4. Isolation of Wolbachia from Trichogramma …shodhganga.inflibnet.ac.in/bitstream/10603/51398/9/09_chapter4.pdf · 4. Isolation of Wolbachia from Trichogramma pretiosum – culturing

4. Isolation of Wolbachia from Trichogramma pretiosum – culturing

and preparation for transmission studies

Rijesh, K. and Swaminathan, K.

Department of Microbial Biotechnology, Bharathiar University, Coimbatore

Abstract

Maternally inherited Wolbachia induces sex manipulations in the host insect.

Parthenogenesis induced by Wolbachia is exploited in biological control programs to

increase the number of females in the population of biocontrol agents such as

Trichogramma. Trichogramma is very species specific and was not detected across

the species. In the present study, Wolbachia detected in T. pretiosum of Andhra

Pradesh population was isolated and cultured in Sf21 ovarian cell line, since the

bacterium is an obligatory intracellular endosymbiont. The survival of bacterium was

estimated by semi quantitative RT PCR was found to be 5-7 days after which the

bacterium was expelled from the cells. The metabolic activity of the infected Sf21

was also analyzed by MTT assay to see the effect of infectin in the cell line. For long

trerm use of Wolbachia in transmission studies, cryopreserved Wolbachia was viable

after the storage for six months and could establish infection in Sf21 cell lines.

Key words: Semi quantitative RT PCR, MTT, Sf21 cell lines, Shell vial technique,

cryopreservation

4.1. Introduction

Wolbachia are a group of endosymbiotic bacteria first reported in 1924 by

Marshall Hertig an entomologist and Samuel Wolbach, a pathologist, through a

collaborative study on the presence and identification of microorganisms in

arthropods (Hertig and Wolbach, 1924). Wolbachia is one of the most common

parasitic microbes of many arthropods, nematodes and insect species. A survey

conducted by a team of scientists detected Wolbachia in 16.9% of insect species

which corresponds to a total number of 1.69 – 5.07 million insect species present

globally (Werren et al., 1995).

The maternally inherited Wolbachia, for its obligatory intracellular nature

cannot be cultured in any artificial medium and requires established cell line for

culture and maintenance (Munderloh and Kurtti, 1995). The inability to culture these

81

Please purchase PDF Split-Merge on www.verypdf.com to remove this watermark.

bacteria outside of the invertebrate host has also led to the existing bias of Wolbachia

research towards infections that occur in host insects that are easily reared. A

continuous cell line was established from the eggs of Aedes albopictus tiger mosquito

naturally infected with Wolbachia (O‘Neill et al., 1997). In vitro cultivation of

various strains of Wolbachia was achieved by (Dobson et al., 2002) using several

insect cell lines. Shell vial technique, a diagnostic protocol to detect rickettsial

infection was used to introduce Wolbachia in cell lines. In this technique the

bacterium is centrifuged onto a monolayer of uninfected cells, for the initial

establishment of infection. This method requires rather large quantities of infected

host materials for in vitro infection. Wolbachia infect small-sized arthropods;

therefore it is often difficult to obtain sufficient amount of host materials and to keep

whole sample materials from other bacterial contaminants. Later, a simplified

protocol of infecting Wolbachia was introduced by Noda et al., (2002), overlaying the

homogenate of plant hopper ovary on two insect and one mammalian cell lines to

establish infection. The infection was confirmed visually by electron microscopy and

ftsZ diagnostic PCR. Wolbachia apparently have a broader in vitro host range, as

suggested by Dobson et al., (2002). Wolbachia was also cultured in human embryonic

lung fibroblast cell lines (Fenollar et al., 2003) confirming that the host cell range is

broader than initially thought.

The need for horizontal transfer of Wolbachia bacterium between invertebrate

host hinges on the ability to adapt to new intracellular environments (McMeniman et

al., 2008). The experimental transfer of Wolbachia between distantly related host

species often results in the loss of infection, presumably due to an inability of

Wolbachia to adapt quickly to the new host. McMeniman et al., (2008) cultured a life

shortening Wolbachia from Drosophila in cell lines derived from A. albopictus

mosquito. After several serial passages in the cell line, the bacterium was reintroduced

to its native host and observed that the ability to cause life-shortening infection and

cytoplasmic incompatibility have reduced compared to the original strain. This study

suggests that for horizontal transfer Wolbachia should not be maintained in the cell

lines for several passages.

Fallon (2008) studied the cytological properties of mosquito cell line infected

with Wolbachia and observed that the cells grew as patchy monolayers comprising of

non-contiguous clusters of cells that give rise to solid clumps of tightly adherent cells.

82


He also observed free floating multicellular clumps in the medium. The presence of

Wolbachia was monitored by PCR amplification of specific genes and the cytological

properties did not alter even after the removal of bacterium by antibiotic treatment.

Since few of the Wolbachia infected cells detach from the surface and float in

the medium, quantification is impossible. Fallon and Hellestad (2008) performed an

assay based on conversion of methylthiazole tetrazolium [MTT; 3-(4, 5-

dimethylthiazole-2-yl)-2,5-dipheny tetrazolium bromide] to a colored formazan

product in the mitochondria of cells. This MTT assay also reflects the mitochondrial

function (Berridge et al., 2005) and hence tetrazolium dyes are widely used as

indicators of cell metabolism.

The objective of the present study is to isolate the Wolbachia detected in

Trichogramma pretiosum, purify and culture in Sf21 (Spodoptera frugiperda) insect

ovarian cell line. The viability of the bacterium in the cell line was checked and

cryopreserved for long term use.

4.2. Material and methods

4.2.1. Wolbachia isolation from Trichogramma pretiosum

Wolbachia was isolated from T. pretiosum infested Corcyra eggs. Infested

Corcyra eggs were collected after six days of infestion, aseptically surface sterilized

with 1% sodium hypochlorite and then washed twice with 70% ethanol. To remove

the ethanol content, the eggs were rinsed twice with serum free Grace‘s insect

medium. The eggs were then individually crushed in 200µl of fresh serum free

Grace‘s insect medium, transferred and homogenized for 10 strokes in a 0.1ml

homogenizer (Wheaton, USA). The suspension was centrifuged at 2500 rpm for 3

minutes to pellet the egg debris and filtered through a 5µm filter (Merck Millipore,

Germany). The filtrate is then centrifuged at 11000 rpm for 5 minutes through a

250mM sucrose gradient. The Wolbachia pellet was suspended in 100 µl medium and

was used for infecting the Sf21 insect ovarian cell lines

4.2.2. Sf21 insect ovarian cell line maintenance and infection of Wolbachia

Spodoptera frugiperda (Sf21) ovarian cell line procured from National Centre

for Cell Science (NCCS), Pune, India was maintained in Grace‘s Insect medium

83


(HiMedia Laboratories, India) supplemented with 10% Fetal Bovine Serum (FBS)

and without any antibiotics. The cells on attaining confluence were sub-cultured by

sloughing with a micropipette and were incubated at 28oC in a CO2 independent

incubator.

Wolbachia infection was done by a modified Shell vial technique. The isolated

Wolbachia suspension (100 µl) was transferred and mixed in 2ml of medium

containing 60% confluent Sf21 cells maintained in a 25cm2 culture flask. The flask

was centrifuged in bucket rotor (Hettich) with proper balance at 2500rpm for 15

minutes at 15oC. After centrifugation, 5ml of fresh culture medium was added to the

flask and kept for incubation for 24 hours. As a control, Sf21 cells were added with

100 µl of sterile water and followed the same infection process.

4.2.3. Detection of Wolbachia by Microscopy and PCR

Wolbachia infected cell lines were observed for surface granulation in an

inverted microscope (Olympus IX70) at 4x and 10x magnification.

The Wolbachia infected Sf21cell line was slowly flushed out to a microfuge

tube and centrifuged at 2000rpm for 2 minutes at room temperature. The pellet was

washed twice with 1X Phosphate buffer saline (8g of NaCl, 0.2g of KCl, 1.44g of

Na2HPO4, 0.24g of KH2PO4 in 800 ml of distilled water and autoclaved. pH 7.4). The

pellet was then suspended in 100µl of STE buffer (100mM-NaCl, 10mM-TrisCl,

10mM-EDTA) and quickly freeze thawed twice in liquid Nitrogen. The suspension

was then homogenized in a 0.1ml homogenizer for 10 strokes and centrifuged at

3000rpm for 2 minutes. The supernatant was transferred to a fresh vial and added with

double the volume of ethanol and incubated at -20oC for 2h. After incubation, it was

centrifuged at 12000rpm for 10min at 4oC. The pellet was suspended in 20µl of TE

Buffer. Fifty nano grams of T. pretiosum DNA isolated by above method was used for

detecting the presence of Wolbachia in all the populations. T. embryophagum which

naturally harbors Wolbachia is considered as a positive control for the PCR based

detection. Specific Wolbachia Surface Protein (wsp) primers (Forward- 81F

5‘TGGTCCAATAAGTGATGAAGAAAC-3‘, Reverse- 691R

5‘AAAAATTAAACGCTACTCCA-3‘) were used for the detection and confirmation.

The PCR reaction was carried out in a 25µl reaction volume with 1x PCR buffer,

2.5mM dNTPs, 10pM of forward and reverse primer and 1U of Taq polymerase

84


(NEB, England). The amplification conditions for wsp was 3 min initial denaturation

at 94oC followed by 35 cycles of 1min denaturation at 94

oC, 1min annealing at 53

oC

and 1min elongation at 72oC. The PCR amplicon was excised from the gel using

Qiaex II Gel Extraction Kit (Qiagen, India) following manufacturers instruction. The

extracted product was then sequenced at Chromous Biotech, India by Sanger‘s

method.

4.2.4. Growth curve of Wolbachia in Sf21 cell line

Sf21 cell lines were infected with Wolbachia as above in multiple flasks and

were incubated for 1, 3, 5, 7, 9, and 10 days. After the respective day of incubation,

infected cells were collected, pelleted and suspended in 1ml of TRI Reagent (Sigma

Aldrich, India) and RNA was isolated as per manufacturer‘s protocol. The cells in

TRI were freeze thawed multiple times in liquid nitrogen to make sure proper rupture

of cells.

To synthesize first strand cDNA, 5µg of RNA was added with 2µl of oligo dT

and incubated at 65ºC for 15min and immediately transferred to ice. Two microlitres

of 10mM dNTP mix, 5µl of M-MLV buffer and 5 units of M-MLV reverse

transcriptase were added and the reaction volume made up to 25µl. The reaction

mixture was incubated at 42ºC for 90 min. The enzyme was inactivated by adding

0.5mM of EDTA and incubating at 75ºC for 15 min. A control reaction without

reverse transcriptase was performed to examine the DNA contamination. Twenty five

ng of cDNA was taken for the semi-quantitative RT PCR with wsp primers as per the

above PCR conditions. A set of primers were developed for Spodoptera actin

(Forward 5’ ACG ATA TGG AGA AGA TCT GGC 3’ and Reverse 5’ GGC GTA GCC

CTC GTA GAT 3’) to use as an internal control with the same parameters except the

annealing temperature of 48ºC. The amplicons were analyzed in an agarose gel

electrophoresis. The intensity of bands at different days was quantified using UVI

BANDMAP software (Uvipro Platinum, Cambridge, UK). A growth curve was

plotted for the values obtained.

4.2.5. Metabolic analysis of Wolbachia infected Sf21 cell lines by MTT assay

The Sf21 cells were plated in 35 mm culture plates with 2ml of Grace‘s

Insect medium with FBS. Wolbachia was isolated as previous and infected the cell

85


lines as described above and incubated for 11 days. MTT (3-(4,5-dimethylthiazol-2-

yl)-2,5-diphenyltetrazolium bromide, Sigma) was dissolved in Phosphate buffered

saline (PBS) at a concentration of 5mg/ml. MTT (100 µl) was added to infected cells

at 1, 3, 5, 7, 9 and 10 days of incubation and were incubated for 1h. The cells were

directly suspended in the medium by sloughing with a micropipette and then collected

by centrifuging at 10000rpm for 5 min in a 2 ml microfuge tube. The supernatant was

discarded and the pellets were stored at -20oC until processed in acid isopropanol.

One ml of acid isopropanol (0.04N HCl in isopropanol) was added to the

pellets and incubated at 50oC for 15min to 30 min with intermittent vortexing, to

leach the formazan product. The tubes were centrifuged at 10000 rpm for 5 min to

clarify the supernatant by pelleting the white cellular debris. The supernatant was

measured at 570nm in a spectrophotometer against an acid isopropanol blank.

4.2.6. Cryopreservation of Wolbachia

Wolbachia infected by above mentioned method, after incubating for 24h was

collected by gently sloughing the cells in a 2ml of spent medium and transferred to a

sterile centrifuge tube. The cells were collected by spinning at 500rpm for 2mins to

the pellet 1ml of freezing medium (60% Grace‘s Insect medium, 30% of FBS, 10% of

DMSO) was added and mixed gently. It was then transferred to a sterile Cryovial

(Nunc) and transferred to a Cryocooler (Thermo Fischer) kept at -80oC for four hours.

The cryo-cooler decreases the temperature gradually at 1oC/min. After 4h incubation,

the cryo-vial was immediately transferred to cryo-can containing liquid Nitrogen.

4.2.7. Viability confirmation of cryopreserved Wolbachia

The Wolbachia infected Sf21 cell preserved in liquid Nitrogen was taken after

three months and immediately thawed at 37oC and transferred to a centrifuge tube

containing 9ml of fresh Grace‘s Insect medium. After mixing gently, it was then spun

at 500rpm for 2 min. The pellet was suspended in 200µl of fresh media and

homogenized in a 0.1ml homogenizer for 10 strokes. The suspension was spun at

1000 rpm for 5 min and supernatant transferred to a fresh tube. This supernatant was

used to infect previously seeded Sf21 cell lines as per Shell vial technique.

86


After 24h of incubation, the cells were observed for granulation and viability

of Wolbachia was analyzed by isolating RNA using TRI reagent and performing wsp

PCR.

4.3. Results

4.3.1. Sf21 insect ovarian cell line maintenance and infection of Wolbachia

The Sf21 cell lines received was a healthy monolayer of small spherical cells

of different sizes (Fig.1). Aseptically, the medium was aspirated and discarded and

the monolayer cells were dislodged into 5 ml of fresh Grace‘s media. The cells were

counted in a hemocytometer and 1x106 cells/ml was transferred to a pre-wet 25cm

2

flask, added with 5 ml of fresh medium and incubated at 27oC. On reaching

confluency cells were harvested and 1x107cells were transferred to 1 ml of freezing

medium and stored in liquid nitrogen. Sufficient stocks were maintained for future

use.

The Sf21 cell lines after infection by Shell vial technique was immediately

kept at 27oC for an hour to recover from any mechanical stress occurred during the

process. After an hour, cells remained healthy and were adhered to the bottom

surface.

Fig. 1: Sf21 cell lines uninfected

87


4.3.2. Detection of Wolbachia by Microscopy and PCR

After 24h of incubation the infected cells were observed for any

morphological changes on the cell surface. Uniform sized unevenly distributed

granules were observed on all the cells (Fig. 2) at 10x magnification, whereas

granulation was not observed in the mock infected Sf21 cells (Fig. 3)

Fig. 2: Sf21 cell line showing granulation- an indication of Wolbachia

Fig. 3: Mock-infected Sf21 cell lines showing no granules

88


The confirmatory wsp PCR from the DNA isolated from infected Sf21 cell lines

amplified a 600 bp (Fig. 4) product. The nucleotide sequence of the PCR product

eluted from gel and sequenced by Sanger‘s method was found to be the same as that

obtained from the wsp sequence of T. pretiosum (*Supporting information 1).

Fig. 4: wsp PCR produce an amplicon of 600bp

4.3.3. Growth curve of Wolbachia in Sf21 cell line

The RNA extracted by TRI reagent was analyzed in a denaturing agarose gel

to confirm the RNA intact (Fig.5, 6). RNA was resolved completely and 28S & 18S

subunits were of good quality without any degradation. The wsp PCR performed after

first strand cDNA synthesis produced bands of different intensities with a high

intensity band on day1, 3 and 5 and with a gradual decrease towards later incubation

periods (Fig. 7). A graph plotted for the measured intensity of the bands using UVI

BANDMAP software showed a growth curve with log, stationary and decline phase.

The Sf actin PCR for the corresponding days showed a steady growth but a slow

decline towards the end (Fig. 8, 9).

89


Fig. 5: RNA extracted from Wolbachia Uninfected Sf21cell lines

Fig. 6: RNA extracted from Wolbachia infected Sf21cell lines

Fig. 7: wsp PCR showing the growth curve of Wolbachia

Fig. 8: Sf actin PCR of Wolbachia infected and uninfected Sf21 cell lines

90


Fig. 9: Growth curve of Wolbachia infected and uninfected Sf21 cell lines

4.3.4. Metabolic analysis of Wolbachia infected Sf21 cell lines by MTT assay

The Wolbachia infected Sf21 cells in the culture plates were added with MTT

at 1, 3, 5, 7, 9 and 10 days of incubation post infection. It was observed that, though

there were multiple cell aggregates at certain places the MTT staining was found to be

uniform under microscopic observation in these clusters. After incubation for

indicated time, the cells were dislodged in 2ml media and centrifuged to collect the

cells. The formazan product was leached from the pellet by adding acid isopropanol to

the colored cell pellet. The colored supernatant transferred to a cuvette was measured

at 570 against an acid isopropanol blank. A graph plotted (Fig.10) for the values

showed an initial increase of metabolic activity in infected cells followed by an

immediate drop. Whereas, in uninfected cell line the metabolic activity increased until

5 days of incubation but a gradual decrease was observed beyond 5 days of

incubation.

4.3.5. Viability confirmation of cryopreserved Wolbachia

Wolbachia infected cells stored in liquid nitrogen (Fig. 11) for 3 months were

thawed to room temperature and Wolbachia was isolated from the cells. When this

Wolbachia was added to fresh Sf21 cells, established granulation, revealing successful

infection. The wsp PCR performed from the cDNA prepared from the RNA extracted

91


from the re-infected cells amplified a 600bp suggesting the presence of Wolbachia

(Fig.12).

Fig. 10: MTT assay of Wolbachia infected and uninfected Sf21 cells showing the

metabolic activity.

Fig. 11: Cryovial containing Wolbachia culture suspended in freezing medium

Fig. 12: Wsp PCR detecting the presence of Wolbachia in cryopreserved Sf21 cells

and Wolbachia granulation in fresh Sf21 cells.

92


4.4. Discussion

Horizontal transmission of Wolbachia in non-harboring Trichogramma spp.

can be of immense use in biological control. Wolbachia cannot be cultured in an

artificial medium because for its obligate intracellular nature; it needs to be cultured

in an established cell line (Munderloh and Kurtti, 1995). Cytoplasmic incompatibility

inducing Wolbachia infected cell line was established from Aedes albopictus (O‘Neill

et al., 1997), and the diverse host range of Wolbachia has also been studied (Dobson

et al., 2002). Initial efforts to establish Wolbachia infected cell line from

Trichogramma were unsuccessful because of high contamination rate. Ovarian cell

line of Spodoptera frugiperda (Sf21) was established (Vaughn et al., 1977) and was

widely used for virus mediated transfer of genes for protein expressions (Davis et al.,

1993).

Wolbachia isolation from the adult T. pretiosum when infected to Sf1, resulted

in nematodal and bacterial contamination, hence a protocol for isolationof Wolbachia

from Corcyra eggs after six days of Trichogramma infestation, was standardized.

Shell vial technique as described by Dobson et al., (2002) to infect Wolbachia, was

modified accordingly and employed in the present study. To relieve the Wolbachia

infected cell lines from physical stress acquired during the infection process, it was

left undisturbed in the incubator for two hours and later supplemented with the

medium. No cytological difference was observed for the first 18 hours after infection.

Granulation appeared on the cell surface after 24 hours of incubation in microscopic

observation, whereas mock infected Sf21 cell lines appeared normal without any

granulation.

The standard wsp PCR based approach to detect the Wolbachia presence in

Sf21, amplified the expected band and the sequence information matched with that of

the Wolbachia present in T. pretiosum. After successful infection, the long term

persistence of Wolbachia in the cell lines was observed. Wolbachia cultures

maintained in Sf21 gradually decreased granulation, generated floating clusters of

cells indicating Wolbachia expulsion from the cells and this showed the instability of

Wolbachia in the new host (McMeniman et al., 2008).

Detecting the Wolbachia presence in the subsequent passages of infected cell

line ended up with wrong conclusion, as DNA was intact in the dead cells.

93


Alternatively, cDNA was prepared from isolated mRNA of infected cells proved to be

best method to analyze the viability of infected cell lines. Because Wolbachia was

immediately expelled on subsequent sub-culturing and since the newly adapted

Wolbachia fails to induce its property in transmitted host, the long term persistence of

bacterium in the cell line was seen by incubating the infected cell line for a series of

days and by establishing a growth curve.

The band intensity of wsp amplicon started declining after 5 days post

infection, suggesting a decrease in the Wolbachia density and after 9 days of

incubation Wolbachia could not be detected. An internal control specifically designed

to amplify Spodoptera actin exhibited brighter bands on the later days of incubation

providing evidence on the viability of the Sf21 cell lines.

Alternative to the use of radiolabelled substrates, to evaluate the metabolic

activity of cells, MTT based assay was developed (Fallon and Hellestad, 2008). MTT

assay reflects the metabolic activity of cells and the growth curve established

indicated that metabolic activity of Sf21 remains viable even after incubation for a

series of days on post infection. Since the bacterium was expelled from the cell lines,

the Wolbachia was cryopreserved in freezing medium for transmission studies. It was

observed that the bacterium remained viable after six months of storage and could

reinfect fresh Sf21 cel lines. This suggests the possibilities of using cryopreserved

Wolbachia for transmission studies.

4.5. Conclusion

In the present study, Wolbachia present in T. pretiosum was isolated and

cultured in Sf21 insect ovarian cell lines. The growth curve was estimated and

observed that the bacterium is viable in the cell line for 5-7 days. The metabolic

activity of the infected cells was assayed by MTT method. From this observation it

was clear that Wolbachia infection is considered to be a pathogenic infection and the

host immune system either kills or expels out the bacterium form the cells. Hence,

Wolbachia multiplied in Sf21 was to be cryopreserved for long term for transmission

studies.

94


4.6. References

Berridge, M. V., Herst, P. M., & Tan, A. S. (2005). Tetrazolium dyes as tools in cell

biology: new insights into their cellular reduction. Biotechnology Annual Review, 11,

127–152. doi:10.1016/S1387-2656(05)11004-7

Davis, T. R., Wickham, T. J., McKenna, K. A., Granados, R. R., Shuler, M. L., &

Wood, H. A. (1993). Comparative recombinant protein production of eight insect cell

lines. In Vitro Cellular & Developmental Biology - Animal, 29(5), 388–390.

doi:10.1007/BF02633986

Dobson, S. L., Marsland, E. J., Veneti, Z., Bourtzis, K., & O‘Neill, S. L. (2002).

Characterization of Wolbachia host cell range via the in vitro establishment of

infections. Applied and Environmental Microbiology, 68(2), 656–660.

doi:10.1128/AEM.68.2.656-660.2002

Fallon, A. M. (2008). Cytological properties of an Aedes albopictus mosquito cell line

infected with Wolbachia strain wAlbB. In Vitro Cellular & Developmental Biology.

Animal, 44(5-6), 154–161. doi:10.1007/s11626-008-9090-4

Fallon, A. M., & Hellestad, V. J. (2008). Standardization of a colorimetric method to

quantify growth and metabolic activity of Wolbachia-infected mosquito cells. In Vitro

Cellular & Developmental Biology. Animal, 44(8-9), 351–356. doi:10.1007/s11626-

008-9129-6

Fenollar, F., La Scola, B., Inokuma, H., Dumler, J. S., Taylor, M. J., & Raoult, D.

(2003). Culture and phenotypic characterization of a Wolbachia pipientis isolate.

Journal of Clinical Microbiology, 41(12), 5434–5441. doi:10.1128/JCM.41.12.5434-

5441.2003

Hertig, M., & Wolbach, S. B. (1924). Studies on Rickettsia-like micro-organisms in

insects. The Journal of Medical Research, 44(3), 329–374.7.

McMeniman, C. J., Lane, A. M., Fong, A. W. C., Voronin, D. A., Iturbe-Ormaetxe, I.,

Yamada, R., O‘Neill, S. L. (2008). Host adaptation of a Wolbachia strain after long-

term serial passage in mosquito cell lines. Applied and Environmental Microbiology,

74(22), 6963–6969. doi:10.1128/AEM.01038-08

Munderloh, U. G., & Kurtti, T. J. (1995). Cellular and molecular interrelationships

between ticks and prokaryotic tick-borne pathogens. Annual Review of Entomology,

40(1), 221–243. doi:10.1146/annurev.en.40.010195.001253

95


Noda, H., Miyoshi, T., & Koizumi, Y. (2002). In vitro Cultivation of Wolbachia in

Insect and Mammalian Cell Lines. In Vitro Cellular & Developmental Biology.

Animal, 38(7), 423–427.

O‘Neill, S. L., Pettigrew, M. M., Sinkins, S. P., Braig, H. R., Andreadis, T. G., &

Tesh, R. B. (1997). In vitro cultivation of Wolbachia pipientis in an Aedes albopictus

cell line. Insect Molecular Biology, 6(1), 33–39.

Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., & McCawley, P. (1977). The

establishment of two cell lines from the insect Spodoptera frugiperda (lepidoptera;

noctuidae). In Vitro, 13(4), 213–217. doi:10.1007/BF02615077

Werren, J. H., Windsor, D., & Guo, L. (1995). Distribution of Wolbachia among

Neotropical Arthropods. Proceedings of the Royal Society of London. Series B:

Biological Sciences, 262(1364), 197–204. doi:10.1098/rspb.1995.0196

96


*Supporting information (wsp sequence of Wolbachia present in T. pretiosum)

TGGTCCAATAAGTGATGAAGAAACTAGCTACTACGTTCGTTTACAATACAACGGTGAAAT

TTTACCTTTTTATACAAAAGTTGATGGTATTAAAAATGCAACAAGTAAAGAGAAGGATAG

TCCTTTAAAAAGATCTTTTATAGCTGGTGGTGTTGCGTTTGGTTATAAAATGGATGACAT

CAGAGTTGATGTTGAAGGGCTTTACTCACGATTGGCTAAAAATAAAGCTGTAATAGATGC

TTCTGAAGCAAATGTTGCAGACAGTTTAACAGCATTTTCAGGATTGGTTAACGTTTATTA

TGATATAGTGATTGAAGATATGCCTATCACTCCATACGTTGGTGTTGGTGTTGGTGCAGC

ATATATCAGCAATCCTTCAAACGCTGCTGACGTTAAAGATCAAAGGAGATTTGGTTTTGC

TTATCAAGCAAAAGCTGGTGTTAGTTATGATGTAGCCCCAGAAAACAAACTCTTTGCTGG

AGCTCGTTACTTCGGTTCTTATGGTGCTAGTTTTGATAAGGCAGCTAAGGGTGATGATGG

TATCAAAAATATTCTTACAACACTTGTGCAGAGCCT

97


Documents

4. Isolation of Wolbachia from Trichogramma …shodhganga.inflibnet.ac.in/bitstream/10603/51398/9/09_chapter4.pdf · 4. Isolation of Wolbachia from Trichogramma pretiosum – culturing