9/17/2015fatchiyah, JB-UB Gene Regulatory ByFatchiyah([email protected]) Dept. of Biology, Brawijaya University

04/21/2304/21/23 fatchiyah, JB-UBfatchiyah, JB-UB

Gene RegulatoryGene Regulatory

ByByFatchiyahFatchiyah

([email protected])([email protected])Dept. of Biology, Brawijaya Dept. of Biology, Brawijaya

UniversityUniversity


Regulation of GenesRegulation of Genes

WhatWhat turns genes on (producing turns genes on (producing a protein) and off?a protein) and off?

WhereWhere (in which cells) is a gene (in which cells) is a gene turned on?turned on?

WhenWhen is a gene turned on or off? is a gene turned on or off? How manyHow many copies of the gene copies of the gene

product are produced?product are produced?


Overview of Gene Overview of Gene ControlControl The mechanisms that control the The mechanisms that control the

expression of genes operate at many expression of genes operate at many levels.levels.

source: Molecular Biology of the Cell (4th ed.), A. Johnson, et al.


Multi-scale Model ProblemMulti-scale Model Problem

Organizational Structure in BiologyOrganizational Structure in Biology– Single Cells (Building blocks)Single Cells (Building blocks)– Tissues (organization of multiple cells)Tissues (organization of multiple cells)

– OrganismOrganism Fundamental Cellular ProcessesFundamental Cellular Processes

– Inputs (Signal Transduction)Inputs (Signal Transduction)– TranscriptionTranscription– TranslationTranslation– Outputs – adaptive processesOutputs – adaptive processes


DNA to chromosomeDNA to chromosomeM ovie: DNA to Chromosome

The structure of DNA dictates the way The structure of DNA dictates the way it encodes genetic information. A it encodes genetic information. A strand of DNA consists of three types strand of DNA consists of three types of fundamental chemical units, of fundamental chemical units, repeated many times.repeated many times.


Prokaryote regulationProkaryote regulation

Lac operonLac operon


Transcriptional Transcriptional RegulationRegulation The transcription of each gene is The transcription of each gene is

controlled by a regulatory region of controlled by a regulatory region of DNA relatively near the transcription DNA relatively near the transcription start site (TSS). start site (TSS).

two types of fundamental two types of fundamental componentscomponents– short DNA regulatory elementsshort DNA regulatory elements– gene regulatory proteinsgene regulatory proteins that that

recognize and bind to them. recognize and bind to them.


Gene Signals in DNAGene Signals in DNA

CpG islands; methylation patterns; promotors

Polymerase binding site; cofactors binding sites; enhancer; silencer

transcription start sites; introns Donors; acceptors; branch point Termination signals


Regulation of Genes Regulation of Genes (1)(1)

RNA polymerase(Protein)

Transcription Factor(Protein)

source: M. Tompa, U. of Washington

Regulatory Element

DNA ATG

Start site

Gene

Termination site



GeneRegulatory Element

DNA


Transcription

ATG



DNA


ATG

mRNA

Protein

ATG


AnimationAnimation

Transcription regulatoryTranscription regulatory

Post-Transcription regulationPost-Transcription regulation


IonChannels

Receptors

mRNA

TranscriptionFactors

Ligands

ELECTROPHYSIOLOGY

Extracellularspace

Cytoplasm

NucleusTranslation +

processing

cis sites

IntracellularSignaling

GeneticRegulatory

Network

Post Post translationtranslation


Expression profiles

Cellularprocesses

Proteins

Nucleus

mRNAsTFsIntracellular

signals

Cytosol

Genomicsequences

cis bindingactivities

Cellular Processes


Alignment of CpG Alignment of CpG islandisland

Transcription start(homology-based assignment)

TATA-box

CpG island

mRNA


Gene Regulatory MotifGene Regulatory Motif

A subsequence (substring) that occurs in A subsequence (substring) that occurs in multiple sequences with a biological multiple sequences with a biological importance.importance.

Motifs can be totally constant or have Motifs can be totally constant or have variable elements.variable elements.

Protein Motifs often result from structural Protein Motifs often result from structural features.features.

DNA Motifs (regulatory elements)DNA Motifs (regulatory elements)– Binding sites for proteinsBinding sites for proteins– Short sequences (5-25)Short sequences (5-25)– Up to 1000 bp (or farther) from geneUp to 1000 bp (or farther) from gene– Inexactly repeating patternsInexactly repeating patterns

What is a motif?What is a motif?


daf-19 Binding Sites in daf-19 Binding Sites in C. C. eleganselegans

GTTGTTGTGTCATGGTCATGGTGGACACGTTGTTTTCCATGGCCATGGAAAACAACGGCCTTAACCATGGCCATGGCCAACAACGTTGTTAACCATCCATAAGTAACGTAACGTTGTTTTCCATGGTAACCCATGGTAAC che-2che-2 daf-19daf-19 osm-1osm-1 osm-6osm-6

F02D8.3F02D8.3

-150 -1

source: Peter Swoboda


Splice Motifs in A/T Splice Motifs in A/T rich Organismsrich Organisms


Motif RepresentingMotif Representing

Consensus sequence: a single string with Consensus sequence: a single string with the most likely sequence(+/- wildcards)the most likely sequence(+/- wildcards)

Regular expression: a string with Regular expression: a string with wildcards, constrained selectionwildcards, constrained selection

Profile: a list of the letter frequencies at Profile: a list of the letter frequencies at each positioneach position

Sequence Logo: Sequence Logo: – graphical depiction of a profile graphical depiction of a profile – conservation of elements in a motif.conservation of elements in a motif.


Motif Logos: an Motif Logos: an ExampleExample

(http://www-lmmb.ncifcrf.gov/~toms/sequencelogo.html)


Finding Regulatory Finding Regulatory MotifsMotifs

GivenGiven a collection of genes with a collection of genes with common expression,common expression,

FindFind the (TF-binding) motif in common the (TF-binding) motif in common

.

.

.


An Example: Hormonal Gene An Example: Hormonal Gene RegulationRegulation

To understand the cellular To understand the cellular mechanisms of hormonal (hydrophobic mechanisms of hormonal (hydrophobic and Hydrophilic) gene regulationand Hydrophilic) gene regulation


Hormonal Gene regulationHormonal Gene regulation

OBJECTIVES:OBJECTIVES: Describe basic mechanisms of gene regulation.Describe basic mechanisms of gene regulation. Describe gene regulation at transcriptional level.Describe gene regulation at transcriptional level. Describe key elements present in the region of gene involved in Describe key elements present in the region of gene involved in

gene transcription. gene transcription. Give a definition of Promoters, enhancers, Response elements, Give a definition of Promoters, enhancers, Response elements,

Transcription factors and co-activators.Transcription factors and co-activators. Aware that hydrophobic hormone receptor is a transcription Aware that hydrophobic hormone receptor is a transcription

factor.factor. Describe basic organisation of steroid receptor moleculeDescribe basic organisation of steroid receptor molecule Describe how hydrophobic hormones regulate gene expressionDescribe how hydrophobic hormones regulate gene expression Describe how hydrophilic hormones regulate gene Describe how hydrophilic hormones regulate gene

expression via cellular signalling molecules.expression via cellular signalling molecules.


Regulation at Regulation at Transcriptional levelTranscriptional level Transcription by tissue specific factors: Transcription by tissue specific factors:

muscle cell specific transporter factor(myoD)- muscle cell specific transporter factor(myoD)- in myoblasts. Ker1=keratinocyte in myoblasts. Ker1=keratinocyte differentiating factor-skin cells. HNF-differentiating factor-skin cells. HNF-5=hepatic nuclear factor5- liver cells5=hepatic nuclear factor5- liver cells

Hormone, growth factor or cellular Hormone, growth factor or cellular messenger binding to response messenger binding to response element: glucocorticoid response element: glucocorticoid response element (GRE): binds glucocorticoid element (GRE): binds glucocorticoid receptor complexreceptor complex

Alternative promoter: dystrophin geneAlternative promoter: dystrophin gene


Promoter RegionsPromoter Regions

tgacgca cacgtg gggcgg ccatt-100

tata-35

Exon1 Exon2

Many factor sites: c-fos, c-jun, c-myc/mac; Sp1, CREB, etc

CREBC-myc/max Sp-1 C/EBP

RNA Pol II

TF II-B

TF II-A

TF II-D

Transcription ON

mRNA

Protein


Transcriptional Transcriptional regulationregulation cis-acting transcriptional control cis-acting transcriptional control

sequences: Promoter, Response elements; Enhancers, sequences: Promoter, Response elements; Enhancers, silencersilencer

Transcription regulatory proteins (Transcription factors)

·


Cis acting Cis acting transcriptional control transcriptional control sequencessequences PromotersPromoters: : Located in the immediate upstream region, Located in the immediate upstream region,

serves to initiate transcription.serves to initiate transcription. Consists of combination of short sequence Consists of combination of short sequence

elements (ccaat box, tata box, gc box).elements (ccaat box, tata box, gc box). Recognised by ubiquitous transcription factors. Recognised by ubiquitous transcription factors. Promoters of gene that show tissue Promoters of gene that show tissue

specific expression pattern often include specific expression pattern often include cis-acting sequence elements that can be cis-acting sequence elements that can be recognised by tissue specific transcription recognised by tissue specific transcription factors.factors.


Cis acting Cis acting transcriptional control transcriptional control sequencessequences Response elementsResponse elements: : Found in selected genes whose Found in selected genes whose

expression is controlled by an expression is controlled by an external factor. Located short external factor. Located short distance upstream of promoters.distance upstream of promoters.


Cis acting Cis acting transcriptional control transcriptional control sequencessequences EnhancersEnhancers: : Positive regulatory elements, function Positive regulatory elements, function

independent of both orientation and independent of both orientation and distance from the genes they regulate. distance from the genes they regulate. They contain elements recognised by They contain elements recognised by ubiquitous transcription factors and tissue ubiquitous transcription factors and tissue specific specific transcription factors.transcription factors.

SilencersSilencers: :

negatively regulatory elements. negatively regulatory elements.


Transcriptional regulatory Transcriptional regulatory proteins (Transcription proteins (Transcription factors)factors) Transcription is regulated by a large number Transcription is regulated by a large number

of DNA binding proteins.of DNA binding proteins. These DNA binding proteins mostly These DNA binding proteins mostly

bind the response elements in a dimeric bind the response elements in a dimeric form, either as homodimers or or as form, either as homodimers or or as heterodimersheterodimers. .

The symmetry of these dimeric transcription The symmetry of these dimeric transcription factor is matched by their response elements factor is matched by their response elements which frequently posses an incomplete dyad which frequently posses an incomplete dyad symmetry. symmetry.


Structural motifs of the Structural motifs of the regulatory DNA binding regulatory DNA binding proteinprotein Helix-turn-helix (HTH) motif: mediated DNA binding by Helix-turn-helix (HTH) motif: mediated DNA binding by

fitting into major groove of the DNA helix, allowing fitting into major groove of the DNA helix, allowing precise alignment of the factor in relation to DNA precise alignment of the factor in relation to DNA sequence recognisedsequence recognised

Helix –loop helix: promotes both DNA binding Helix –loop helix: promotes both DNA binding and protein dimer formation.and protein dimer formation.

Zinc Finger: loops or fingers of amino acids that have Zinc Finger: loops or fingers of amino acids that have a zinc ion at their core. The adjacent amino acid a zinc ion at their core. The adjacent amino acid sequences form a α-helices that makes contact with sequences form a α-helices that makes contact with DNA in the major groove DNA in the major groove

Leucine Zipper: forms a dimer that grips the Leucine Zipper: forms a dimer that grips the DNAdouble helix like a peg, by inserting into the DNAdouble helix like a peg, by inserting into the major groove.major groove.


DNA binding motifs in DNA binding motifs in ProteinsProteins


Properties of dimeric Properties of dimeric transcription factors.transcription factors. DNA binding module: Provides a non-DNA binding module: Provides a non-

selective affinity for DNA and the ability to selective affinity for DNA and the ability to recognise the specific base sequence of the recognise the specific base sequence of the response element.response element.

A dimerisation module allows protein to A dimerisation module allows protein to form an active dimeric state.form an active dimeric state.

Transcription activation (or inhibition) region: Transcription activation (or inhibition) region: required for stimulation or inhibition of required for stimulation or inhibition of transcription transcription


Regulation of Regulation of transcription factorstranscription factors Level of synthesisLevel of synthesis

Covalent modification by Covalent modification by phosphorylation /desphosphorylationphosphorylation /desphosphorylation

Binding of small molecules can act as Binding of small molecules can act as positive or negative allosteric effectorspositive or negative allosteric effectors


Specific transcription Specific transcription factorsfactors Tissue specific gene expressionTissue specific gene expression

Cell growth and differentiationCell growth and differentiation

Response to lipid soluble hormones and second Response to lipid soluble hormones and second messenger moleculesmessenger molecules

Cellular transcription factors required for the Cellular transcription factors required for the transcription of viral gene.transcription of viral gene.


Specific Hormonal Specific Hormonal Gene regulationGene regulation Hormones regulate the function of their target cells by Hormones regulate the function of their target cells by

receptor mediated pathways. receptor mediated pathways. Water soluble hormones for which the lipid barrier of Water soluble hormones for which the lipid barrier of

the plasma membrane is impenetrable, interact with the plasma membrane is impenetrable, interact with their receptors at the cell surfacetheir receptors at the cell surface

Hydrophobic hormones that are lipid soluble and Hydrophobic hormones that are lipid soluble and therefore can pass the cell membrane interact with therefore can pass the cell membrane interact with another family of receptors that are intracellular another family of receptors that are intracellular (cytosolic or nuclear). These intracellular receptors (cytosolic or nuclear). These intracellular receptors function as hormone-regulated transcription factors, function as hormone-regulated transcription factors, controlling the expression of specific target genes by controlling the expression of specific target genes by interacting with regions known as hormone response interacting with regions known as hormone response elements located close to the promoter in the elements located close to the promoter in the regulatory regionregulatory region


Receptor-mediated Receptor-mediated induction of gene induction of gene transcription by steroid transcription by steroid hormones hormones

Activated receptors

Coactivator protein(s)

hsp90Pre-initiation complexRNA Pol-II + GTFs

TATA box HRE

Steroid ligands

Vacant Receptor


Mechanism of gene activation Mechanism of gene activation by the steroid hormone by the steroid hormone receptors (transcription receptors (transcription factors)factors) The DNA binding domain is characterised by The DNA binding domain is characterised by

the presence of two zinc fingers. the presence of two zinc fingers. In the case of steroid hormones Zinc is co-In the case of steroid hormones Zinc is co-

ordinated by four cysteine residues. ordinated by four cysteine residues. In other Zinc fingers Zn can be co-ordinated In other Zinc fingers Zn can be co-ordinated

by two histidine and two cysteine residues. by two histidine and two cysteine residues. Although these are referred to as fingers, the Although these are referred to as fingers, the

tertiary structure is more like a fist made from tertiary structure is more like a fist made from beta sheet and α helical structure. DNA beta sheet and α helical structure. DNA interacting residues are found in the α-helical interacting residues are found in the α-helical part of the molecule.part of the molecule.


Mechanism of gene Mechanism of gene regulation by Hydrophilic regulation by Hydrophilic hormoneshormonesIntracellular second messenger cAMP and Intracellular second messenger cAMP and

gene regulation.gene regulation. In the previous lecture you learnt that cAMP is produced In the previous lecture you learnt that cAMP is produced

as a result of activation of adenylate cyclase by G as a result of activation of adenylate cyclase by G protein which in turn had been acivated by hormone protein which in turn had been acivated by hormone which can not pass the hydrophobic cell membrane.which can not pass the hydrophobic cell membrane.

This cAMP in turn acivates a cAMP depedent protein This cAMP in turn acivates a cAMP depedent protein kinase (PKA) which modulates multiple aspects of cell kinase (PKA) which modulates multiple aspects of cell function. PKA phosphorylates a transcription factor function. PKA phosphorylates a transcription factor called CREB (cAMP response element binding protein). called CREB (cAMP response element binding protein).

This is then translocated to the nucleus where it binds This is then translocated to the nucleus where it binds to a short pallinodromic sequence in the promoter to a short pallinodromic sequence in the promoter

region of cyclic AMP-regulated genes referred to as CRE.region of cyclic AMP-regulated genes referred to as CRE.


Thank YouThank You

Documents

9/17/2015fatchiyah, JB-UB Gene Regulatory ByFatchiyah([email protected]) Dept. of Biology, Brawijaya University