4441 (2): 366 378 Article ZOOTAXA

The rediscovery of Schaefer’s Spine-jawed Snake (Xenophidion schaeferi Günther & Manthey, 1995) (Serpentes, Xenophidiidae) from Peninsular Malaysia with notes on its variation and the first record of the genus from Sumatra, IndonesiaZootaxa 4441 (2): 366–378
http://www.mapress.com/j/zt/ Article
Günther & Manthey, 1995) (Serpentes, Xenophidiidae) from Peninsular Malay-
sia with notes on its variation and the first record of the genus from Sumatra,
Indonesia
EVAN S.H. QUAH1,8, L. LEE GRISMER2, THOM JETTEN3, PERRY L. WOOD, Jr.4, AURÉLIEN MIRALLES5,
SHAHRUL ANUAR MOHD SAH1, KURT H.P. GUEK6 & MATTHEW L. BRADY7
1School of Biological Sciences, Universiti Sains Malaysia, 11800 Minden, Penang, Malaysia.
E-mails: [email protected], [email protected], [email protected] 2Herpetology Laboratory, Department of Biology, La Sierra University, 4500 Riverwalk Parkway, Riverside, California 92515 USA.
E-mail: [email protected], 3Biotic Eco-Tech, G-53, Plaza Ampang Jaya, Jalan Mewah 3, 68000 Ampang, Kuala Lumpur, Malaysia.
E-mail: [email protected] 4Department of Ecology and Evolutionary Biology and Biodiversity Institute, University of Kansas, Dyche Hall, 1345 Jayhawk Blvd,
Lawrence, Kansas 66045-7561, USA. E-mail: [email protected] 5Institut Systématique, Evolution, Biodiversité (ISYEB)—UMR 7205, Muséum national d'Histoire naturelle, 25 rue Cuvier, CP 30,
75005 Paris, France. E-mail: [email protected] 625, Jalan 22/38A, Taman Sri Sinar, 51200 Kuala Lumpur, Malaysia. E-mail: [email protected] 7LSU Museum of Natural Science, 119 Foster Hall, Louisiana State University, Baton Rouge, Louisiana 70803, USA.
E-mail: [email protected] 8Corresponding author
Abstract
The family Xenophidiidae is an extremely rare and little-known family of snakes that contains only two species, Xeno-
phidion acanthognathus Günther & Manthey and X. schaeferi Günther & Manthey that are each known only from their
holotypes. We report on the rediscovery of X. schaeferi from two new locations in southern Peninsular Malaysia. The new
specimens differ markedly from the holotype of X. schaeferi in colour pattern and are more akin to the patterning of X.
acanthognathus from Borneo. However, molecular analyses of one of the new specimens reveal that it only differs from
the holotype of X. schaeferi by a minimum sequence divergence of 0.27%. An expanded description of the species based
on these specimens is provided and phenotypic variation within the species is discussed. We also report the first record of
the genus Xenophidion from West Sumatra, Indonesia. These sensational discoveries continue to underscore the fact that
southern Peninsular Malaysia and upland areas of Southeast Asia in general still harbour unrealized herpetological diver-
sity and are still in need of field research-based taxonomic studies.
Key words: Reptile, Squamata, Southeast Asia, Sundaland, endemic, biodiversity, taxonomy
Introduction
The family Xenophidiidae contains two extremely rare species, Xenophidion acanthognathus Günther & Manthey from Borneo and X. schaeferi Günther & Manthey from Peninsular Malaysia, each known only from their holotypes (Günther & Manthey 1995; Stuebing et al. 2014). Very little is known about their ecology but they are believed to be semi-fossorial snakes known to shelter beneath layers of moss covering rocks. Both species occur in lowland forests up to approximately 600 m in elevation (Günther & Manthey 1995; Stuebing et al. 2014). They get their common name, Spine-jawed Snakes from a large pair of spiny projections of the palatine bones that diagnose the family. This, together with the presence of the large tooth in the anterior portion of each lower jaw, suggests they specialise in feeding on slippery prey or those with smooth, hard scales (Günther & Manthey 1995; Stuebing
366 Accepted by T. Nguyen: 16 May 2018; published: 27 Jun. 2018
et al. 2014). These snakes are of great interest to herpetologists who have long worked to resolve the position of their family in higher level snake phylogenies (Wallach & Günther 1998; Lawson et al. 2004).
Two recently collected snake from southern Peninsular Malaysia at Lata Kijang, Jelebu, in the state of Negeri Sembilan and Semenyih, in the state of Selangor were determined to belonged to the genus Xenophidion owing to them having a combination of character states (Günther & Manthey 1995) including the absence of premaxillary teeth; the presence of small, numerous, approximately equal-sized, aglyphous, weakly recurved palatine, pterygoid, and maxillary teeth; maxillae bearing a long, tapering palatine processes (Processus praefrontales), and a broad, long and thin ectopterygoid processes (Processus pterygoideus); ectopterygoids extending nearly to the middle of the maxillae and almost completely adhering to them; dentary with a bent anterior end and significantly enlarged caniniform tooth; undivided nasals extending ventrally from the midline of the rostrum to near the opening of the mouth; internasals absent, probably fused with prefrontals or nasals; prefrontals greatly enlarged, forming the largest scales on the top of the head; all dorsal head shields extending to the three bordering the prefrontals posteriorly approximately the same modest size, the three bordering the prefrontals are enlarged and possibly fused with the preoculars and the frontal (or parts of it); numerous sensory papillae located on most head shields and especially on the labial scales; loreals absent; suboculars absent; dorsal scales keeled with rounded tips; ventrals narrow; anal plate single; and subcaudals undivided. Initially, the identity of these specimens were uncertain as they were similar in colour pattern to X. acanthognathus and in squamation to X. schaeferi. A tissue sample of the specimen from Lata Kijang was sequenced and included in the dataset of Lawson et al. (2004) and subsequently identified as X. schaeferi. We also identify the specimen from Semenyih as X. schaeferi based on its similarities in pholidosis and colour pattern to the specimen from Lata Kijang. Here we expand the description of this rare species based on these additional material and discuss its variation and natural history.
Another Xenophidion was recently photographed at Mount Talakmau, West Sumatra, Indonesia and determined here to belong to the genus Xenophidion based on having undivided nasals; no internasals; greatly enlarged prefrontals forming the largest scales on the top of the head; other dorsal head scales up to the three bordering the prefrontals posteriorly approximately the same modest size, the latter, which are enlarged and possibly fused with the preoculars and the frontal (or parts of it); no loreal or suboculars; dorsal scales with rounded tips; narrow ventrals; anal plate single; and subcaudals undivided (Fig. 4). This is the first record of the genus from Sumatra and the biogeographic significance of this discovery is discussed.
Material and methods
Material examined. Adult male (LSUHC 13481) obtained by Thom Jetten from native collectors that found it on 22 August 2017 near Lata Kijang, Jelebu, Negeri Sembilan, Peninsular Malaysia (N 3.200581, E 101.986279; approximately 800 m in elevation); Adult male (USMHC 2389) found by Kurt Hock Ping Guek on 20 April 2018 at Semenyih, Selangor, Peninsular Malaysia (N 3.058051, E 101.872747; approximately 87 m in elevation); Specimen of unknown sex (LSUDPC 10755–58) that was photographed by Matthew L. Brady and Oscar Johnson on 17 March 2018 at Mount Talakmau, West Pasaman Regency, West Sumatra Province, Indonesia (N 0.0973, E 99.9480; approximately 1075 m in elevation).
Morphological analysis. Morphological and colour pattern data were taken and compared with data reported for the holotypes of X. acanthognathus and X. schaeferi (Günther & Manthey 1995: Table 1). Scale counts and scale nomenclature follow Günther & Manthey (1995). All body measurements were made to the nearest millimeter. The number of ventral scales were counted according to Dowling (1951). The terminal scute (cloacal plate) was not included in the number of ventrals. Dorsal scale row counts are given at one head length behind the head, at mid-body (i.e., at the level of the ventral scale corresponding to one-half of the total number of ventrals), and at one head length anterior to the vent. We considered infralabials as those scales that had more than one-half their length below a supralabial. The values for paired head scales are listed in left/right order. Character abbreviations are adapted from Grismer et al. (2014a) and Günther & Manthey (1995) and include SVL–Snout- vent length (mm), TaL–tail length (mm), TL–total length (mm), ADSR–dorsal scale rows at neck, MDSR–dorsal scale rows at mid-body, PDSR–dorsal scale rows before vent, VEN–number of ventral plates, SubC–number of subcaudal scales, cloacal plate single or divided, L–presence of loreal scales, SL–number of supralabials, SL/Eye– numbers of supralabials entering the orbit, Larg SL–largest supralabial, IL–number of infralabials, IL/1st chin shield–number of infralabials in contact with the anterior chin shield, PreOc–number of preoculars, PostOc–
Zootaxa 4441 (2) © 2018 Magnolia Press · 367XENOPHIDION SCHAEFERI AND FIRST RECORD OF THE GENUS FROM SUMATRA
number of postoculars, SuprOc–number of supraoculars. The museum abbreviations LSUHC refers to La Sierra University Herpetological Collection, La Sierra University, Riverside, California, USA; USMHC refers to Universiti Sains Malaysia Herpetological Collection; and LSUDPC refers to La Sierra University Digital Photographic Collection.
TABLE 1. Comparison of the scalation and colour pattern in the holotypes of X. acanthognathus, X. schaeferi and the
newly collected X. schaeferi specimens (LSUHC 13481 and USMHC 2389) *data obtained from Günther & Manthey
1995, – no data available. Abbreviations are listed in the Materials and Methods.
Molecular analysis. Sequence data from a 1116 base pair fragment of the cytochrome b gene (cyt b) was obtained from Xenophidion schaeferi (LSUHC 13481). The new sequence used in this study is deposited in GenBank (Accession number MH172020).
Mitochondrial DNA was isolated from liver tissue stored in 95% ethanol and extracted using using the Maxwell® RSC Tissue DNA kit on a Promega Maxwell® RSC extraction robot. The cyt b gene was amplified using a double stranded Polymerase Chain Reaction (PCR) under the following conditions: 1.0 µl genomic DNA (concentration 10–30 µg of DNA), 1.0 µl light strand primer (concentration 10 µM) HI4910 5’– GACCTGTGATMTGAAAAACCAYC–3’ (Burbrink 2000), 1.0 µl heavy strand primer (concentration 10 µM) H15720 5’–TCTGGTTTAATGTGTTGTGGT–3’ (Burbrink 2000), 1.0 μl deoxynucleotide pairs (1.5 μM), 2.0 μl 5x buffer (1.5 μM), 1.0 MgCl 10x buffer (1.5 μM), 0.1 μl Promega Taq polymerase (5u/μl), and 7.4 μl H2O. PCR reactions were completed using a Bio-Rad gradient thermocycler under the following conditions: initial denaturation at 95°C for 2 min, second denaturation at 95°C for 35 s, annealing at 49°C for 35 s followed by an extension cycle at 72°C for 95 s + 4 s per cycle for 34 cycles. PCR products were visualized using gel electrophoresis using a 1.0% agarose gel. PCR products that had a distinct band with the correct molecular weight
Characteristics Xenophidion
ADSR 19 – 20 21
PDSR 19 – 18 20
Nasal Undivided Undivided Undivided Undivided
Internasals Absent Absent Absent Absent
SL 8/8 8/8 8/9 8/8
Larg SL 1 & 2/ 1 & 2 1 & 2/ 1 & 2 3/2 2/2
SL/Eye 3–4/3–4 3–4/3–4 3–4/3–5 3–4/3–4
IL 8 or 9 8/8 9/9 8/8
IL/1st chin shield 2/2 2/2 2/2 2/2
PreOc (no.) Present (1/1) Present (1/1) Present (1/1) Present (1/1)
PostOc (no.) Present (2/2) Present (2/2) Present (2/2) Present (2/2)
SuprOc (no.) Present (1/1) Present (1/1) Present (1/1) Present (1/1)
SVL 276 mm 218 mm 239 mm 211 mm
TaL 61 mm 45 mm 51 mm 44mm
TL 337 mm 263 mm 290 mm 255 mm
SVL/TaL 4.52 4.84 4.69 4.79
Yellowish-white
QUAH ET AL. 368 · Zootaxa 4441 (2) © 2018 Magnolia Press
based on the standardized ladder were submitted to GENEWIZ® for PCR purification, cycle sequencing, sequencing clean up, and sequencing. Sequences were analysed from both the 3’ and 5’ ends independently to ensure congruence between the sequences. Both the forward and the reverse sequences were assembled and edited
in GeneiousTM version v6.1.8 (Kearse et al. 2012). We used the BLASTn suite from BLAST® version 2.7.1 (Zhang et al. 2000; Morgulis et al. 2008) to query the nucleotide database to infer what species LSUHC 13481 was genetically related. PAUP* (version 4.0a build 159) was used to calculate uncorrected p-distances.
Results
The results of the nucleotide blast demonstrate that the new sample LSUHC 13481 has an E-value of 0.0 and 99% sequence identity with X. schaeferi (ZMB 50534, AY574279) indicating its conspecificity with ZMB 50534. Molecular analyses also indicate that specimen LSUHC 13481 is conspecific with X. schaeferi with BPP and ML bootstrap values of 1.0 and 100 respectively. In addition, it only differs from the holotype of X. schaeferi by an uncorrected pairwise sequence divergence of 0.27%. The most recently collected specimen, USMHC 2389 is similar in pholidosis and colour pattern with LSUHC 13481 and is considered conspecific (Table 1; Fig. 1). Both new records represent range extensions for the species in Peninsular Malaysia of approximately 40 km to the south and southeast of the type locality. A description of the new specimens is presented below.
The specimen photographed in Sumatra was also determined to belong to the genus Xenophidion based on its combination of characters and we refer to it here as Xenophidian sp. until morphological and molecular examinations can take place.
Description of LSUHC 13481 (Figs. 1 & 2). Head small relative to body, distinct from neck, wedge-shaped in lateral profile with concavity between the eye; eyes small, dorsolaterally oriented, pupils round; snout short and rounded in dorsal profile, rostrum tapers downwards; rostral scale triangular, broader than tall, visible from above; nasals undivided, extending from middle of snout above to nearly the mouth opening below, nares in the distal corners; internasal absent (probably fused with prefrontals or nasals); loreal absent; preocular 1/1, large, extending
dorsally on each side contacting prefrontal, frontal, supraocular, one head scale, 2nd & 3rd supralabial and eye; supraocular 1/1, small; postoculars 2/2, upper smaller than lower; prefrontals two, very large, longer than wide, in broad contact with each other, frontal, preoculars, posterior tip of nasals, and supralabials 1 and 2/1–3; frontal hexagonal, small, less than 0.5 times size of preoculars and less than 0.25 times size of prefrontals; supralabials 8/ 9, largest supralabials 3/2, supralabial entering orbit 3 and 4/3–5; mental groove present; infralabials 9/9, first two in contact with anterior pair of chin shields; body laterally compressed, gradually increasing in circumference from behind neck, reaching its maximum circumference at midbody; dorsal scales keeled, imbricate, 20 ADSR, 21 MDSR, 18 PDSR; 176 ventrals; cloacal plate undivided; and 45 unpaired subcaudal scales. Body long, slender; tail short, tapered; SVL 239 mm; TaL 51mm; TL 290mm.
Colouration in life. LSUHC 13481 (Fig 1A & B): The top of the head is uniform dark-brown with lighter, orange-brown speckling and spots on the rostral, nasal, prefrontals, frontal, preoculars, supraoculars, postoculars, supralabials and other dorsal scales covering the head and neck. Some of the small, light-brown speckles merge to form a faint postocular stripe. The iris is orange. Beginning just posterior to the nape is a light, elongate, yellow- white patch on approximately dorsal scale rows 4–18, approximately five times longer than the head. Within the light-coloured, neck patch are dark speckles along the midline that are more prominent anteriorly. The base colouration of rest the dorsum is grey and is darker along the vertebral scale rows, fading to a lighter silver-grey along the flanks. An irregular, dark-grey, zig-zag stripe runs along the vertebral column starting from the posterior end of the yellow-white neck patch to the tail and it breaks into blotches along the posterior end of the body and tail. Along the upper section of the flanks is a row of large more-or-less rectangular shaped dark-grey markings forming the lower borders of the nape patch and extends to midway down the tail. The bottom edges of some of these markings coalesce to form a series of confluent blotches. Together with the dark, zig-zag, vertebral stripe, these rectangular blotches form two light-coloured, irregularly shaped zig-zag stripes that extend along the length of the body to the tail that are formed by the constriction of the lighter base colour of the dorsum. On the lower flanks, is a row of smaller blotches that tend to alternate with the larger rectangular shaped blotches above and form a chequered pattern along the lower flanks. The infralabials, chin and throat are grey, the ventrals are whitish and marked or chequered with dark-grey, squarish blotches that are either alternate with each other laterally or are confluent to form a single series of ventral markings. Each dark blotch or band is 2–6 ventral scales wide and
separated from each other by another 1–4 ventral scales. The dark ventral markings also extend on to the first row of dorsal scales and may merge with the lower row of small blotches on the lower flanks.
LSUDPC 10755–58 (Fig. 4): The top of the head is uniform dark-grey with lighter, whitish speckling and spots on the rostral, nasal, prefrontals, frontal, preoculars, supraoculars, postoculars, supralabials and other dorsal scales covering the head and neck. Some of the small, light speckles merge to form a faint postocular stripe. The iris is grey. The base colouration of the dorsum is dark-grey and is darker along the vertebral scale rows, fading to a lighter grey along the flanks. An irregular, broad, whitish, zig-zag stripe runs along the vertebral column starting from the nape to the tail and it breaks into blotches along the posterior end of the tail. In the middle of the whitish zig-zag stripe runs a dark-grey zig-zag stripe that breaks up into more-or-less rhomboidal markings along the back. Along the upper section of the flanks is a row of large more-or-less rectangular shaped dark-grey markings starting from the neck to the tail. On the lower flanks, is a row of smaller dark-grey blotches that tend to alternate with the larger rectangular shaped blotches above and form a chequered pattern along the lower flanks. The ventral are whitish and marked with dark-grey, squarish blotches that are either alternate with each other laterally to form a chequered pattern or are confluent to form bands across the venter. A series of dark spots on the middle of each ventral scale form a broken stripe down the middle of the venter and most ventrals are speckled with a few smaller spots along the edges. The dark ventral markings may also extend on to the first row of dorsal scales and merge with the lower row of small blotches on the lower flanks. The infralabials, chin and throat are grey.
Natural history. The Peninsular Malaysian specimens LSUHC 13481 and USMHC 2389 were found at approximately 2100 hours and 2045 hours respectively. Both specimens were found crawling on the ground between the leaf litter in the forest. It had just rained for approximately 30 mins prior to specimen USMHC 2389 being found and conditions were similarly very wet where LSUHC 13481 was found from rain the days before. In addition, USMHC 2389 was found approximately 15 m from a stream and the snake sprung forward repeatedly to try and escape when found, similar to the behaviour observed in Pseudorabdion longiceps (Kurt H.P. Guek pers. obs.; Baker & Lim 2008). The Sumatran specimen was observed at 2045 hours crawling on the ground (Fig. 4A) in slightly disturbed, primary rainforest approximately 15–20 m from a rocky, flowing stream (Matthew L. Brady pers. obs.).
Variation and comparison (Figs. 1–4). Specimen USMHC 2389 closely resembles LSUHC 13481 in overall external morphology, colouration, and patterning (Table 1; Fig. 1). It differs from LSUHC 13481 only by its higher number of anterior (21 vs. 20), mid-body (23 vs. 21) and posterior (20 vs. 18) dorsal rows, lower number of infralabials (8 vs. 9) and a smaller yellowish-white neck patch (3X head length vs. 5X head length).
The most notable difference in the new X. schaeferi specimens (LSUHC 13481 and USMHC 2389) compared to the holotype is their colour pattern. The holotype of X. schaeferi was reported as having a brown base colouration with a solid, dark-brown vertebral stripe beginning on the nape to the posterior end of the body that breaks up into spots on the tail. The vertebral stripe is bordered by wide, yellowish white stripes with wavy borders. Along the flanks are dark-brown lateral markings with triangular points derived from a basal stripe while the ventrals are dark-brown, and at a regular interval series of one to four successive ventrals, their borders display white spots (Günther & Manthey 1995; Fig. 2C). The new specimens LSUHC 13481 and USMHC 2389 have an elongate, yellow-white patch on the neck; an irregular, discontinuous, dark-grey, zig-zag stripe running along the vertebral column starting behind the light-coloured neck patch and extending to the tail; a row of rectangular dark- grey blotches along the flanks; and the ventrals are chequered (see detailed description in section on colouration in life). In addition to colour pattern, LSUHC 13481 differs from the holotype of X. schaeferi by having a lower number of mid-body dorsal scale rows (21 vs. 23), lower number of ventrals (176 vs. 178), higher number of subcaudals (45 vs. 43), higher number of infralabials (9 vs. 8) and the largest supralabials being the 2nd & 3rd vs. 1st
& 2nd. From X. acanthognathus which it resembles in colour pattern, LSUHC 13481 differs in its lower number of mid-body dorsal scale rows (21 vs. 23), lower number of ventrals (176 vs. 181), lower number of subcaudals (45 vs. 51), the largest supralabials being the 2nd & 3rd versus the 1st & 2nd and a larger yellowish-white neck patch (5X head length vs. 3X head length) (Günther & Manthey 1995). USMHC 2389 is more similar in pholidosis with the holotype of X. schaeferi than LSUHC 13481 and only differs from it in having a lower number of ventrals (176 vs. 178) and higher number of subcaudals (45 vs. 43). From X. acanthognathus which it resembles in colour pattern, USMHC 2389 differs by its lower number of ventrals (176 vs. 181), lower number of subcaudals (45 vs. 51) and the higher number of anterior (21 vs. 19) and posterior (20 vs. 19) dorsal scale rows (Günther & Manthey 1995). Other distinguishing characters between LSUHC 13481, USMHC 2389 and the holotypes of X. acanthognathus
and X. schaeferi are presented in Table 1.
FIGURE 1. (A) Dorsum of Xenophidion schaeferi (LSUHC 13481) from Lata Kijang, Negeri Sembilan. (B) Venter of X.
schaeferi (LSUHC 13481) from Lata Kijang, Negeri Sembilan. Photographs by Evan Quah. (C) Dorsum of X. schaeferi
(USMHC 2389) from Semenyih, Selangor. Photograph by Kurt H.P. Guek.
FIGURE 2. (A & B) Number of supralabials and other head scales on X. schaeferi (LSUHC 13481), A: The right side of the
head. B: The left side of the head. F = frontal; IL = infralabial; N = nasal; PF = prefrontal; PO = postocular; PrO = preocular; R
= rostral; SL = supralabial; SO = supraocular. Photographs by Evan Quah. (C) Holotype of X. schaeferi (ZMB 50534) from
near Templer’s Park, Selangor. Photograph courtesy of Wolfgang Grossmann.
FIGURE 3. (A) Xenophidion acanthognathus found in-situ crawling across a fallen log at night at Lambir Hills National Park,
Sarawak. (B) Full body shot of the Xenophidion acanthognathus. (C) Close-up of the head of Xenophidion acanthognathus. All
photographs courtesy of Neil Rowntree.
FIGURE 4. (A) Dorsum of Xenophidion sp. from Mount Talakmau, West Sumatra. Photograph by Matthew L. Brady. (B)
Close-up of the head and (C) Venter of Xenophidion sp. from Mount Talakmau, West Sumatra. Photographs courtesy of Oscar
Johnson.
Based solely off colour pattern, the Sumatran specimen appears somewhat similar to LSUHC 13481, USMHC 2389 and X. acanthognathus minus the white or yellow patch on the neck. It differs from the holotype of X.
schaeferi by its dorsal pattern (more-or-less chequered vs. striped) and ventral pattern (chequered or banded vs. dark-brown with white spots on their borders) (Günther & Manthey 1995). However, as noted in this study, the colour pattern can be very variable in X. schaeferi despite the specimens being genetically similar. Thus, we reiterate that pending the acquisition of a voucher material for detailed examination and molecular comparison, we refer to the Sumatran population as Xenophidian sp..
Discussion
Xenophidion species are extremely rare and have only been observed three times prior to this and the Bornean X.
acanthognathus has only recently been photographed alive (Fig. 3) (Rowntree et al. 2017). Thus, the rediscovery of X. schaeferi and the first record of the genus from Sumatra is especially exciting. The new localities of these X.
schaeferi specimens from Lata Kijang, Jelebu, Negeri Sembilan and Semenyih, Selangor extends the range of this species by approximately 40 km to the southeast and south respectively from the type locality at Templer’s Park,
Selangor which is now reportedly destroyed (Günther & Manthey 1995). In addition, the specimen collected at Lata Kijang from approximately 800 m in elevation significantly extends the elevational range for the species that was previously only known from the lowlands. It also highlights the underestimated diversity remaining in upland regions of southern Peninsular Malaysia and underscores the fact that there is still much left to be discovered (Chan & Norhayati 2009; Grismer & Pan 2008; Grismer et al. 2011). In recent years, other new discoveries made from the state of Negeri Sembilan and other regions of southern Peninsular Malaysia are the new frog, Gastrophrynoides
immaculatus representing the first record of that genus for Peninsular Malaysia (Chan et al. 2009) as well as Ansonia endauensis, Ingerophrynus gollum, Cyrtodactylus majulah, C. pantiensis, C. semenanjungensis,
Dendrelaphis kopsteini, Rhacophorus norhayatii, Microhyla mantheyi, and Kalophrynus limbooliati (Chan & Grismer 2010; Das et al. 2007; Grismer 2006, 2007; Grismer & Leong 2005; Grismer et al. 2008, 2012; Matsui et
al. 2012; Vogel & van Rooijen 2008). Another notable discovery was the genetic similarity between the new X. schaeferi specimen (LUSHC 13481)
and the holotype despite looking very different. This finding demonstrates that the colour pattern in X. schaeferi is variable, and this phenomenon has been observed in other Malaysian snakes, such as Ahaetulla prasina, Boiga
cynodon, B. drapiezii, Chrysopelea paradisi, Dryocalamus subannulatus, Gonyosoma oxycephalum, Oligodon
purpurascens and Naja sumatrana (Baker & Lim 2008; Cox et al. 1998; Grismer 2011; Stuebing et al. 2014; van Rooijen et al. 2011; Wüster & Thorpe 1989). The phenotype of the new specimens is also similar to that of X.
acanthognathus (Fig. 3). This phenotypically similar colour pattern of the new X. schaeferi specimens with that of X. acanthognathus and the very minimal differences in scale counts between them might suggest that these species may possibly be conspecific. Other studies have demonstrated the genetic similarity between populations of certain taxa between Borneo and Peninsular Malaysia especially at the more southerly locations (Chan et al. 2014; Quah et
al. 2017; Wostl et al. 2016, 2017). The relationship of the two species can be tested in the future with the acquisition of genetic material for X. acanthognathus.
FIGURE 5. Distribution map of Xenophidion species. Stars indicate type locality. Circle indicates reported localities.
Also of significance is the discovery of the first specimen of the genus Xenophidion from Sumatra, Indonesia, which is in accord given the past multiple connections between Sumatra, Peninsular Malaysia, and Borneo from the Pliocene onward (Inger & Voris 2001; Voris 2000; Sathiamurthy & Voris 2006; Woodruff 2010). The finding of
Xenophidion sp. from Gunung Talakmau in West Sumatra echoes other recent discoveries of Sundaland amphibian and reptile taxa previously unrecorded from Sumatra such as the frogs of the genus Gastrophrynoides (Matsui et al. 2017) and the gekkonid genus Cnemaspis (Amarasinghe et al. 2015).
The rarity of these snakes still leaves much of their natural history unknown and only anecdotal evidence can be gathered from chance observations. The holotypes of X. acanthognathus and X. schaeferi as well as USMHC 2389 and the Sumatran specimen have been found in the proximity of streams (Günther & Manthey 1995) indicating they may also be semiaquatic. Observations on the movements of LSUHC 13481 and USMHC 2389 on land and in water, lead us to consider that the laterally compressed body of this snake may be an adaptation for swimming. In addition, the flattened shape of the snake’s head and the absence specialised burrowing structures such as reduction of head scales, the inordinately thin neck, and relatively long tail suggests it not a burrower (Inger & Marx 1965). The recent night time sighting of X. acanthognathus crawling on the side of a log in the forest (Fig. 3A) suggests this species may be semi-scansorial, moving through low vegetation and rocks (Rowntree et al. 2017). The food habits of this genus are still completely unknown. Details of the skeletal structure of the skull and internal anatomy of LSUHC 13481 will be treated in a separate paper along with a multilocus phylogeny (Miralles et al. in prep).
Acknowledgements
Our team is grateful to the Department of Wildlife and National Parks, Peninsular Malaysia for issuing us permits P-00074-15-18 and B-00741/13/16 to conduct research. Research work in Malaysia by LLG was supported in part by a grant from the College of Arts and Sciences, La Sierra University, Riverside, California and from a National Geographic Society Explorers Grant, while research by Shahrul Anuar was supported by a Universiti Sains Malaysia Grants (811311 and 870039). Evan Quah would like to thank Tom Charlton for bringing to his attention the discovery of one of new X. schaeferi specimens and his research is partially supported by the USM Postdoctoral scheme. Matthew L. Brady would like to thank Subir Shakya and Prof. Fred Sheldon of LSU for organising and obtaining the funding for the expedition in Sumatra, Indonesian colleagues Andri Saputra and Tri Haryoko of LIPI for help in the field and Yingyod Lapwong who helped with identification on inaturalist. We are also grateful to Neil Rowntree, Oscar Johnson and Wolfgang Grossmann for generously contributing their photographs and to Ulrich Manthey and another anonymous reviewer for the feedback that helped improve the manuscript.
References
Amarasinghe, A.A.T., Harvey, M. B., Riyanto, A. & Smith, E. N. (2015) A new species of Cnemaspis (Reptilia: Gekkonidae)
from Sumatra, Indonesia. Herpetologica, 71 (2), 160–167.
https://doi.org/10.1655/HERPETOLOGICA-D-14-00034
Baker, N. & Lim, K. (2008) Wild Animals of Singapore. A Photographic Guide to Mammals, Reptiles, Amphibians and
Freshwater Fishes. Draco Publishing and Distribution Pte. Ltd. and Nature Society, Singapore, 180 pp.
Cox, M.J., van Dijk, P.P., Nabhitabhata, J. & Thirakhupt, K. (1998) A Photographic Guide to Snakes and Other Reptiles of
Peninsular Malaysia, Singapore and Thailand. New Holland Publishers Ltd., London, 144 pp.
Chan, K.O. & Grismer, L.L. (2010) Re-assessment of the Reinwardt’s Gliding Frog, Rhacophorus reinwardtii (Schlegel 1840)
(Anura: Rhacophoridae) in Southern Thailand and Peninsular Malaysia and its re-description as a new species. Zootaxa,
2505, 40–50.
Chan, K.O., Grismer, L.L., Ahmad, N. & Belabut, D. (2009) A new species of Gastrophrynoides (Anura: Microhylidae): an
addition to a previously monotypic genus and a new genus for Peninsular Malaysia. Zootaxa, 2124 (1), 63–68.
Chan, K.O., Grismer, L.L. & Brown, R.M. (2014) Reappraisal of the Javanese Bullfrog complex, Kaloula baleata (Müller,
1836) (Amphibia: Anura: Microhylidae), reveals a new species from Peninsular Malaysia. Zootaxa, 3900 (4), 569–580.
https://doi.org/10.11646/zootaxa.3900.4.7
Chan, K.O. & Norhayati, A. (2009) Distribution and natural history notes on some poorly known frogs and snakes from
Peninsular Malaysia. Herpetological Review, 40 (3), 294–301.
Das, I., Yaakob, N. & Sukumaran, J. (2007) A new species of Microhyla (Anura: Microhylidae) from the Malay Peninsula.
Hamadryad, 31, 304–314.
Dowling, H.G. (1951) A proposed standard system of counting ventral in snakes. Journal of Herpetology, 1, 97–99.
Grismer, L.L. (2006) A new species of Ansonia Stoliczka, 1870 (Anura: Bufonidae) from a lowland rainforest in southern
Peninsular Malaysia. Herpetologica, 62, 466–475.
https://doi.org/10.1655/0018-0831(2006)62[466:ANSOAS]2.0.CO;2
Grismer, L.L. (2007) A new species of Ingerophrynus (Anura: Bufonidae) from a lowland rain forest in southern Peninsular
Malaysia. Journal of Herpetology, 41, 225–230.
https://doi.org/10.1670/0022-1511(2007)41[225:ANSOIA]2.0.CO;2
Grismer, L.L. (2011) Field Guide to the Amphibians and Reptiles of the Seribuat Archipelago, Peninsular Malaysia. Edition
Chimaira, Frankfurt am Main, 258 pp.
Grismer, L.L., Chan, K., Grismer, J., Wood Jr., P.L. & Belabut, D. (2008) Three new species of Cyrtodactylus (Squamata:
Gekkonidae) from Peninsular Malaysia. Zootaxa, 1921, 1–23.
Grismer, L.L., Grismer, J.L., Wood Jr., P.L., Ngo, V.T. & Chan, K.O. (2011) Herpetology on the fringes of the Sunda Shelf: a
discussion of discovery, taxonomy, and biogeography. Bonner Zoologische Monographien, Bonn, 57, 57–97.
Grismer, L.L, & Leong, T.M. (2005) New Species of Cyrtodactylus (Squamata: Gekkonidae) from Southern Peninsular
Malaysia. Journal of Herpetology, 39 (4), 584–591.
https://doi.org/10.1670/43-05A.1
Grismer, L.L. & Pan, K.A. (2008) Diversity, endemism, and conservation of the amphibians and reptiles of southern Peninsular
Malaysia and its offshore islands. Herpetological Review, 3, 270–281.
Grismer, L.L., Quah, E.S.H., Shahrul, A.M.S., Muin, M.A., Wood Jr., P.L. & Azizah, S.M.N. (2014a) A diminutive new species
of cave-dwelling Wolf Snake (Colubridae: Lycodon Boie, 1826) from Peninsular Malaysia. Zootaxa, 3815 (1), 51–67.
Grismer, L.L., Wood, P.L. Jr. & Lim, K.K.P. (2012) Cyrtodactylus majulah, a new species of bent-toed gecko (Reptilia:
Squamata: Gekkonidae) from Singapore and the Riau Archipelago. The Raffles Bulletin of Zoology, 60 (2), 487–499.
Günther, R. & Manthey, U. (1995) Xenophidion, a new genus with two new species of snakes from Malaysia (Serpentes,
Colubridae). Amphibia-Reptilia, 16 (3), 229–240.
https://doi.org/10.1163/156853895X00028
Inger, R.F. & Marx, H. (1965) The systematics and evolution of the oriental colubrid snakes of the genus Calamaria. Fieldiana:
Zoology, 49, 1–304.
Inger, R.F. & Voris, H.K. (2001) The biogeographical relations of the frogs and snakes of Sundaland. Journal of Biogeography,
28, 863–891.
https://doi.org/10.1046/j.1365-2699.2001.00580.x
Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran,
C., Thierer, T., Ashton, B., Mentjes, P. & Drummond, A. (2012) Geneious basic: an integrated and extendable desktop
software platform for the organization and analysis of sequence data. Bioinformatics, 28 (12), 1647–1649.
https://doi.org/10.1093/bioinformatics/bts199
Lawson, R., Slowinski, J.B. & Burbrink, F.T. (2004) A molecular approach to discerning the phylogenetic placement of the
enigmatic snake Xenophidion schaeferi among the Alethinophidia. Journal of Zoology, 263 (3), 285–294.
https://doi.org/10.1017/S0952836904005278
Matsui, M., Nishikawa, K., Belabut, D., Norhayati, A. & Yong, H. (2012) A new species of Kalophrynus (Amphibia, Anura,
Microhylidae) from Southern Peninsular Malaysia. Zootaxa, 3155, 38–46.
Matsui, M., Yeo, S.T., Nishikawa, K., Zainudin, R., Eto, K. & Hamidy, A. (2017) Biological notes on an enigmatic microhylid,
Gastrophrynoides borneensis (Anura, Microhylidae). Raffles Bulletin of Zoology, 65, 466–473.
Morgulis, A., Coulouris, G., Raytselis, Y., Madden, T.L., Agarwala, R. & Schäffer, A.A. (2008). Database indexing for
production MegaBLASTsearches. Bioinformatics, 24 (16), 1757–1764.
https://doi.org/10.1093/bioinformatics/btn322
Quah, E.S.H., Shahrul Anuar, M.S., Grismer, L.L., Wood Jr., P.L., Siti Azizah, M.N. & Muin, M.A. (2017) A new species of
frog of the genus Abavorana Oliver, Prendini, Kraus & Raxworthy 2015 (Anura: Ranidae) from Gunung Jerai, Kedah,
northwestern Peninsular Malaysia. Zootaxa, 4320 (2), 272–288.
distribution. Herpetological Review, 48 (1), 132–133.
Sathiamurthy, E. & Voris, H.K. (2006) Maps of Holocene sea level transgression and submerged lakes on the Sunda Shelf.
Natural History Journal of Chulalongkorn University, 2, 1–43.
Stuebing, R.B., Inger, R.F. & Lardner, B. (2014) A field guide to the snakes of Borneo. 2nd Edtion. Natural History Publications
(Borneo), Kota Kinabalu, 310 pp.
Swofford, D.L. (2002) Phylogenetic analysis using parsimony. Sinauer Associates Inc, Sunderland, MA. [software]
van Rooijen, J., Wood Jr., P.L., Grismer, J.L., Grismer, L.L. & Grossmann, W. (2011) Colour pattern dimorphism in the
colubrid snake Oligodon purpurascens (Schlegel, 1837) (Reptilia: Squamata). Russian Journal of Herpetology, 18 (3),
215–220.
Vogel, G. & van Rooijen, (2007) A new species of Dendrelaphis (Serpentes: Colubridae) from Southeast Asia. Zootaxa,
1394, 25–45.
Biogeography, 27, 1153–1167.
https://doi.org/10.1046/j.1365-2699.2000.00489.x
Wallach, V. & Günther, R. (1998) Visceral anatomy of the Malaysian snake genus Xenophidion, including a cladistics analysis
and allocation to a new family (Serpentes: Xenophidiidae). Amphibia-Reptilia, 19, 385–404.
https://doi.org/10.1163/156853898X00052
Woodruff, D.S. (2010) Biogeography and conservation in Southeast Asia: how 2.7 million years of repeated environmental
fluctuations affect today's patterns and the future of the remaining refugial-phase biodiversity. Biodiversity and
Conservation, 19, 919–941.
https://doi.org/10.1007/s10531-010-9783-3
Wostl, E., Riyanto, A., Hamidy, A., Kurniawan, N., Smith, E.N. & Harvey, M.B. (2017) A taxonomic revision of the Philautus
(Anura: Rhacophoridae) of Sumatra with the description of four new species. Herpetological Monographs, 31, 98–141.
https://doi.org/10.1655/HERPMONOGRAPHS-D-16-00007
Wostl, E., Sidik, I., Trilaksono, W., Shaney, K.J., Kurniawan, N. & Smith, E.N. (2016) Taxonomic Status of the Sumatran
Pitviper Trimeresurus (Popeia) toba David, Petri, Vogel & Doria, 2009 (Squamata: Viperidae) and Other Sunda Shelf
Species of the Subgenus Popeia. Journal of Herpetology, 50 (4), 633–641.
https://doi.org/10.1670/15-045
Wüster, W. & Thorpe, R.S. (1989) Population affinities of the Asiatic cobra (Naja naja) species complex in south-east Asia:
reliability and random resampling. Biological Journal of the Linnean Society, 36, 391–409.
https://doi.org/10.1111/j.1095-8312.1989.tb00503.x
Zhang, Z., Schwartz, S., Wagner, L. & Miller, W. (2000) A greedy algorithm for aligning DNA sequences. Journal of
Computational Biology, 7 (1–2), 203–214.
https://doi.org/10.1089/10665270050081478
Abstract
Introduction

Documents

4441 (2): 366 378 Article ZOOTAXA