66

with A. hydrophila biofilm with increased antibody production and protection in three

species of Indian major carps.

The antigenic diversity of A. hydrophila has posed a great difficulty in developing a

vaccine, and at present, no vaccine for protection against A. hydrophila is commercially

available. In this situation, the search for common protective antigens of A. hydrophila

becomes critical for developing a common vaccine against this bacterium. One of the

potential candidates of conserved antigens is the outer membrane component of this

bacterium which is involved in the adherence and invasion of fish. Fang et al. (2000)

characterized a 43Kda adhesin which could provide protective immunity to fish (blue

gourami) against A. hydrophila and Vibrio spp. in vivo. Rekha et al. (2007) immunized

Indian major carp, Labeo rohita Hamilton using a purified 37 kDa temperature sensitive

OMP (OMP TS) of A. hydrophila. The protein induced antibodies with mean titers of

1:4000 on day 14 and 1:12,000 on day 28 indicating that the protein is highly immunogenic

in fish and that the gene is a potential candidate for vaccine development.

III. MATERIALS AND METHODS

3.1. Isolation and identification of A. hydrophila

The isolates used in the study were obtained from diseased and moribund

freshwater fish (Labeo rohitha) exhibiting tail rot and fin rot. The generic level

identification of Aeromonas group was performed as per the scheme proposed by Bain

& Shewan (1968) Le Chevallier et al., (1980) (Fig. 1 & 2).

The species level differentiation of A. hydrophila from other Aeromonas spp was

carried out as previously described by and and Popoff & Lallier (1984), Abbott et al

(2003) and Martin-Carnahan and Joseph (2005) (Table 8). All these cultures were

67

routinely maintained in tryptic soya broth (TSB) or on tryptic soya agar (TSA) at 37

ºC and stock cultures were kept in a suspension of TSB with 30% glycerol and stored

at -80ºC.

Tryptone soya broth (TSB)

Tryptone 17.0 g

Soya peptone 3.0 g

Sodium chloride 5.0 g

Dipotassium phosphate 2.5 g

Distilled water 1L

Final pH 7.2+0.2

The ingredients were dissolved in distilled water, dispensed into tubes and flasks

according to the volume required and sterilized by autoclaving at 121 ºC for 15min.

Tryptone soya agar (TSA)

Tryptone 15.0 g

Soya peptone : 5.0 g

Sodium chloride : 5.0 g

Agar : 15.0 g

Distilled water: 1L

Final pH : 7.2+0.2

The ingredients were dissolved in distilled water, sterilized by autoclaving at 121 ºC for

15 min and poured into plates.

Isolation and identification of aeromonads is done by carrying out a series of

biochemical tests as described by Bain and Shewan (1968), Holding and Collen (1971)

and MacFaddin (1990).

3.1.1. Gram staining

68

Huckers modification of Gram staining was followed. The stained smears were

observed under oil immersion objective to record the Gram reaction and only Gram

negative isolates were further proceeded with.

Crystal Violet

Solution A

Crystal violet 2.0 g

Ethanol (95%) 20.0 ml

Solution B

Ammonium oxalate 0.2 g

Distilled water 20.0 ml

Solution A was diluted 10 fold with distilled water and mixed with equal volume of

solution B, filtered and stored.

Lugols Iodine

Iodine crystals 1.0 g

Potassium iodide 2.0 g

Distilled water 300 ml

Iodine crystals and potassium iodide were mixed and dissolved in distilled water,

filtered and stored in a amber coloured bottle.

Safranin (Counter Stain)

Safranin 2.5 g

Ethanol(95%) 100 ml

Safranin was added to 100ml ethanol to prepare the stock solution. To get the working

solution, 10ml of the alcoholic solution was diluted with 90ml distilled water.

3.1.2. Motility test

16- 18 h cultures of the isolates grown in tryptone soya broth were tested for

motility by hanging drop technique, using cavity slide. Only actively motile isolates

were proceeded with for further biochemical tests.

69

3.1.3. Oxidation - Fermentation (O/F) test

Hugh and Leifson’s O/F medium

Peptone : 2.0 g

Yeast extract : 5.0 g

Sodium chloride : 5.0 g

Glucose : 10.0 g

Bromocresol purple : 0.016g

Agar : 3.0 g

Distilled water : 1 L

Final pH : 7.2±0.1

Liquid paraffin

Liquid paraffin was sterilized at 180 ºC for 1 h in a hot air oven.

Bromocresol purple (1.6%)

Bromocresol purple : 1.6 g

Ethyl alcohol (95%) : 50 ml

Distilled Water : 50 ml

Bromocresol purple was first dissolved in 95% ethyl alcohol followed by the addition

of 50 ml distilled water. The solution was filtered to remove any suspended particles

and stored.

The ingredients were dissolved in distilled water by boiling and dispensed into

tubes so as to get one and half inch butt and sterilized by autoclaving at 110 ºC for 15

min.

70

The culture to be tested was stabbed into the butts of two tubes containing

Hugh and Leifson’s O/F medium. One of the tubes was overlaid with sterile liquid

paraffin. Reactions were recorded after 48 h of incubation at 30 ºC as fermentative if

both the tubes turned yellow. Isolates which were fermentative were recorded and

proceeded with.

3.1.4. Cytochrome oxidase test (Holding and Collen, 1971)

Oxidase reagent strips

Oxidase Reagent 0.1 g

(NNN-N'- Tetramethyl p-phenylene diamine dihydrochloride) (Sigma Chemicals,

USA) :

Distilled water: 10.0 ml

Whatman No.1 filter paper was cut into strips of 2.5 cm x 1.0 cm, dipped in the

reagent, dried and stored in dark bottles at 4 ºC.

Young culture (18h old) on TSA slants were picked up using a platinum wire

loop and spotted onto pre-moistened oxidase strips. Development of a dark purple

color within 10sec was recorded as positive. Only oxidase positive isolates were

proceeded with.

3.1.5. Sensitivity to O/129 compound (Bain and Shewan, 1968)

O/129 Discs

O/129 Compound 15.0 g

(2,4- diamino 6,7- di-isopropyl pteridine) (Sigma Chemicals, USA)

Acetone: 1.0 ml

O/129 compound was dissolved in acetone. Hundred numbers of filter paper

discs, each of 6.5 mm in diameter (pre-sterilized at 140 ºC for 1h), were soaked in this

71

solution; so that, each disc contained a concentration of 150 mg of the compound. The

discs were then dried in an incubator and stored at 4 ºC.

A young culture (18h old) of test organism was spread on a sector of TSA plate

and O/129 discs placed over it. The plates were incubated for 24 h at 30 ºC. A uniform

growth with no zone of inhibition around the disc was recorded as resistant to

pteridine compound. O/129 resistant isolates were proceeded with.

3.1.6. Triple sugar iron (TSI) reaction (McFaddin, 1980)

Triple sugar iron (TSI) agar (Hi Media, Mumbai)

The dehydrated media was suspended in distilled water (65.0 g in 1L) and

dissolved by boiling and distributed into tubes in 5.0 ml volumes. Tubes were sterilized

by autoclaving at 110 ºC for 15 min and allowed to set at an angle to have both butt

and slant.

Cultures to be tested were inoculated to TSI agar tubes by stabbing the butt

and streaking the slant surface. Tubes were incubated at 30 ºC for 18 to 24 h and

observed for the typical reaction of acid butt (yellow color) and alkaline slants (pink

color). Cultures showing an acid butt and an alkaline slant, with gas production and

blackening (H2S production) were further proceeded with.

3.1.7. Amino acid decarboxylase test

Basal medium for amino acid decarboxylase test

Peptone : 5.0 g

Yeast extract : 3.0 g

Sodium chloride : 5.0 g

Glucose : 1.0 g

Bromocresol purple : 0.016g

Distilled water : 1L

Final pH : 7.2+0.1

72

The basal medium was divided into four portions and the amino acids, viz. L-

lysine monohydrochloride, L-ornithine monohydrochloride and L- agrinine

monohydrochloride were added individually to each part at a concentration of 0.5, 0.5

and 0.4% respectively. The fourth portion served as control without any amino acid.

The media were distributed into tubes in 4.0 ml volumes and sterilized by autoclaving

at 110 ºC for 15 min.

A young broth culture (18 h old) was inoculated to each of the four tubes:

control, lysine, ornithine, arginine and overlaid with sterile liquid paraffin. The tubes

were incubated at 30 ºC for 3 to 4 days and results recorded. A positive reaction was

recorded as yellow coloration in the control tube while the amino acid containing tubes

turned yellow and returned to purple. Isolates that gave positive reaction for lysin and

arginine and negative for ornithine were proceeded with.

3.1.8. Sugar fermentation test (McFaddin, 1980)

Sugar fermentation medium

Peptone 10.0 g

Sodium chloride 5.0 g

Sugars 10.0 g

Bromocresol purple 0.016 g

Distilled water 1L

Final pH 7.2 ±0.1

The ingredients were dissolved in distilled water and dispensed into tubes

containing 4 ml each with Durham's tube and sterilized by autoclaving at 110 ºC for 15

min. The sugars used in this study were glucose, sucrose, lactose, arabinose, salicin,

The fermentation of the sugars was studied by inoculating the medium with a young

culture, incubating at 30 ºC for 24 h and recording results as change in the color of the

73

medium from purple to yellow. Isolates that fermented glucose, sucrose, lactose,

arabinose and salicin were proceeded with.

3.1.9. Catalase test (MacFaddin, 1980)

Young cultures of the isolates were placed in a drop of 3%v/v hydrogen

peroxide taken in a tile, release of oxygen observed as effervescence was recorded as

positive reaction. Catalase positive isolates were proceeded with.

3.1.10. Indole test (MacFaddin, 1980)

Tryptophan broth

Tryptophan 10.0 g

Sodium chloride 10.0 g

Distilled water 1L

pH 7.1

This medium was distributed in small test tubes in 2.5 ml volume and autoclaved at

121 ºC for 15 min.

Kovacs Reagent

p- dimethyl amino benaldehyde (DMAB) 5.0 g

Amyl alcohol 75 ml

Concentrated Hydrochloric acid 25 ml

DMAB was dissolved in amyl alcohol and then the conc. HCL was added slowly. The

solution was stored and used to perform the test whenever required The isolates were

grown in tryptone broth for 24-48 h and a few drops of Kovacs reagent was added.

Formation if a pink indole ring floating in the surface of the broth was recorded as a

positive reaction. Indole positive isolates were proceeded with.

3.1.11. Methyl Red (MR) test (MacFaddin, 1980)

MR-VP broth

Peptone : 5.0 g

74

Dipotassium hydrogen Phosphate (K2HPO4) : 5.0 g

Sodium Chloride : 5.0 g

Glucose : 5.0 g

Distilled water : 1L

Final pH : 7.2±0.1

The ingredients were dissolved in distilled water and dispensed into 5.0 ml volume into

tubes and sterilized by autoclaving at 110 ºC for 15 min.

Reagents for Methyl Red (MR) test

Methyl red : 0.1 g

Ethyl alcohol : 300 ml

Distilled water : 200 ml

Methyl red was first dissolved in ethyl alcohol and the volume was then made upto 500

ml using distilled water.

The break down of glucose to acidic end-product by the bacteria in MR - VP broth

culture was tested after growing bacteria at 30 ºC for 48 to 72 h by adding a few drops

of alcoholic methyl red indicator. Development of a pink to red color was recorded as

positive. MR positive cultures were proceeded with.

3.1.12. Voges – Proskauer (VP) test (MacFaddin, 1980)

Reagents for Voges - Proskauer (VP) test

Solution A:

α - Naphthol : 5.0 g

Ethyl alcohol : 100 ml

Solution B:

Potassium hydroxide : 40.0 g

75

Distilled water : 100 ml

The production of neutral end products like acetyl methyl carbinol (acetoin) from

glucose by the bacteria was tested by growing the organism in 5.0ml of MR - VP broth

at 30 ºC for 48 to 72 h and adding VP reagents consisting of solution A (0.6 ml) and

solution B (0.2 ml). Development of a port wine colour was recorded as positive. VP

positive isolates were proceeded with.

3.1.13. Aesculin hydrolysis (MacFaddin, 1980)

Aesculin agar

Peptone : 5.0 g

Beef extract : 3.0 g

Sodium Chloride : 5.0 g

Aesculin : 1.0 g

Ferric citrate : 0.5 g

Agar : 15.0 g

Distilled water : 1L

Final pH : 7.2+0.1

The medium was boiled to dissolve the ingredients, sterilized by autoclaving 110 ºC for

15 min and poured into sterilized petriplates.

The ability of some aeromonads to hydrolyze the glycoside aesculin to aesculetin and

glucose was studied by spot inoculating the cultures on the surface of aesculin agar

plates and incubating at 30 ºC for 48 h. Appearance of black to dark brown zone

around the spot indicated positive reaction. Isolates that were positive for this test

were proceeded with.

3.2. SDS-polyacrylamide gel electrophoresis

Proteins of A. hydrophila were analysed by the method of Laemmli (1970) using SDS-

PAGE with some modifications. All 16 isolates of A. hydrophila including environmental

76

and clinical along with other Aeromonas sp viz A. caviae, A. veronii, A. trota, A. sobria, A.

schubertii, A. jandaei were anlalysed for their whole cell protein profile. Two

environmental isolates (Ah68, G49), two clinical isolates (AhF0002, AhF12044) of A.

hydrophila, A. veronii, A. sobria, A. caviae GB912, A. trota F06662 were analysed for the

outer membrane proterin profile.

3.2.1. Sample preparation for SDS-PAGE

3.2.1.1. For whole cell protein profile

The whole cell lysate of A. hydrophila in the study were prepared as per the method

described by Chanphog and Sirirat (1997). 1.5 ml of an overnight culture of the organism in

brain heart infusion broth was centrifuged at 10000 rpm for 10 min at 4ºC. The pellet was

resuspended in 1ml of 20 mM Tris HCl buffer (pH 7.2) and centrifuged at 2000x g for 10

min at 4ºC. The process of washing and centrifugation was repeated twice. The pellet was

suspended in 50 µl of sample buffer and heated at 95ºC for 10 min and them stored at -20ºC

for further studies.

3.2.1.2. For outer membrane protein profile

OMP was prepared as per Rahman et al. (1999) with slight modifications.

A. hydrophila was cultured in 25 ml Brain heart infusion broth (Himedia) at 37ºC for 24 h,

then cells were harvested by centrifugation at 3000xgfor 20 min. Cells of A. hydrophila was

washed twice in PBS and once in Tris–HCl (pH 7·5) by centrifugation at 3000xg for 20

min. Cells were resuspended in Tris–HCI and sonicated at 50-W for 30-s, four times on ice.

The suspension was centrifuged at 30000xg for 90 min. The pellet was mixed with 500µl of

2% Sarkosyl in Tris–HCI for solubilisation of the inner membrane and incubated at 4º C for

overnight. The suspension was centrifuged at 45000xg for 2 h to harvest the outer

77

membrane protein. The OMP were resuspended in distilled water and analysed by SDS-

PAGE.

The various buffers and reagents used for SDS PAGE are as follows:

a) Acrylamide-bisacrylamide mixture

Twenty nine grams of acrylamide and 1.0 g of bisacrylamide (N, N’-methylene

bisacrylamide) were dissolved in 80 ml of distilled water. The volume was made up to

100 ml and stored at 4 ºC.

b) Separating gel buffer (1.5 M Tris-Cl, pH-8.8)

181.7 g of Tris base was dissolved in 800 ml of distilled water and pH was

adjusted using concentrated HCl. Then final volume was made up to 1 liter with

distilled water and stored at 4 ºC.

c) Stacking gel buffer (1 M Tris-HCl, pH-6.8)

121.1 g of Tris base was dissolved in 800 ml of distilled water and pH was

adjusted using concentrated HCl. Then final volume was made up to 1 liter with

distilled water and stored at 4 ºC.

d) 10 % sodium dodecyl sulphate (SDS) solution

10 g of SDS was dissolved in 100 ml of distilled water and stored at room temperature.

e) 10% ammonium persulfate (APS) solution

1 g of APS was dissolved in 10 ml of the distilled water and stored at 4 ºC temperature.

APS decomposes slowly and hence fresh solution was prepared after one week.

f) N,N,N’,N’-tetramethylethylenediamine (TEMED)

78

Electrophoresis grade TEMED (Bangalore Genei, Bangalore) stored at 4oC was

used.

g) Electrode buffer ( 5 solution)

5 stock solution was prepared by dissolving 15.1 g of Tris base, 94 g of

glycine (electrophoresis grade) in 900 ml distilled water and then 50 ml of 10 % SDS

solution of electrophoresis grade was added and the final volume was completed to 1

liter with distilled water and stored at room temperature. For running the gel, 1X buffer

was prepared using 5 electrode buffer.

h) SDS gel loading buffer (2)

2 gel loading buffer contained 100 mM Tris-Cl (pH 6.8); 4% (w/v) SDS; 20%

(v/v) glycerol; 0.1% (w/v) bromophenol blue; 200 mM β-mercaptoethanol. Gel loading

buffer lacking thiol reagent was stored at room temperature. 200 mM β-

mercaptoethanol was added to buffer from 14 M stock mercaptoethanol just before use.

i) Staining solution

2.5 g of Coomassie Brilliant blue R250 (HiMedia, Mumbai), 450 ml of

methanol and 100 ml of acetic acid were mixed, filtered and volume was made to 1

liter with distilled water. Solution was stored at room temperature.

j) Destaining solution

300 ml of methanol and 100 ml of acetic acid mixed with distilled water and

completed to 1 liter with distilled water. Solution was stored at room temperature.

k) Standard protein molecular weight marker

79

A medium-range protein molecular weight marker ((PMW-M) Bangalore

Genei, Bangalore) was used for determination of molecular weights of desired protein.

The molecular weight protein standards included phosphorylase b (97,000 Da), bovine

serum albumin (66,000 Da), ovalbumin (43,000 Da), carbonic anhydrase (29,000 Da),

soyabean trypsin inhibitor (20,100 Da) and lysozyme (14,300 Da).

3.2.2. Preparation of SDS-PAGE apparatus (Sambrook et al., 1989)

Depending on the proteins to be separated, 10-15% resolving gel and 5% stacking

gels were used in this study. Glass plates were rinsed by absolute alcohol and cleaned

using tissue paper. Spacers (1 mm) were placed on both sides between two plates in such a

way that any bubbles could not move through that and seated in stand and checked by

water. 10-15% resolving gel was prepared and poured up to 3\4 portion, and kept for

solidification. After solidification, 5% stacking gel was prepared, poured and 1 mm comb

was inserted into the staking gel. Gel was allowed to solidify. Comb was removed and the

solidified gel with plates was fixed in gel running apparatus. Gel running tank was filled

with 1x electrode buffer and samples were loaded into wells. Samples were resolved by

applying constant current of 20 mA for 2 hr. After electrophoresis, the gel was transferred to

a clean container and stained overnight at room temperature with shaking. After staining,

the gel was destained using destaining solution until a clear background was obtained.

Photographs of the gels were taken with Herolab gel documentation system (Germany). The

photographs were scanned and the profiles of each lane transferred to a densitometry

interface in the GelCompare II version 2.5 (Applied Maths, Sint-Martens-Latem, Belgium),

and the exact position of the protein peaks were determined.

80

Resolving gel mixture was prepared in a small beaker with a magnetic stirrer by

mixing the components for a desired concentration of acrylamide according to the following

chart (Harlow and Lane, 1998).

Preparation of resolving gels (pH 8.8) (Sambrook et al., 1989)

12% gel 15% gel Solution component

Component volumes (ml) Component Volumes (ml)

Total volume 5.0 10.0 5.0 10.0

Deionised water 1.7 3.3 1.2 2.3

30% acrylamide mix 2.0 4.0 2.5 5.0

1.5 M Tris-HCl pH 8.8 1.3 2.5 1.3 2.5

10% (w/v) SDS 0.05 0.1 0.05 0.1

10 % (w/v) APS 0.05 0.1 0.05 0.1

TEMED 0.002 0.004 0.002 0.004

81

Preparation of stacking gels (pH 6.8) (Sambrook et al., 1989)

Component 1 ml 3 ml 5 ml 8 ml 10 ml

H20 0.68 2.1 3.4 5.5 6.8

30% Acrylamide Mix 0.17 0.5 0.83 1.3 1.7

1.0 M Tris (pH-6.8) 0.13 0.38 0.63 1.0 1.25

10% SDS 0.01 0.03 0.05 0.08 0.1

10% APS 0.01 0.03 0.05 0.08 0.1

TEMED 0.001 0.003 0.005 0.008 0.01

For preparation of resolving gel, immediately upon addition of APS and TEMED,

the solution was poured into the assembled plates and overlaid with isobutanol to prevent

diffusion of oxygen into the gel and for obtaining a uniform margin of the gel. It was

allowed to polymerize for about 15 min.

In a similar manner, stacking gel mixture with 5% acrylamide mix was prepared by

mixing the components as give above.

3.3. Cloning and expression of outer membrane proteins

3.3.1. Preparation of crude bacterial cell lysates

Test cultures were grown overnight in 3ml Luria Bertani broth (HiMedia,

Mumbai) and centrifuged at 10,000g for 10min. The resultant pellet was washed twice

in sterile distilled water, resuspended in 100μl sterile distilled water and heated to

95oC for 15min in a hot bath. The tubes were then kept in ice for rapid release of DNA.

82

The cell debris was settled by centrifugation at 10,000g for 10 min and the supernatant

used for PCR. The cell lysates were stored at -20C till further use.

3.3.2. Genomic DNA extraction from the isolates

Genomic DNA was extracted from A. hydrophila strains using Cetyl trimethyl

ammonium bromide lysis method of Ausubel et al., (1992). Briefly, the strains were

grown in Luria Bertain broth (LB) over night with shaking. A 1.5ml of the culture was

centrifuged at 10000 rpm for 10 min and the pellet was re-suspended in TE buffer,

Sodium dodecyl sulfate and proteinase k were added and incubated for 1h. Following

this CTAB-NaCl digestion was performed and the mixture was extracted twice with

phenol: chloroform: isoamyl alcohol. DNA was precipitated using isopropanol, washed

with 70% ethanol dissolved finally in TE (Tris- EDTA; pH 8.0) buffer.

Estimation of DNA concentration in the solution after elution

Spectrophotometeric method was used for determination of the concentration

of DNA. Quantification of the DNA was determined by checking the absorbance of the

suitably diluted solution at 260 nm. An OD of 1 corresponded to approximately 50

μg/ml of double stranded DNA. The ratio of absorbance at 260 and 280 was used as an

indicator of purity of DNA. The integrity of the genomic DNA was checked by

electrophoresis of genomic DNA in 0.7% agarose gel. A single band of high molecular

weight range indicates good quality DNA that is not sheared.

3.3.3. Designing of primers and application of different outer membrane proteins

genes of A. hydrophila

Gene sequences of two outer membrane proteins of A. hydrophila namely, ompW

and omp48 gene of A. veronii were retrieved from Genbank database for designing of

83

primers for amplification of these genes. The primers to amplify the whole gene as well

gene excluding the signal peptide were synthesized, by Bioserve, Hyderabad. These primers

were tested on all 16 isolates of A. hydrophila and other Aeromonas sp viz; A. caviae, A.

veronii, A. trota, A. sobria, A. schubertii, A. jandaei.

The amplification of the OMP genes was performed in a programmable

thermocycler (M J Research, USA). PCR was carried out in 30 l reaction mixture

containing 2.0 l template DNA, 1assay buffer (10 mM Tris-HCl, pH 9.0; 1.5 mM

MgCl2, 50 mM KCl, 0.01% Gelatin), 200 M of each deoxyribonucleotide triphosphates, 10

pmol of each of forward and reverse primers and 1 U of Taq DNA polymerase (Bangalore

Genei, Bangalore). The optimized PCR programme consisted of initial denaturation at 95ºC

for 5 min, followed by 30 cycles of 1 min denaturation at 95ºC, 1 min annealing at

respective annealing temperatures shown in Table 3, 1 min extention at 72ºC. The final

extension was performed at 72ºC for 10 min. OMP genes with their Genbank accession

number, primer sequence, annealing temperature and expected amplicon sizes, and cloning

vector used for cloning the PCR products are given in Table 9.

The PCR products were detected by agarose gel electrophoresis. 1-1.2% (w/v)

agarose gels were prepared in 1 TAE buffer. The molten agarose was cooled to below

65ºC, ethidium bromide was added to a final concentration of 0.5 g/ml, mixed and

poured to gel mould and allowed to set. 10 l of the PCR products were mixed with 4

l of 6 loading buffer and loaded into the wells. 1 kb or 100 bp DNA ladder

(Bangalore Genei, Bangalore) was used as a molecular weight marker. Electrophoresis

was carried out at 100-120 V and the bands were visualized under UV

transilluminator (Herolab, Germany).

84

TAE (Tris acetate EDTA) buffer (50)

Tris base 242 g

Glacial acetic acid 57 ml

0.5M EDTA (pH 8.0) 100 ml

The solution was made up to a final volume of 1 liter with distilled water. The

working solution (1000 ml of 1 TAE) was prepared by diluting 20 ml of 50 stock

solution to 1000 ml with distilled water.

Sample loading buffer (6x)

Bromophenol blue 0.25 g

Sucrose 40 g

Distilled water: 100 ml

Ethidium bromide (Sigma, U.S.A.)

A stock solution was prepared by dissolving 5 mg of ethidium bromide in 1 ml of

distilled water. The solution was either added to agarose gel during preparation or to the

appropriate buffer (1TAE buffer) to yield a final concentration of 0.5 g/ml. In the

latter case, the gel was allowed to stain in the solution for 20 min and destained in

distilled water for 10 min to remove excess stain.

Table 9. Primers used in this study

Protein Accession number

PCR product size (bp)

Anneling temp. (ºC)

ExpressionVector used

Primer sequences

OMP48 AF538866 1305 50 pRSET B

F(1)5’ tcctctcagcgggaataagga

R5’ ttaccaccaagcttccgcttg 3’

85

OMPW ABK37420.1 612

552 52 pQE30 UA

F(1)5’ atgaaaaagatccttcctct

3’

F(2)5’ caccaggctggtgatattct

3’

R5’ tcagaagcgatagccgacac 3’

F1: Forward primer for amplification of the whole gene.

F2: Forward primer for amplification of the gene excluding the signal peptide

R: Reverse primer for the amplification of the gene

86

Aeromonas hydrophila

DNA extraction

PCR amplification of desired genes by gene specific primer

Purification of PCR product

Ligation of purified PCR product in cloning vector

pRSET B(or) pQE30 UA vector

Transformation into BL21(DE3)pLysS(or) SG13009 competent cells

Screening of positive clone by PCR (gene specific primer)

Expression of recombinant protein

Purification of recombinant protein

Flow chart 1: Cloning, expression and purification of different outer membrane

proteins of A. hydrophila.

3.3.5. Purification of PCR products

87

The omp 48 and omp W genes were PCR amplified in bulk (100 l) using the

primers and conditions as mentioned above. The PCR products were purified before

ligation to remove contaminants like Taq DNA polymerase, primer dimers, remaining

dNTPs which may interfere with subsequent processes, using QIAquick PCR purification

kit (Qiagen).

To one volume of the PCR product, 5 volume of buffer PB was added and mixed

and then transferred to QIAquick spin column placed in a 2 ml collection tube. The flow

through was discarded after centrifugation at 10,000 g for 1 min, washed by adding 0.75

ml buffer PE containing ethanol followed by centrifugation at 10,000 g for 1 min. The

DNA was eluted by adding 50 l of elution buffer (10 mM Tris-Cl, pH 8.5) or distilled

water to the QIAquick column placed in a fresh microcentrifuge tube and collected by

centrifuging the column at 10,000 g for 1 min (Fig 3).

Fig. 3 Purification of PCR products using QIAquick spin column

3.3.6.1 Ligation of omp 48 gene PCR product into the expression vector

88

The ligation reactions using expression vectors were carried out according to the

manufacturer’s protocols. The expression vector used was pRSET B (Fig 4, Invitrogen,

USA).

Fig. 4. Vector used in this study- pRSET B vector (Invitrogen, USA)

The omp48 gene product was cloned into the pRSET B expression vector

(Invitrogen, USA), using Pst I at 37 bp and Hind III at 1269 bp from the start codon at 5’

and at 3’ respectively using 10 µl restriction Buffer (10x), 1 µl BSA (100x), 1 µl HindII

enzyme, 1 µl Pst I enzyme, 1 µl pRSET B Vector ((50 ng/ µl) and 86 µl DNA sample and

distilled water, mixed briefly and incubated at 37 ºC in a thermal cycler block for 2 hr.

3.3.6.2 Ligation of omp W PCR product into the expression vectors

89

The ligation reactions using expression vectors were carried out according to the

manufacturer’s protocols. The expression vector used was pQE30 UA (Fig 5. Qiagen,

USA).

Fig. 5. Vector used in this study- pQE30 UA linearized vector (Qiagen, USA)

For Qiagen vector (pQE30 UA linearized plasmid DNA), ligation was performed

using 4 µl purified PCR product and 1 µl vector (50 ng/ µl). Five microlitres of 2 ligation

master mix was added, mixed briefly and incubated the tube at 16 ºC in a thermal cycler

block for 2 hr.

3.3.7. Transformation

After ligation the pRSET vector containing the omp48 gene was maintained in

TOPO10F’ cells and the recombinant protein was expressed in the E. coli

BL21(DE3)pLysS strain. One Shot TOP10F’ and BL21(DE3)pLysS competent cells for

high efficiency transformation was procured from Invitrogen, USA and used for the study.

90

The pQE30 UA vector containing omp W gene was maintained and the recombinant

protein was expressed in E. coli SG13009 strain.

The recombinant expression vectors were transfered to a tube containing 150 µl. of

the respective competent cells. The contents were mixed by gentle tapping and incubated

on ice for 30 min. The cells were subjected to heat shock at 42 ºC for 90 sec in a water

bath. The tubes were then rapidly transferred to ice and cells were allowed to chill for 1-2

min. 500 µl of LB broth was added to the tubes and incubated at 37 ºC for 1hr with

vigorous shaking. The cells were centrifuged at 4000 rpm for 10 min. 300 µl supernatant

was discarded and transformed cells were resuspended in remaining 200 µl broth and was

spread on two LB plates (100 µl/plate) containing antibiotics (100 µg/ml ampicillin & 25

µg/ml kanamycin and 35 µg/ml chloramphenicol & 50 µg/ml ampicillin for SG13009 and

BL21(DE3)pLysS cells, respectively). The plates were then incubated overnight at 37 ºC.

3.3.7.1. Preparation of competent E. coli SG13009 cells

The procedure described by the suppliers (Qiagen, USA) was followed to prepare

the competent cells. Aliquots of E. coli strains, SG13009 were removed from the supplied

vial with a sterile tooth pick, streaked on LB agar containing antibiotics (25 µg/ml

kanamycin for SG13009 strain and incubated overnight at 37 ºC. Then single colony was

inoculated into 10 ml of LB broth containing respective antibiotic and grown overnight at

37 ºC with constant shaking at 150 rpm. The following day, 1 ml of overnight grown

culture was transferred into 100 ml of LB broth containing respective antibiotics and

incubated for 90-120 min with vigorous shaking at 200 rpm at 37 ºC. Optical density at 600

nm (OD600) was measured after every 30 min. When OD600 reached 0.4-0.5, culture was

chilled on ice, transferred to pre-chilled 50 ml polypropylene tubes and centrifuged at 2500

rpm for 10 min using cooling centrifuge (Hearus, Germany). The supernatant was

91

discarded and the cells pellet was suspended gently without damaging the cells in 30 ml of

ice cold TFB1 buffer and the suspension was kept on ice for an additional 90 min and

centrifuged at 2500 rpm at 4 ºC for 10 min. The supernatant was discarded carefully and

the cell pellet was resuspended in 4 ml of ice cold TFB2 buffer. About 150 µl of

suspension of competent cells was aliquoted in 1.5 ml microfuge tubes, frozen and stored

at -80 ºC.

Luria-Bertanii (LB) broth (Hi Media, Mumbai)

Tryptone 10 g/l

Yeast extract 5 g/l

Sodium chloride 10 g/l

2.5 g of LB broth was dissolved in 100 ml of distilled water and sterilized at 121 ºC for 15

min. To the cooled LB broth, antibiotics were added from the stock solutions to get the

desired concentrations.

Luria-Bertanii (LB) agar (Hi Media, Mumbai)

Tryptone 10 g/l

Yeast extract 5 g/l

Sodium chloride 10 g/l

Agar 15 g/l

4 g of LB broth was dissolved in 100 ml of distilled water and sterilized at 121 ºC for 15

min. Then it was cooled to 50 ºC and antibiotics were added from the stock solutions to get

the desired concentrations.

Kanamycin stock solution (25 mg/ml)

Stock solution was prepared by dissolving 0.0385 g of kanamycin powder (HiMedia,

Mumbai) having the assay potency of 650 µg/mg in 1ml distilled water, filter sterilized and

stored in aliquots at -20 ºC.

92

Ampicilin stock solution (100 mg/ml)

Stock solution was prepared by dissolving 0.1089 g of ampicillin powder (HiMedia,

Mumbai) having 98% purity in 1ml distilled water, filter sterilized and stored in aliquots at

-20 ºC.

Chloramphenicol stock solution (35 mg/ml)

Stock solution was prepared by dissolving 0.039 g of chloramphenicol powder (HiMedia,

Mumbai) having 98% purity in 1 ml 100% ethanol. It is not necessary to filter sterilize.

Store the stock solution at –20°C.

TFB1 buffer

RbCl 100 mM

MnCl2 50 mM

Potassium acetate 30 mM

Calcium chloride 10 mM

Glycerol 15%

pH 5.8

All the chemicals used were of molecular biology grade. pH was adjusted carefully to

avoid formation of insoluble manganese precipitate. After adjusting the pH, the buffer was

filter sterilized and stored at 4 ºC.

TFB2 buffer

MOPS 10 mM

RbCl 10 mM

Calcium chloride 75 mM

Glycerol 15%

pH 6.8

After adjusting the pH, the buffer was filter sterilized and stored at 4 ºC.

93

3.3.8. Screening of transformants

Transformants were randomly selected and screened for the presence of insert by

preparing crude lysate of DNA (Dileep, 2002). Briefly, each of the selected colonies were

inoculated to 2 ml of LB broth and incubated overnight at 37 ºC. To 50 µl of the culture,

450 µl of TE buffer was added and cells were lysed at 100 ºC for 10 min, snap chilled,

centrifuged briefly for 5 min and 2 µl of supernatant was used as template for PCR using

gene specific primers. Glycerol stock (30%) were made for all the positive clones and

stored at -80 ºC.

3.3.9. Confirmation of the recombinant constructs

The orientation of the insert of the cloned viral coat protein genes were confirmed

by using vector specific forward primers and gene specific reverse primer.

3.3.10. Expression of the recombinant proteins

The pRSET B vector containing the omp48 was maintained in TOPO10F’ cells and

the recombinant protein was expressed in the E. coli BL21(DE3)pLysS strain. The

recombinant gene constructs containing omp W was maintained and expressed in E. coli

SG13009 host cells.

To ascertain the expression, each of the positive clones of omp48 and ompW were

inoculated in to 5 ml of LB medium containing antibiotics. Cultures were grown overnight

at 37 ºC with constant agitation at 150 rpm and 1 ml of overnight grown cultures were

inoculated into 10 ml of LB broth with specific antibiotics and incubated at 37 ºC with

constant shaking until the OD600 is 0.5-0.7. The cultures were induced with different

concentrations of IPTG (1mM, 1.5 mM, 2 mM, 2.5 mM amd 3 mM) and further incubated

for 4 hr with the same conditions. Uninduced recombinant clone, E. coli strains SG13009

94

and E. coli BL21(DE3)pLysS were used as control. 1 ml culture from each sample was

centrifuged at 11,000 g for 3 min and the supernatant was discarded. The pellet was

resuspended in 30 µl distilled water and 30 µl of 2X sample buffer by continuous

vortexing, lysed at 95 ºC for 5-10 min in a dry bath. Then samples were loaded to the

prepared polyacrylamide gel.

Isopropylthio- β-D-galactoside (IPTG, 1 M)

Stock solution was prepared by dissolving 2.3 g of IPTG in 10 ml of distilled water,

filter sterilized and aliquots were stored at -20 ºC.

3.3.11. Plasmid DNA extraction

Reagents supplied with kit (Eppendorf Fast Plasmid Mini Kit)

Lysis solution, RNase solution, Lysozyme, Wash buffer concentrate, Elution buffer

and Fast Plasmid Spin Column Assembly.

Plasmid extraction protocol

Young bacterial cultures at the logarithmic growth phase were used for plasmid

DNA extraction. 1.5 ml of bacterial culture was centrifuged to sediment the cells to the

bottom of the microfuge tube. The clear supernatant was discarded and to the pellet, 400 l

of ice cold complete lysis solution was added. The pellet was mixed thoroughly and

incubated at room temperature for 3 min. Subsequently, the lysate was transferred to the

spin column assembly and centrifuged at maximum speed for 60 sec. 400 l of diluted

wash buffer was added to the spin column and centrifuged for 1 min. For elution, 50 l of

95

elution buffer was added to the spin column placed in a collection tube and centrifuged.

The purified plasmid was collected in the collection tube and stored (Fig 6).

96

Fig. 6. Plasmid purification using Eppendorf fast plasmid mini kit

3.4. SDS-polyacrylamide gel electrophoresis

Recombinant proteins expressed in E. coli were analysed by the method of

Laemmli (1970) using SDS-PAGE with some modifications as described above.

Sample preparation of recombinant E. coli for SDS-PAGE

1.5 ml Bacterial Culture

Centrifuge for 1 minute to pellet the cells Decant the media Add 400 µl of ice-cold complete lysis solution Vortex for a full 30 seconds at the highest setting

Incubate at room temperature for 3 minutes

Transfer the lysate to a Spin Column Assembly

Spin Column Assembly

Centrifuge for 30–60 seconds

Centrifuge for 30-60 seconds

Wash DNA with 400 µl of diluted wash buffer

Decant the filtrate from the waste tube and re-assemble the Spin Column Assembly

Centrifuge for 1 minute Add 50 µl of Elution Buffer to the center of the Spin Column Transfer the Spin Column into a collection tube

Centrifuge for 30-60 seconds

Purified Plasmid DNA

97

One ml of test cultures was pelleted by centrifugation at 11,000 × g for 3 min and

supernatant was discarded. The pellet was resuspended in 30 µl distilled water and 30 µl of

2X sample buffer, vortexed and lysed at 95 ºC for 5-10 min in a dry bath. The samples

were loaded to the SDS polyacrylamide gel.

3.4.1. Purification of recombinant proteins

For production of recombinant proteins in relatively large scale, 200 ml of LB

broth was used. The cultures of the recombinant E. coli were grown and expressions were

obtained under optimized conditions of IPTG induction and time course. The DNA inserts

were expressed with 6 histidine residues as an N-terminal fusion protein. The metal

binding domain in the fusion protein allows simple one step purification of immobilized

metal affinity chromatography (IMAC). The following steps were used for purification of

the recombinant proteins by Ni-NTA affinity chromatography.

Cells were harvested by centrifugation at 11,000 × g for 5 min after induction with

IPTG for 4 hr. Cell pellets were resuspended in lysis buffer (pH 8.0) and stirred using

magnetic beads for 1hr at room temperature, sonicated on ice at 20-30 W with six 10 sec

bursts. The lysates were centrifuged at 11,000 × g for 15 min at room temperature to pellet

the cellular debris. The supernatant was added to 1 ml of 50% Ni-NTA agarose slurry and

stirred gently on magnetic stirrer for 1 hr at 4 ºC. The lysate-Ni-NTA mixtures were loaded

into columns and each column washed twice with 4 ml wash buffer (pH 6.3). The proteins

were then eluted with 4 ml of elution buffer (pH 4.5), dialyzed against 10 mM Tris, pH

8.0, 0.1% Triton X-100 overnight at 4 ºC to remove guanidine hydrochloride and

concentrated using vacuum concentration instrument and purity of these proteins were

analyzed on 12-15 % SDS-PAGE.

98

Lysis buffer (pH 8.0)

NaH2PO4 100 mM

Tris-Cl 10 mM

Urea 8 M

pH was adjusted to 8.0 using NaOH

Wash buffer (pH 6.3)

NaH2PO4 100 mM

Tris-Cl 10 mM

Urea 8 M

pH was adjusted to 6.3 using NaOH

Elution buffer (pH 4.5)

NaH2PO4 100 mM

Tris-Cl 10 mM

Urea 8 M

pH was adjusted to 4.5 using NaOH.

3.4.2. Protein estimation

The protein content was measured by the method of Lowry (1951). The procedure

is based on quantitating the color obtained from the reaction of Folin Ciocalteau phenol

reagent with tyrosyl residues of unknown protein and comparing this with a standard

protein, usually bovine serum albumin (BSA). Five standard BSA (1 mg/ml in distilled

water) samples were prepared in 0.1 N sodium hydroxide to give concentrations of 20, 40,

60, 80 and 100 µg/ml, respectively, in glass tubes in duplicates. Test samples were taken in

2 different dilutions of 20 µg and 40 µg along with neat. Equal volume of alkaline copper

reagent was added to all tubes and the mixture was incubated for 15 min at room

temperature. Folin’s reagent (Sigma, USA) was added at a concentration of 50 µl/ml. The

99

entire mixture was mixed well and incubated for another 30 min at room temperature.

Optical density was measured at 690 nm. The protein concentration of the sample was

obtained from the graph plotted for the standard BSA concentrations as optical density

values.

Copper sulphate (1%) solution

Copper sulphate 0.1 g

Distilled water 50 ml

Sodium potassium tartarate (2%) solution

Sodium potassium tartarate 1 g

Distilled water 50 ml

Sodium carbonate (4%) solution

Sodium carbonate 2 g

Distilled water 50 ml

Sodium hydroxide (0.1 N) solution

Sodium hydroxide 0.2 g

Distilled water 50 ml

Alkaline copper reagent (ACR)

Copper sulphate (1%) 1 ml

Sodium potassium tartarate (2%) 1 ml

Sodium carbonate (4%) 48 ml

Bovine serum albumin (1%)

Bovine serum albumin 0.01 g

Distilled water 1 ml

3.4.3. Generation of hyperimmune sera in rabbit

100

Rabbits were immunized with 200 µg of purified recombinant proteins by

intramuscular injection at 7-day intervals for 4 weeks consecutively. The first dose was

administered with Freund’s complete adjuvant while subsequent doses were given with

Freund’s incomplete adjuvant. Rabbits were bled, a week after the last dose by cardiac

puncture. Sera were separated from blood cells and stored -20 ºC in aliquots.

3.4.4. Immunization of fish with recombinant protein

Overly healthy rohu (L. rohita Hamilton) weighing 350-400 g were kept in 100

liter containers for one week prior to immunization. The fish were fed with pelleted feed

during the experimental period. The fish were anaesthetized and 4 doses of the

recombinant protein (1.5 µg g-1 of fish body weight) were injected intramuscularly at 7-day

intervals for 4 weeks consecutively to one group of 5 fish while the other group of 5 was

injected with PBS. The first dose was administered with Freund’s complete adjuvant while

subsequent doses were given with Freund’s incomplete adjuvant. Fish were bled, a week

after the last dose. Sera were separated from blood cells and stored -20 ºC in aliquots.

3.4.5. Titration of hyperimmune sera

Titres of hyperimmune sera (HIS) were checked by plate ELISA (Engvall and

Perlman's, 1971). Wells of polystyrene ELISA plates were coated separately with 10

µg/ml of antigen in carbonate - bicarbonate buffer and incubated at 4 ºC overnight. After

washing with phosphate buffered saline (PBS), non-specific sites were blocked by 5%

defatted milk powder in PBS and further incubated overnight at 4 ºC. After washing thrice

with phosphate buffered saline tween-20 (PBST), plates were incubated for 1 hour at 37 ºC

with serially diluted HIS in PBS. Wells containing PBS served as controls. The plates

were washed thrice with PBST and incubated with 100 µl/well of horse-raddish-peroxidase

conjugated goat anti-rabbit immunoglobulins (Sigma, USA) at 1:2000 dilutions in PBS for

101

1 hour at 37 ºC. After extensive washing with PBST, enzyme activity was determined by

adding 100 µl of freshly prepared solution of tetramethyl benzidine hydrogen peroxide

(TMB/H2O2) into each well. Incubation was carried out for 5 minutes at room temperature

in dark and 100 µl of 2.5 N sulphuric acid was added into wells to stop the reaction.

Enzyme activity was read at 450 nm in ELISA reader (ELX 800, Bio-Teck instrument,

USA).

Carbohydrate-bicarbonate buffer (0.05 M, pH 9.5)

Na2CO3 16 mM

NaHCO3 36.9 mM

Phosphate buffered saline (PBS)

NaCl 137 mM

KCl 2.7 mM

Na2HPO4 10 mM

KH2PO4 2 mM

Phosphate buffered saline tween-20 (PBST)

PBS 100 ml

Tween-20 0.5 ml

Tetramethyl benzidine hydrogen peroxide (TMB/H2O2, 20, Bangalore Genei,

Bangalore)

TMB/H2O2 was 20 times diluted in distilled water just before use.

3.4.6. Characterization of hyperimmune sera by Western blotting

Specificity of hyperimmune serum raised against purified recombinant proteins,

whole cell proteins of uninduced non-recombinant competent cells, IPTG induced non-

recombinant competent cells, uninduced recombinant competent cells and bacterial species

were tested by Western blotting. Western Blotting was carried out as per the procedure of

102

Towbin et al. (1979) and antigenicity of recombinant proteins was determined by

developing of color with respective antisera. The following materials were used:

a) Nitrocellulose membrane

Nitrocellulose membrane (NC) (Pall Life Sciences, USA) was used as per the

manufacturer’s instructions.

b) Transfer buffer

Glycine 39 mM

Tris base 48 mM

SDS 0.037%

20% methanol was added to this solution just prior to

use.

c) Blocking solution

The blocking solution was prepared with 3% (w/v) BSA (HiMedia, Mumbai)

d) Enzyme labeled antibody

Goat anti-rabbit immunoglobulin conjugated with horseradish peroxidase (HRP)

(Bangalore Genei, Bangalore) was used at a dilution of 1:1000 in PBS.

e) Substrate

DAB(3-3’-diaminobenzidine tetrahydrochloride) and H2O2 (Bangalore Genei, Bangalore)

was used.

Procedure

The immunoblotting procedure was carried out as follows:

1) Resolution of sample by gel electrophories

2) Transfer of separated polypeptides to a nitrocellulose membrane

3) Blocking of non-specific binding sites on the membrane

103

4) Addition of antibody

5) Detection

i) Polyacrylamide gel electrophoresis

The antigens were electrophoresed on a 10% SDS-polyacrylamide gel as per the

method described in section 3.2. The samples were loaded and resolved in two sets of

repeating lanes so that the portion of gel containing one set of samples could be taken for

staining with coomassie blue and the other portion of gel for electrotransfer. A lane

containing protein molecular weight marker was included for electrophoresis for each

portion of the gel.

ii) Electrophoretic transfer

Transfer of proteins from the polyacrylamide gel to nitrocellulose membrane was

carried out using the semidry transfer unit-Semiphor (Hoefer Scientific Instruments, USA).

Electrode plates of the semiphor unit was rinsed with distilled water. Six sheets of

absorbent paper (Whatman No. 1) and one sheet of nitrocellulose membrane were cut to

the size of the gel used for electrotransfer. The transfer stack was prepared by placing a

pre-cut mylar mask (2 mm smaller than the gel from each side) on the anode in the base

centering the opening. Three sheets of absorbent papers soaked in transfer buffer were

placed at the centre of the opening. Nitrocellulose membrane soaked in deionised water

was placed on the absorbent papers. The polyacrylamide gel slightly wetted in deionised

water was placed on the absorbent papers. The polyacrylamide gel slightly wetted in

deionised water was placed carefully at one attempt on the membrane surface. The

remaining three absorbent papers soaked in transfer buffer were placed on the top of the

gel completing the stack. As each layer was added, care was taken in removing air pockets

by rolling a clean test tube over them. Electrophoresis was performed with constant

104

voltage of 45 V for 1 hr at maximum current. After electrotransfer, the nitrocellulose

membrane was taken out and dried. The lane containing molecular weight marker was cut

and stained with amido black.

iii) Blocking

The nitrocellulose membrane was rinsed several times with PBS. The blocking

solution (3% BSA/PBS) was added to the membrane placed in a clean glass petri plate.

The membrane was soaked in this solution at 4 ºC overnight.

iv) Addition of antibody

The blot was removed from blocking solution and was washed twice with PBS for

5 min each. Then NC sheet was incubated with hyperimmune serum (1:100) to specific

recombinant proteins for 1 hour at room temperature on a rotor shaker. The blot was

washed with four changes of PBST for 5 min each. After washing with PBST, the NC

sheet was incubated with goat anti rabbit antibodies HRP conjugate, at a dilution of 1:1000

at room temperature for 1 hour.

v) Detection

The blots were washed with four changes of PBST before addition of the substrate,

DAB (3-3’-diaminobenzidine tetrahydrochloride) and H2O2 for detection of bands. The

colour developed within 1-5 min and the excess development of color was stopped by

keeping the blot in distilled water.

3.4.7. DNA sequencing and analysis

The plasmids was purified using a Plasmid purification kit (QIAGEN, USA). The

cloned products were sequenced by M/s Bioserve, Hyderabad, India using M13 and gene

105

specific primers. The identity of the nucleotide and derived amino acid sequences to

known sequences in GenBank was analysed using the respective BLAST program

available at NCBI (http://www.ncbi.nlm.nih.gov/). The program Sequence Quickie-Calc

version 5.0 software (http://molecular programming.com/) was used for the prediction of

molecular weight, pI, hydrophobic nature of the proteins. Signal peptide sequence was

located using SignalP ver.3.0 (http://www.cbs.dtu.dk/services/SignalP). The structural

class of the membrane proteins was predicted using PRED-TMBB

(http://bioinformatics.biol.uoa.gr/PRED-TMBB) an online software which is capable of

predicting the transmembrane strands and the topology of the outer membrane proteins of

Gram-negative bacteria. The probable antigenic sites in the proteins were determined by

the Emboss-GUI package (http://sequenzanalyse.biologie.uni-konstanz.de/EMBOSS).

Similarity of the protein to bacterial adhesins was predicted using SEAPATH (30) from the

GenoCluster suite of programs.