PC9 314
homokaryon Δku80 strain. Several phenotypic traits were analyzed. Strain 20b produced 315
a biomass similar to that of the wild-type PC9 strain, showed a comparable linear growth 316
rate and ligninolytic functionality (as evaluated by laccase activity, Mn2+-peroxidase 317
activity and Orange II decolorization capacity), and was capable of mating with the 318
incompatible strain PC15 to produce a dikaryon mycelium which was resistant to 319
carboxin and produced typical fruiting bodies (Table 3). 320
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
15
Screening for a second dominant selectable marker. To implement use of the 321
carboxin-resistant P. ostreatus PC9 homokaryon Δku80 strain 20b as the background 322
strain for a successive transformation step, a transformation procedure with a second 323
dominant selectable marker had to be developed. We tested P. ostreatus for sensitivity to 324
several common selectable agents by plating nontransformed protoplasts on solid YMG 325
medium containing 0.5 M sucrose as an osmotic stabilizer, which was then overlaid with 326
the same medium amended with the different drugs. The tested compounds were 327
nourseothricin, phosphinothricin, neomycin, phleomycin, zeocin and hygromycin B (40), 328
at final concentrations of 0 to 1000 mg/l. After 10 days of incubation, background 329
colonies emerged in all treatments, except when ≥100 mg/l hygromycin B was present in 330
the medium. Therefore, hygromycin B was chosen as a selection compound for further 331
testing. 332
Development of a hygromycin B dominant resistance selective marker 333
transformation system. To introduce hygromycin B resistance into P. ostreatus, the 334
CDS of the hygromycin B-resistance gene hph from E. coli (10, 27) was cloned and fused 335
to the promoter and terminator regions of either the Lentinus edodes glyceraldehyde-3-336
phosphate dehydrogenase (gpd) (12, 16) or P. ostreatus iron-sulfur protein subunit of 337
succinate dehydrogenase (sdi1, which was also used to drive the Cbxr cassette; data not 338
shown) gene in a manner similar to the construction of the carboxin-resistance ku80-339
replacement cassette (TMS6, Fig. 1). None of these cassettes, following introduction into 340
the fungus, were successful in producing stable hygromycin B-resistant transformants. 341
To confer resistance to hygromycin B during the crucial phase of protoplast 342
regeneration, sufficient levels of hygromycin B phosphotransferase (HPH) must be 343
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
16
produced. We initially determined that expression of the P. ostreatus β-tubulin gene is 344
higher than that of gpd, sdi1 and cross-pathway control (cpc-1) (Fig. 4). Thus, the P. 345
ostreatus β-tubulin promoter was chosen to drive hph, producing the Hygr cassette (see 346
Materials and Methods, Fig. 2A). The Hygr cassette was fused to the flanking DNA (2 kb 347
5' and 3') of P. ostreatus ku80 to produce a fragment designated TMS14. TMS14 was 348
then cloned to produce plasmid pTMS14 (see Materials and Methods, Fig. 2A). Using 349
this design strategy, the targeted gene’s 3’ flank provides a versatile terminator signal for 350
the Hygr cassette, and is expected to reduce the chances of HR with the endogenous β-351
tubulin (which may reduce transformation efficiency). This also simplified construction 352
of the gene-replacement cassettes. In addition, to allow regenerating protoplasts to gain 353
enough resistance to hygromycin B via accumulation of HPH, they were regenerated 354
overnight prior to exposure to hygromycin B. Both the plasmid (pTMS14) and the linear 355
cassette (TMS14, purified restriction fragment of pTMS14 digested with SphI and NotI) 356
were used, separately, for transformation into either P. ostreatus wild-type PC9 strain or 357
the 20b strain (Fig. 2A). Only the treatment in which the protoplasts were allowed to 358
regenerate before exposure to selection was successful in producing stable and integrative 359
transformation of the tested P. ostreatus strains for hygromycin B resistance with the 360
recombinant hph under the control of P. ostreatus β-tubulin promoter (Fig. 2). The 361
number of transformants obtained from transformation of the wild-type and strain 20b 362
was similar, about 100 transformants per transformation experiment (an average of six 363
independent transformation experiments). 364
Evaluation of gene-targeting efficiency using the P. ostreatus 20b (Δku80) 365
strain. To evaluate the efficiency of the gene-targeting system based on using the P. 366
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
17
ostreatus carboxin-resistant Δku80 strain 20b as a background strain for transformation, a 367
Hygr cassette intended for replacement of the Cbxr cassette, located at the ku80 locus, 368
was constructed. Both the plasmid (pTMS14) and the linear cassette (TMS14) were used, 369
separately, for transformation into P. ostreatus strain 20b (Fig. 2A), and hygromycin B-370
resistant colonies were isolated. 371
About 100 transformants (collected from two independent transformation 372
experiments) were subcultured under hygromycin B selection. Subsequently, they were 373
transferred for three rounds of subculturing to medium without selection. Following the 374
subculturing process, all resulting transformants were found to be hygromycin B-375
resistant;carboxin-sensitive, also indicating that these transformants are, most probably, 376
homokaryons. 377
Genomic DNA was extracted from 10 randomly chosen transformants (designated 378
20bH1-10) to determine, by PCR, whether the Cbxr cassette, located at the ku80 locus of 379
strain 20b, had in fact been replaced by the Hygr cassette. Primers in this PCR were 380
designed such that one was outside the targeted gene, at the flanking ku80 5’ region, and 381
the other was inside the Hygr cassette (see Recombination probe in Fig. 2A, PCR results 382
in Fig. 2B and primers in Table 1). All 10 hygromycin B-resistant transformants 383
contained the Hygr cassette in place of the Cbxr cassette at the ku80 locus (Fig. 2B), 384
exhibiting 100% HR frequency in the strain 20b transformation background (Table 2). 385
Next, these 10 transformants were screened for the presence of nontransformed 386
(heterokaryotic) nuclei, by using PCR with primers set so that one is outside the targeted 387
gene, at the flanking ku80 5’ region, and the other is inside the Cbxr cassette (located at 388
the ku80 locus) targeted for replacement by the Hygr cassette (see Homokaryon probe in 389
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
18
Fig. 2A, PCR results in Fig. 2C and primers in Table 1). All 10 transformants were found 390
to be homokaryons, reconfirming the occurrence of HR into the Cbxr cassette, previously 391
located at the ku80 locus, by the Hygr cassette (Table 2). In addition, both the plasmid 392
(pTMS14) and the linear cassette (TMS14) used for transformation produced Δku80 393
homokaryon strains. 394
One of the homokaryon Δku80 hygromycin B-resistant transformants, designated 395
20bH1 (isolated from transformation with the linear TMS14 cassette), was chosen for 396
further characterization. Several phenotypic traits were compared. Strain 20bH1 397
exhibited a phenotype similar to that of the wild-type strain PC9 and the Δku80 carboxin-398
resistant strain (20b), using the criteria described above (Table 3). Production of these 399
strains increases the flexibility of the gene-targeting system, by producing PC9 Δku80 400
strains resistant to either carboxin or hygromycin B. 401
Inactivation of the versatile-peroxidase (VP) encoded by mnp4. The MnP gene 402
family (mnps) of P. ostreatus comprises of five Mn2+-dependent peroxidases (mnp3, 6, 7, 403
8 and 9) and four Mn2+-independent peroxidases (mnp1, 2, 4 and 5; versatile-peroxidases, 404
VPs) (30, 31). Differential expression of mnps is dependent on the presence of Mn+2 in 405
the medium. The predominantly expressed mnp in GP medium non-amended with Mn2+ 406
is a VP encoded by mnp4, exhibiting about 70 fold increase in expression level under 407
Mn2+-deficient relative to Mn2+-amended conditions (3, 31). This gene is identified in the 408
JGI genome database of PC9 v1.0 by protein ID 137757 (30, http://genome.jgi-409
psf.org/PleosPC9_1/PleosPC9_1.home.html), which corresponds to the previously 410
identified protein ID 186006 in PC15 v1.0 (31). Thus, to verify the conclusions based on 411
gene expression data (31) and examine if other MnP activities appear under these 412
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
19
conditions, mnp4 was inactivated, in the current study, using the gene targeting system by 413
producing a homokaryon knockout strain. 414
A gene replacement cassette targeted at HR with the mnp4 CDS was constructed. 415
Both the plasmid (pTMS10) and the linear cassette (TMS10) were used for 416
transformation into P. ostreatus strain 20b (Fig. 3A), and hygromycin B-resistant 417
colonies were isolated. About 50 transformants were subcultured under hygromycin B 418
selection. Subsequently, they were transferred for three rounds of subculturing to medium 419
without selection. Following the subculturing process, all resulting transformants were 420
found to be hygromycin B-resistant;carboxin-resistant. 421
Five transformants (designated 1, 12, 34, 35 and 39) were selected based on 422
growth rate similar to that of the wild-type strain PC9. Genomic DNA was extracted to 423
determine, by PCR, whether the mnp4 CDS was specifically replaced by the Hygr 424
cassette, and to concurrently screen for the presence of nontransformed nuclei. Primers 425
targeting the CDS of mnp4 and three other mnps (mnp2, 3 and 9; which were previously 426
pointed out as important for ligninolytic functionality (3, 15, 30, 31, 39)) were used in the 427
same PCR reaction mixture (see Amplicons in Fig. 3A, PCR results in Fig. 3B and 428
primers in Table 1). While strains PC9 and 20b produced the expected amplicons 429
corresponding to mnp2, 3, 4 and 9, the five hygromycin B-resistant transformants did not 430
produce the mnp4 amplicon, indicating that the transformants are indeed Δmnp4 431
homokaryons, while also demonstrating that the other, sequence-related, mnp loci tested 432
were not affected (Fig. 3B). In addition, this showed that a 100% HR frequency in a 433
strain 20b transformation background implies also for the mnp4 locus (Table 2). 434
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
20
One of the Δmnp4 transformants, designated 34, was chosen for a time-course 435
characterization of its VP activity level. When the Δmnp4 strain was grown in Mn2+-436
deficient GP medium, extracellular enzymes able to oxidize phenol red were not detected 437
either in the presence or absence of Mn2+ in the reaction mixture. In comparison, the 438
wild-type strain PC9 showed a typical activity pattern (Fig. 3C). 439
440
DISCUSSION 441
Pleurotus is the second most economically important edible mushroom 442
worldwide, having medicinal properties and potential in biofuel production, 443
bioremediation and upgrade of animal feed. Analysis of gene function in basidiomycetes 444
is progressing rapidly (2, 34, 37). To meet the challenges of hypothesis-driven 445
experiments at the gene or gene-family level, appropriate tools are required (20, 31, 32, 446
40). In this study we developed tools and protocols that are essential for efficient and 447
reproducible targeted gene manipulations in the white rot fungus P. ostreatus, the oyster 448
mushroom. Adapting these, and other techniques, for use in additional ligninolytic fungi 449
is feasible and could further promote the functional analysis of the genes (and their 450
products) involved in the modification of lignin and other aromatic compounds. 451
Three basic demands were met: (a) production of strains exhibiting a high rate of 452
HR when used as a background for transformation, (b) confirmation of the isogenic 453
(homokaryon) nature of the strains, and (c) verification of the phenotypic fitness of the 454
strains produced. In the process, we also adapted a second dominant selectable marker 455
procedure to be used in a successive transformation. 456
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
21
Systematic high-throughput targeted gene manipulations in Pleurotus have been 457
limited, for two main reasons: first, Pleurotus wild-type strains have a low frequency 458
(2.3%) of site-specific recombination of DNA integration, which is within the 0.1 to 5% 459
range common for most filamentous fungi (20); second, low yield is obtained using 460
protoplast-mediated transformation (13–16, 31), reducing the chances of obtaining a 461
transformant in which gene replacement has occurred. 462
By increasing the rate of HR in Pleurotus, we circumvented the low natural HR 463
rate, resulting in the need to analyze only a few transformants when screening for the 464
desired gene-targeted transformants. To achieve this, we produced a strain whose NHEJ 465
DNA-repair pathway had been inactivated through disruption of ku80. This strategy has 466
been implemented in a number of fungi (representing models, phytopathogens, industrial 467
strains and human pathogens), resulting in 60% to 100% integration, by HR, of targeted 468
gene-replacement cassettes (20). A conventional gene-replacement cassette (containing 2 469
kb 5' and 3' of homologous sequences flanking the target locus, with a dominant-470
resistance cassette in between) (26) targeted to disrupt the ku80 CDS by HR with the 471
carboxin-resistance cassette (Cbxr) (13) was used for transformation of the wild-type P. 472
ostreatus monokaryon strain PC9. It should be noted that all gene-replacement cassettes 473
used in this study were designed to specifically target only the CDS borders of the 474
targeted gene, so as to minimize the chances of interrupting adjacent regulatory 475
sequences that might affect the expression of other genes. 476
Transformed homokaryons could be distinguished from heterokaryons by a PCR 477
assay directly targeting the CDS of the gene intended for disruption, in this case ku80. In 478
addition, before conducting the PCR assay, the transformants were intentionally grown 479
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
22
without selection for at least three subcultures, to unveil potential nontransformed nuclei 480
that might otherwise be “masked” by transformed nuclei under selective culture 481
conditions. This procedure enabled particularly high-sensitivity detection of 482
nontransformed nuclei (compared with Southern analysis). Out of the seven isolated 483
transformants, three were found to be homokaryons. The three transformants were found 484
negative for ectopic integrations by Southern analysis, reconfirming the occurrence of 485
HR into ku80 and the homokaryon nature of the strains. 486
To complete the development of the gene-targeting system and determine its 487
efficacy, a second selectable marker was used in a successive transformation step. One of 488
the constraints of protoplast-mediated transformation is the need to select and regenerate 489
transformed protoplasts in the presence of large amounts of nontransformed mycelial 490
fragments (6, 28). Transformation of P. ostreatus using uracil auxotrophs (18), bialaphos 491
(41), 5-fluoroindole (17), carboxin (13), hygromycin B (16) and phleomycin (19) 492
resistance have been reported. However, we have found that an auxotrophic marker is not 493
suitable for selection in the rich medium conditions required for protoplast regeneration 494
and that, except for carboxin, these markers are not effective. In view of these results, the 495
number of usable selectable markers in Pleurotus is presently quite limited in comparison 496
with other filamentous fungi (40). The fact that Pleurotus is capable of modifying a broad 497
range of complex substrates (11, 29, 35) might contribute to the reduced efficacy of some 498
of the selectable drugs. The mode of action of carboxin is fundamentally different from 499
those of the other selective compounds tested: whereas the latter inhibit protein or DNA 500
synthesis, carboxin inhibits respiration. In contrast to carboxin, the other compounds do 501
not usually kill nonresistant cells; they only inhibit or stop their growth. Cells containing 502
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
23
the corresponding resistance gene need to produce enough of the relevant detoxifying 503
enzymes to allow regeneration and growth, a process that takes time. Among all of the 504
tested compounds, hygromycin B was the best candidate to serve as a dominant selection 505
marker, since it provides fair selection under conventional protoplast regeneration 506
conditions, and it is one of the most widespread (and available) markers used in 507
filamentous fungi (40). 508
Using the sdi1 promoter to drive the hygromycin B-resistance gene (hph) was 509
unsuccessful in producing resistant colonies under the conditions tested. This can be 510
explained by its lower expression levels relative to β-tubulin and the other promoters 511
tested. Thus, we redesigned hph to be driven by the strong β-tubulin promoter (to produce 512
the current Hygr cassette) and subjected the transformation mixture to an overnight 513
regeneration-incubation period before exposure to the selection drug. This was based on 514
the assumption that higher expression of hph, in combination with exposure to conditions 515
in which the transformed cells produce enough HPH to detoxify it, will support better 516
regeneration. Indeed, we were able to pick clearly resistant colonies, with almost no 517
false-positives or unstable transformants. Furthermore, this transformation procedure 518
proved to be efficient and reproducible, yielding about 100 transformants per 519
transformation experiment (compared to about 250 using carboxin), with either the wild-520
type PC9 or Δku80 strain. Unexpectedly, all of the isolated transformants were found to 521
be homokaryons, in contrast to when carboxin was used, where less than half of the 522
isolated transformants were homokaryons, an outcome that may be a reason for the 523
differences in overall transformation yield compared to carboxin. 524
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
24
The procedure developed here also expanded the flexibility of the gene-targeting 525
system, by producing PC9 Δku80 strains resistant to either carboxin or hygromycin B. In 526
addition, we demonstrated that transformed DNA in the form of a circular plasmid, a 527
linear cassette (purified restriction fragments) and even a PCR product can be used to 528
give correct gene-targeting events. 529
Utilization of a genetically modified background strain in a successive genetic 530
manipulation depends on maintaining its functionality in aspects that might influence the 531
relevant future genetic manipulation. Accordingly, we evaluated the functionality of the 532
strains produced in this work for three aspects related to fundamental properties of 533
Pleurotus: (a) biomass production and linear growth rate, (b) reproductive ability, and (c) 534
ligninolytic activity. Biomass production and linear growth rate of the Δku80 strains 20b 535
(carboxin-resistant) and 20bH1 (hygromycin B-resistant) were found to be similar to 536
those of the parental wild-type PC9 strain. Being a heterothallic homobasidiomycete 537
whose mating is controlled by a bifactorial tetrapolar genetic system, Pleurotus 538
monokaryon strains can only produce a vegetative mycelium, cannot develop fruiting 539
bodies and have a slower growth rate than dikaryons. Monokaryons are also clearly 540
characterized by the absence of clamp connections and a thinner cell wall relative to 541
dikaryons (1, 21–23). PC9 is a monokaryon strain derived by dedikaryotization of the 542
dikaryon commercial strain N001. Since the Δku80 strains are homokaryons derived from 543
transformation of protoclones of PC9, they are expected to maintain the same mating and 544
fruiting abilities as PC9. These abilities were evaluated by mating trials with an 545
incompatible strain, PC15, and examining the formation of a typical dikaryon and 546
production of fruiting bodies under appropriate inductive culture conditions, as well as 547
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
25
the stability of the corresponding resistance trait. All strains exhibited healthy 548
reproductive fitness and retained their resistance to the corresponding selection. Lastly, 549
the extracellular activity of the ligninolytic enzymes laccase and Mn2+-peroxidase of the 550
Δku80 strains was found to be similar to that of PC9, based on enzymatic and Orange II 551
decolorization assays. Taken together, we demonstrated that the produced Δku80 strains 552
are suitable recipients for highly efficient gene-replacement experiments, without 553
compromising fitness levels. 554
The applicability of this system was demonstrated by inactivation of the VP 555
encoding gene mnp4 (3, 30, 31). VP is an enzyme with dual activity and wide substrate 556
specificity associated with its high-redox-potential (E◦>+1.4 V), the presence of two 557
catalytic sites, one for the oxidation of low- and high-redox-potential compounds, and the 558
second for Mn2+-oxidizing peroxidase (E.C. 1.11.1.6) activity. Recent literature point out 559
VP’s catalytic promiscuity, which is attracting great interest due to its potential 560
biotechnological applications (7, 30). To investigate VP’s significance in vivo it was 561
selected for complete and specific inactivation. 562
Δmnp4 homokaryon strains were produced using the gene targeting system. Time-563
course activity assays showed that, in contrast to the wild-type strain PC9, the Δmnp4 564
strain is unable to produce enzymatically oxidized phenol red either in the presence or 565
absence of Mn2+ in the reaction mixture. This finding supports our previous gene 566
expression-based conclusions (31), providing direct proof that mnp4 encodes the 567
predominant VP enzyme in Mn2+-deficient GP medium. This is the first report of a 568
knockout strain in a gene encoding a ligninolytic enzyme in a white-rot fungus. 569
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
26
Furthermore, this illustrates the applicability of the gene targeting system as a versatile 570
platform for directed investigation of Pleurotus lignocellulose degradation system. 571
The new tools and protocols developed in this study for the generation of 572
genetically manipulated strains enhance gene-manipulation ability in P. ostreatus. It is 573
now possible, using the P. ostreatus PC9 homokaryon Δku80 strain as a background 574
strain for transformation, to systematically produce gene-replacement mutants at 100% 575
efficiency, to perform allelic exchange experiments and to introduce mutations with 576
reduced probability of producing other alterations in the genome. It also has the potential 577
to provide a practical means for targeting multiple genes in a single transformation 578
experiment, in conjunction with the double-joint PCR technique, which facilitates the 579
methodical production of gene-replacement cassettes. These new techniques for directed 580
and specific manipulation of gene expression and function, together with the recent 581
availability of the complete genome sequence of P. ostreatus, will enable expanding the 582
analyses of cellular and molecular processes using a genetic approach. Consequently, 583
these advances may contribute to the improvement of Pleurotus physiology and 584
development in terms of agricultural, nutritional, biotechnical, pharmaceutical and 585
bioremediative applications, and to further our understanding of the mechanisms 586
involved in lignin biodegradation. This gene-replacement strategy complements the 587
already proven RNAi approach for altering gene-expression levels (31): while the former 588
can be utilized for complete gene inactivation, the latter can be especially useful in the 589
analysis of essential genes and gene families. 590
591
592
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
27
ACKNOWLEDGMENTS 593
We are deeply grateful to Prof. Takashi Watanabe and Prof. Yoichi Honda, 594
Research Institute for Sustainable Humanosphere, Kyoto University, Japan, for 595
generously providing plasmid pTM1. We are also grateful to Dr. Assaf Eybishtz, Adi 596
Moshe, Dagan Sade, Aurelia Zemach, Dr. Carmit Ziv and Dr. Hely Oren-Jazan (Agentek 597
Ltd, Tel Aviv, Israel) for their advice and comments. We thank the Joint Genome 598
Institute (US Department of Energy) and the Pleurotus Genome Consortium for access to 599
the P. ostreatus genome database. This work was partially supported by grant No. 600
2011505 from the U.S.-Israel Binational Science Foundation (BSF). 601
602
REFERENCES 603
1. Arjona, D., C. Aragón, J. A. Aguilera, L. Ramírez, and A. G. Pisabarro. 2009. 604
Reproducible and controllable light induction of in vitro fruiting of the white-rot 605
basidiomycete Pleurotus ostreatus. Mycol. Res. 113:552–558. 606
2. Cohen, R., L. Persky, and Y. Hadar. 2002. Biotechnological applications and 607
potential of wood-degrading mushrooms of the genus Pleurotus. Appl. Microbiol. 608
Biotechnol. 58:582–594. 609
3. Cohen, R., Y. Hadar and O. Yarden. 2001. Transcript and activity levels of 610
different Pleurotus ostreatus peroxidases are differentially affected by Mn2+. Environ 611
Microbiol 3:312–322. 612
4. de Jong, J. F., R. A. Ohm, C. de Bekker, H. A. B. Wösten, and L. G. Lugones. 613
2010. Inactivation of ku80 in the mushroom-forming fungus Schizophyllum commune 614
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
28
increases the relative incidence of homologous recombination. FEMS Microbiol. Lett. 615
310:91–95. 616
5. Dvash, E., G. Kra-Oz, C. Ziv, S. Carmeli, and O. Yarden. 2010. The NDR kinase 617
DBF-2 is involved in regulation of mitosis, conidial development, and glycogen 618
metabolism in Neurospora crassa. Eukaryot. Cell 9:502–513. 619
6. Fincham, J. R. 1989. Transformation in fungi. Microbiol. Rev. 53:148–170. 620
7. García-Ruiz, E., D. González-Pérez, F. J. Ruiz-Dueñas, A. T. Martínez, and M. 621
Alcalde. 2012. Directed evolution of a temperature-, peroxide- and alkaline pH-622
tolerant versatile peroxidase. Biochem. J. 441:487–498. 623
8. Grigoriev, I. V., D. Cullen, S. B. Goodwin, D. Hibbett, T. W. Jeffries, C. P. 624
Kubicek, C. Kuske, J. K. Magnuson, F. Martin, J. W. Spatafora, A. Tsang, and 625
S. E. Baker. 2011. Fueling the future with fungal genomics. Mycology 2:192–209. 626
9. Grinhut, T., T. M. Salame, Y. Chen, and Y. Hadar. 2011. Involvement of the 627
ligninolytic enzymes and Fenton like reaction during humic acid degradation by 628
Trametes sp. M23. Appl. Microbiol. Biotechnol. 91:1131–1140. 629
10. Gritz, L., and J. Davies. 1983. Plasmid-encoded hygromycin B resistance: the 630
sequence of hygromycin B phosphotransferase gene and its expression in Escherichia 631
coli and Saccharomyces cerevisiae. Gene 25:179–188. 632
11. Hammel, K. E., and D. Cullen. 2008. Role of fungal peroxidases in biological 633
ligninolysis. Curr. Opin. Plant Biol. 11:349–355. 634
12. Hirano, T., T. Sato, K. Yaegashi, and H. Enei. 2000. Efficient transformation of the 635
edible basidiomycete Lentinus edodes by the vector utilizing the glyceraldehyde-3-636
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
29
phosphate dehydrogenase gene promoter to hygromycin B resistance. Mol. Gen. 637
Genet. 263:1047–1052. 638
13. Honda, Y., T. Matsuyama, T. Irie, T. Watanabe, and M. Kuwahara. 2000. 639
Carboxin resistance transformation of the homobasidiomycete fungus Pleurotus 640
ostreatus. Curr. Genet. 37:209–212. 641
14. Irie, T., Y. Honda, T. Watanabe and M. Kuwahara. 2001. Efficient transformation 642
of filamentous fungus Pleurotus ostreatus using single-strand carrier DNA. Appl. 643
Microbiol. Biotechnol. 55:563–565. 644
15. Irie, T., Y. Honda, T. Watanabe, and M. Kuwahara. 2001. Homologous 645
expression of recombinant manganese peroxidase genes in ligninolytic fungus 646
Pleurotus ostreatus. Appl. Microbiol. Biotechnol. 55:566–570. 647
16. Irie, T., Y. Honda, T. Hirano, T. Sato, H. Enei, T. Watanabe, and M. Kuwahara. 648
2001. Stable transformation of Pleurotus ostreatus to hygromycin B resistance using 649
Lentinus edodes GPD expression signals. Appl. Microbiol. Biotechnol. 56:707–709. 650
17. Jia, J. H., J. A. Buswell, and J. F. Peberdy. 1998. Transformation of the edible 651
fungi, Pleurotus ostreatus and Volvariella volvacea. Mycol. Res. 102:876–880. 652
18. Kim, B. G., Y. Magae, Y. B. Yoo, and S. T. Kwon. 1999. Isolation and 653
transformation of uracil auxotrophs of the edible basidiomycete Pleurotus ostreatus. 654
FEMS Microbiol. Lett. 181:225–228. 655
19. Kim, B. G., J. H. Joh, Y. B. Yoo, and Y. Magae. 2003. Transformation of the edible 656
basidiomycete, Pleurotus ostreatus to phleomycin resistance. Mycobiology 31:42–5. 657
20. Kück, U., and B. Hoff. 2010. New tools for the genetic manipulation of filamentous 658
fungi. Appl. Microbiol. Biotechnol. 86:51–62. 659
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
30
21. Kües, U. and Y. Liu. 2000. Fruiting body production in basidiomycetes. Appl. 660
Microbiol. Biotechnol. 54:141–152. 661
22. Larraya, L. M., E. Idareta, D. Arana, E. Ritter, A. G. Pisabarro, and L. 662
Ramı´rez. 2002. Quantitative trait loci controlling vegetative growth rate in the 663
edible basidiomycete Pleurotus ostreatus. Appl. Environ. Microbiol. 68:1109–1114. 664
23. Larraya, L. M., G. Pérez, M. M. Peñas, J. J. P. Baars, T. S. P. Mikosch, A. G. 665
Pisabarro, and L. Ramírez. 1999. Molecular karyotype of the white rot fungus 666
Pleurotus ostreatus. Appl. Environ. Microbiol. 65:3413–3417. 667
24. Levy, M., A. Erental, and O. Yarden. 2008. Efficient gene replacement and direct 668
hyphal transformation in Sclerotinia sclerotiorum. Mol. Plant Pathol. 9:719–725. 669
25. Nakazawa, T., Y. Ando, K. Kitaaki, K. Nakahori, and T. Kamada. 2011. Efficient 670
gene targeting in ΔCc.ku70 or ΔCc.lig4 mutants of the agaricomycete Coprinopsis 671
cinerea. Fungal Genet. Biol. 48:939–946. 672
26. Ninomiya, Y., K. Suzuki, C. Ishii, and H. Inoue. 2004. Highly efficient gene 673
replacements in Neurospora strains deficient for nonhomologous end-joining. Proc. 674
Natl. Acad. Sci. USA 101:12248–12253. 675
27. Punt, P. J., R. P. Oliver, M. A. Dingemanse, P. H. Pouwels, and C. A. M. J. J. 676
van den Hondel. 1987. Transformation of Aspergillus based on the hygromycin B 677
resistance marker from Escherichia coli. Gene 56:117–124. 678
28. Ruiz-Díez, B. 2002. Strategies for the transformation of filamentous fungi. J. Appl. 679
Microbiol. 92:189–195. 680
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
31
29. Ruiz-Dueñas, F. J., and A. T. Martínez. 2009. Microbial degradation of lignin: how 681
a bulky recalcitrant polymer is efficiently recycled in nature and how we can take 682
advantage of this. Microbial. Biotechnol. 2:164–177. 683
30. Ruiz-Dueñas, F. J., E. Ferna´ndez, M. J. Martı´nez, and A. T. Martínez. 2011. 684
Pleurotus ostreatus heme peroxidases: an in silico analysis from the genome 685
sequence to the enzyme molecular structure. C. R. Biol. 334:795–805. 686
31. Salame, T. M., O. Yarden, and Y. Hadar. 2010. Pleurotus ostreatus manganese-687
dependent peroxidase silencing impairs decolourization of Orange II. Microb. 688
Biotechnol. 3:93–106. 689
32. Salame, T. M., C. Ziv, Y. Hadar, and O. Yarden. 2011. RNAi as a potential tool 690
for biotechnological applications in fungi. Appl. Microbiol. Biotechnol. 89:501–512. 691
33. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a 692
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring 693
Harbor, NY. 694
34. Sánchez, C. 2010. Cultivation of Pleurotus ostreatus and other edible mushrooms. 695
Appl. Microbiol. Biotech. 85:1321–1337. 696
35. Sánchez, C. 2009. Lignocellulosic residues: Biodegradation and bioconversion by 697
fungi. Biotechnol. Adv. 27:185–194. 698
36. Staben, C., B. Jensen, M. Singer, J. Pollock, M. Schechtman, J. Kinsey, and E. 699
Selker. 1989. Use of a bacterial Hygromycin B resistance gene as a dominant 700
selectable marker in Neurospora crassa transformation. Fungal Genet. Newslett. 701
36:79–81. 702
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
32
37. Stajić, M., J. Vukojević, and S. Duletić-Laušević. 2009. Biology of Pleurotus 703
eryngii and role in biotechnological processes: a review. Crit. Rev. Biotechnol. 704
29:55–66. 705
38. Takahashi, T., O. Mizutani, Y. Shiraishi, and O. Yamada. 2011. Development of 706
an efficient gene-targeting system in Aspergillus luchuensis by deletion of the non-707
homologous end joining system. J. Biosci. Bioeng. 112:529–534. 708
39. Tsukihara, T., Y. Honda, and T. Watanabe. 2006. Molecular breeding of white rot 709
fungus Pleurotus ostreatus by homologous expression of its versatile peroxidase 710
MnP2. Appl. Microbiol. Biotechnol. 71:114–120. 711
40. Weld, R. J., K. M. Plummer, M. A. Carpenter, and H. J. Ridgway. 2006. 712
Approaches to functional genomics in filamentous fungi. Cell Res. 16:31–44. 713
41. Yanai, K., K. Yonekura, H. Usami, M. Hirayama, S. Kajiwara, T. Yamazaki, K. 714
Shishido, and T. Adachi. 1996. The integrative transformation of Pleurotus 715
ostreatus using bialaphos resistance as a dominant selectable marker. Biosci. 716
Biotechnol. Biochem. 60:472–475. 717
42. Yu, J. H., Z. Hamari, K. H. Han, J. A. Seo, Y. Reyes-Domínguez, and C. 718
Scazzocchio. 2004. Double-joint PCR: a PCR-based molecular tool for gene 719
manipulations in filamentous fungi. Fungal Genet. Biol. 41:973–981. 720
721
722
723
724
725
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
33
FIGURE LEGENDS 726
FIG. 1. (A) Strategy for ku80 replacement in P. ostreatus PC9 wild-type strain. The 727
carboxin-resistance cassette (Cbxr) fused to 2 kb of 5' and 3' DNA flanking ku80 (TMS6) 728
was used for transformation. (B) PCR screening for transformants that underwent 729
homologous recombination, using primers targeting the indicated ku80 recombination 730
probe amplicon (Fig. 1A, Table 1) (lanes 1, 3 and 6). (C) PCR screening for homokaryon 731
transformants that underwent homologous recombination, using primers targeting the 732
indicated ku80 homokaryon probe amplicon (Fig. 1A, Table 1) (lanes 3 and 5). 733
734
FIG. 2. (A) Strategy for replacement of the Cbxr cassette at the ku80 locus in P. ostreatus 735
strain Δku80 (20b, carboxin-resistant). The hygromycin B-resistance cassette (Hygr) 736
fused to 2 kb of 5' and 3' DNA flanking ku80 (TMS14) was used for transformation. (B) 737
PCR screening for transformants that underwent homologous recombination, using 738
primers targeting the indicated ku80 recombination probe amplicon (Fig. 2A, Table 1) 739
(lane 1: strain 20b, lanes 2–11: strains 20bH1–10, respectively). (C) PCR screening for 740
homokaryon transformants that underwent homologous recombination, using primers 741
targeting the indicated ku80 homokaryon probe amplicon (Fig. 2A, Table 1) (lane 1: 742
strain 20b, lanes 2–11: strains 20bH1–10, respectively). 743
744
FIG. 3. (A) Strategy for replacement of the mnp4 CDS in P. ostreatus strain Δku80 (20b, 745
carboxin-resistant). The hygromycin B-resistance cassette (Hygr) fused to 2 kb of 5' and 746
3' DNA flanking mnp4 (TMS10) was used for transformation. (B) PCR screening for 747
homokaryon Δmnp4 transformants, while showing that mnp2, 3 and 9 were not targeted, 748
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
34
using primers targeting the indicated amplicon (Fig. 3A, Table 1) (lane 1: PC9 wild-type 749
strain, lane 2: Δku80 strain 20b, lanes 3–7: Δmnp4 strains 1, 12, 34, 35 and 39, 750
respectively). (C) Time-course assay of Mn2+-dependent (+Mn2+) and Mn2+-independent 751
(-Mn2+) peroxidase activities of strains PC9 and 34 (Δmnp4) in liquid culture of Mn2+-752
deficient GP medium, during 10 days of incubation. Data represent the average of three 753
biological replicates. Bars denote the standard deviation. 754
755
FIG. 4. Comparative gene-expression analysis by RT-PCR of P. ostreatus wild-type 756
strain PC9 grown on solid YMG medium containing 0.5 M sucrose, after 10 days of 757
incubation. The analyzed genes were β-tubulin, glyceraldehyde-3-phosphate 758
dehydrogenase (gpd), iron-sulfur protein subunit of succinate dehydrogenase (sdi1) and 759
cross-pathway control (cpc-1), using the primers detailed in Table 1. 760
761
762
763
764
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
P. ostreatus
wild type strain PC9
ku80 region
ku80 replacement cassette
(TMS6)
X
P. ostreatus
PC9 ku80 strain (20b)
ku80 region
X
Cbxr
Recombination
probe
Southern
probeStyI
BglII
Eco
NI
StyIEco
NI
BglII
BglII
Eco
NI
StyI
BglII
AT
G
TA
G
1 kbp
A
B
2999 bp
M 1 2 3 4 5 6 7C
2174 bp
M 1 2 3 4 5 6 7
StyIEco
NI
Homokaryon
probe
Cbxr
Ku80 CDS
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
P. ostreatus
PC9 ku80 strain (20b)
ku80 region
Cbxr, ku80 locus located,
replacement cassette
(TMS14)
X
Transformed ku80 region
X
Hygr
Recombination
probe
1 kbp
A
B C
4882 bp
2999 bp
M 1 2 3 4 5 6 7 8 9 10 11
Homokaryon
probe
Hygr
Cbxr
M 1 2 3 4 5 6 7 8 9 10 11
NotI
Sph
I
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
P. ostreatus
PC9 ku80 strain (20b)
mnp2/3/4/9 region
mnp4 replacement cassette
(TMS10)
X
P. ostreatus
PC9 ku80 mnp4
strains mnp4 region
X
Hygr
ST
AR
T
ST
OP
1 kbp
A
B
Amplicon
mnp2/3/4/9
CDS
1 2 3 4 5 6 7
Amplicon
mnp2
mnp3
mnp4
mnp9
mnp9
496 bp
mnp3
165 bpmnp2
94 bp
mnp4
282 bp
Hygr
C
0.00
0.02
0.04
0.06
0.08
0.10
0.12
0.14
0 2 4 6 8 10
Acti
vit
y (
U/m
l)
Incubation period (days)
PC9-FULL
PC9-NM
34-FULL
34-NM
PC9 (+Mn2+)
PC9 (-Mn2+)
mnp4 (+Mn2+)
mnp4 (-Mn2+)
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
-tubulin gpdsdi1 cpc-1
300 bp
200 bp
100 bp
M
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
TABLE 1. Oligonucleotides used in this study Template Target Primer designation Sequence (5'→3') Amplicon (bp) Cassette construction ku80 replacement cassette (TMS6)
PC9 genomic DNA ku80 ku80PF AATTGCGGGCTCCTCCGATCTCTGAGTTC 2018 ku80 cbxF-ku80PR GTCGTTGGCAGTGTCATCGGAGTTGGCAATTGGCAAGAGGTT
pTM1 Cbxr ku80PR-cbxF AACCTCTTGCCAATTGCCAACTCCGATGACACTGCCAACGAC 2591 Cbxr ku80TF-cbxR AGTAACATAGCAGAGCCACGACAGCATCGCAAGTGAAACC
PC9 genomic DNA ku80 cbxR-ku80TF GGTTTCACTTGCGATGCTGTCGTGGCTCTGCTATGTTACT 2018 ku80 ku80TR ACGGCCTTTCCAAGCCTCACGACGCGAT Cbxr replacement cassette (TMS14)
PC9 genomic DNA ku80 ku80PF AATTGCGGGCTCCTCCGATCTCTGAGTTC 2023 ku80 btubPF- ku80PR ATTTAGTTTCCTCCCAACAGCATGTTGGCAATTGGCAAGAGGTT
PC9 genomic DNA β-tubulin ku80PR-btubPF AACCTCTTGCCAATTGCCAACATGCTGTTGGGAGGAAACTAAAT 1722 β-tubulin hphF-btubPR GGTGAGTTCAGGCTTTTTCATTCTGCATGGAAAAGAAGTTAGTCG
pCSN44 hph btubPR-hphF CGACTAACTTCTTTTCCATGCAGAATGAAAAAGCCTGAACTCACC 1072 hph ku80TF-hphR AGTAACATAGCAGAGCCACGACCTATTCCTTTGCCCTCGGA
PC9 genomic DNA ku80 hphR- ku80TF TCCGAGGGCAAAGGAATAGGTCGTGGCTCTGCTATGTTACT 2027 ku80 ku80TR ACGGCCTTTCCAAGCCTCACGACGCGAT mnp4 replacement cassette (TMS10)
PC9 genomic DNA mnp4 mnp4PF GATACCTGAGTTCTGGATACCGCCTGAA 2023 mnp4 hygF-mnp4PR ATTTAGTTTCCTCCCAACAGCATGAAATGTCAGCGGAGAGGGT
pTMS14 Hygr mnp4PR-hygF ACCCTCTCCGCTGACATTTCATGCTGTTGGGAGGAAACTAAAT 2760 Hygr mnp4TF-hygR AGCATATTCAGGTATCGAAGCATCTATTCCTTTGCCCTCGGA
PC9 genomic DNA mnp4 hygR-mnp4TF TCCGAGGGCAAAGGAATAGATGCTTCGATACCTGAATATGCT 2251 mnp4 mnp4TR TTCTCATCTGAATCGTGACTACCAT Analysis of construct integration ku80 replacement cassette (TMS6) Recombination probe
strain specific genomic DNA ku80 ku80-2506 ACGCCTGTGCACACTGTCT 2999 Cbxr cbx-831 TGAGGGCCGTATACCCATAA Homokaryon probe
strain specific genomic DNA ku80 ku80+971 GGAAGCTTTCGAGATCAACG 2174 ku80 ku80+3145 ACTCAGAGCCACAAGCCTATTG Southern probe
pTMS6 ku80 ku80+2861 TCGGCAGTACAAACACACAA 1539 ku80 ku80+4400 CATTTTCCTTTTCGGATTTGA Cbxr replacement cassette (TMS14) Recombination probe
strain specific genomic DNA ku80 ku80-2506 ACGCCTGTGCACACTGTCT 4882 Hygr hph+677 GATGTTGGCGACCTCGTATT Homokaryon probe
strain specific genomic DNA ku80 ku80-2506 ACGCCTGTGCACACTGTCT 2999 Cbxr cbx-831 TGAGGGCCGTATACCCATAA mnp4 replacement cassette (TMS10) Amplicon
strain specific genomic DNA mnp2 mnp2+947 TTGACCCCTCCGTAAGTGAC 94 mnp2+1041 CGAGCGAGAACACCTTTACC
strain specific genomic DNA mnp3 mnp3+1103 GCCCGTGGTATGTATTCAGC 165 mnp3+1268 AAGCTTGGCCTGGTTGTCTA
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
strain specific genomic DNA mnp4 mnp4+1084 CCCGGAGTTTTTGATTCTCA 282 mnp4+1366 ATCAAAGGCTGCAAGGAAGA
strain specific genomic DNA mnp9 mnp9+216 ATACCCTGCGTTTTCTGTGG 496 mnp9+712 TACCAAGGGGAAAGCACTTG Gene expression
strain-specific total cDNA sdi1 sdi1+202 CCCATGATTCTGGATGCTCT 198 sdi1 sdi1+380 GATGTACATGTGCGGCAAAG
strain-specific total cDNA β-tubulin btub+358 GTGCGTAAGGAAGCTGAGGG 201 β-tubulin btub+538 TGTGGCATTGTACGGCTCAAC
strain-specific total cDNA gpd gpd+203 AGGGAAAGCCGATCCATATC 200 gpd gpd+323 GTTAACACCGCAGACGAACA
strain-specific total cDNA cpc-1 cpc-1+239 ACACTCCGTTCGAGGATGAC 210 cpc-1 cpc-1+429 GATCCAACAATGGTGTGTCG
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
TABLE 2. Frequency of homologous integration, homokaryons and ectopic integration
at the ku80 locus, in the wild-type and Δku80 strain, respectively
Strain Homologous integrationa Homokaryonsb Ectopic integrationc
PC9 (wild-type) 7/300 (2.3%) 3/7 (43%) 0/3
20b (Δku80) 15/15 (100%) 15/15 (100%) not tested
aHomologous integration was screened for in 300 out of 1000 carboxin-resistant
transformants produced, and in 15 out of 150 hygromycin B-resistant transformants
produced (10 of which targeting the ku80 locus, and 5 of which targeting the mnp4
locus).
bHomokaryons were screened for in the transformants showing homologous integration.
cEctopic integration was screened for in selected homokaryon transformants.
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
TABLE 3. Phenotype of P. ostreatus wild-type and Δku80 strains
Straina PC9 20b 20bH1
Linear growth
rate (mm/24 h)b 7.4±0.1 7.3±0.1 6.9±0.1
Biomass
production
(mg/flask)c
135.8±24.7 137.6±27.3 130.9±19.1
Laccase activity
(mU/mg dry
weight)c
0.74±0.14 0.72±0.14 0.71±0.10
Mn2+-peroxidase
activity
(mU/mg dry
weight)c
13.6±2.5 13.5±2.7 9.3±1.4
Orange II
decolorization
in liquid culture
(% of control)d
96.8±0.1 96.8±0.1 96.7±0.1
Orange II
decolorized area
in solid culture
(cm2)d
11.1±1.1 11.0±1.0 10.1±0.9
Resistance to no yes no
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
carboxine
Resistance to
hygromycin Be no no yes
Mycelium
phenotypef
monokaryon
monokaryon monokaryon
Mycelium
phenotype after
mating with
PC15f
dikaryon
dikaryon dikaryon
Resistance to
carboxin
after mating with
PC15e
no yes no
Resistance to
hygromycin B
after mating with
PC15e
no no yes
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from
Fruiting body
production
after mating with
PC15g
yes
yes
yes
aPC9 and PC15 are monokaryon strains derived by dedikaryotization of the commercial
dikaryon strain N001; 20b is a carboxin-resistant Δku80 strain produced by
transformation on PC9 background; 20bH1 is a hygromycin B-resistant Δku80 strain
produced by transformation on 20b background.
bGrown on solid YMG culture for 10 days. Data represent the averages of three
biological replicates.
cAfter 10 days of incubation in liquid GP culture. Data represent the averages of five
biological replicates.
dAfter 10 days of incubation in liquid or solid GP culture amended with Orange II.
Noninoculated medium amended with Orange II was used as a control Data represent the
averages of three biological replicates.
eGrown on solid YMG culture amended with either carboxin or hygromycin B.
fGrown on solid YMG culture for 10 days. Visually characterized microscopically. Scale
bars represent 10 µm.
gIn vitro production of fruiting bodies after 12–14 days on solid YMG medium. Data
represent four biological replicates.
on April 13, 2019 by guest
http://aem.asm
.org/D
ownloaded from