Embed Size (px)
Citation preview
Name Period
2015 FALL BIOLOGY FALL FINAL REVIEW
BIOCHEMISTRY
1. Biochemistry is the study of:
, Complex compounds are produced fro4}orgaÿ compounds or b)inorganic compounds.
3. What are four organic compounds that we have discussed in the unit and give an example of each?
. What of the following is an organic compound?a. NaCI c. H20
b. C02 (ÿdÿ6Hlÿ06
5. Polymerization is the formation of a ÿ)0\ ÿAÿ( as the result of two or more ÿ©ÿq.PXÿ.Oÿtÿ%omingtogether and forming a complex compound.
,
.
As a result of polymerization, a water molecule is given off. This type of reaction is also called
g .
List the building blocks for each biomolecule we have discussed .... (know the molecular structure of each)
a. Lipidb. Protein
c. Carbohydrate
d. Nucleic Acid
10. Starch, when digested, is broken down into ÿ 6ÿ10 tÿgÿ,
11. Enzymes are which type of biomolecule? What is their function?
12, Enzymes are specific or nonspecific to thR type of reaction they catalyze?
13. What is the corred relationship between monomers and polymers?
a. Monomers are long, connected chains of polymers.
8. How many different amino acids are there and what biomolecule do they form?
9. List the elements that make up each biomolecule individually.a. Lipids ....
b. Protein ÿ Cÿ\ 0 ÿ'ÿ
c. Carbohydrate ÿ,ÿ ÿ0
d. Nucleic Acids I
p
are subunits of polymers.
14. All organic molecules contain which element? CÿÿYk"
15. When do enzymes perform most efficiently on a reaction? ÿ'(" "ÿ
16. What happens when an enzyme is added to a reaction? l ÿ (-,J/'(ÿtÿLÿ ÿ-
17, What happens when an enzyme is removed from a reaction? ÿ[0kJÿ
18. The human body is composed of approximately 70-80% of Vÿ ÿV'
ap
19. The reactants (substrate) must be able to bind to the enzyme for the reaction to be catalyzeÿ False
20. Which words do not belong together?
a. Starch: carbohydrate
b. Enzyme: Protein
c. Wax: Lipid
Steroid: Nucleic Acid
21, Enzymes ONLY effect theÿ-ÿaÿÿ4/'(
22. Large molecules called tÿ ÿL('ÿ[JÿI,'(_.
of a reaction.
[/ÿ(.L'6ÿ'-ÿ store genetic information.
/
23. Glucose and fructose are examples of
a. Double sugarsDisaccharidesMonosaccharides
d. Polysaccharides
24, 'ÿ
CELL STRUCTURE/FUNCTION
28. List the 8 characteristics of living things:
3} ÿ iÿ
29, Viruses are living organisms: True o<Fa!iÿeÿ ÿ/ ............
30. Viruses are no n-cellulÿTrue/ÿ r Fa Ise
31, What characteristic(s) do viruses share with living organisms?
32. Define Cell Differentiation:
-ÿ,ÿ iÿ ÿ7, bÿb <ÿ: ÿ vvmÿ33. Draw an example of an amino acid molecu arÿructure:
34, Define homeostasis:
35. What structure do prokaryotic and eukaryotic organisms share?
36. Prokaryotic and eukaryotic organism differ in that prokaryotic cells are lacking: (%ÿ{.\ÿJ_
37. The cell membrane is composed of which two biomolecules? ÿkvk ÿ. ÿ:ÿ._ ÿt{' ÿ<ÿ
38. What is made at the ribosome?
39. List the three parts of the cell theory:
C,
40. Be able to label and know the differences between plant and animal cells:
41, What is the main function of the cell membrane and what does it help maintain?
42. What does it mean to be selectively permeable?
43, What are the two main types of cell transport and what are the differences between them?
44. What are the three types of passive transport and what are the two main differences between them?
45. What are the three types of active transport?
/-/46, In active transport, molecules move from areas of \ (ÿ1ÿ
concentration,
gÿ ÿvÿOÿ ÿ! ,
concentration to areas of kÿ'fl !€k-
47. What is diffusion?
48. Diffusion continues until ÿ,u.ÿ ÿ.ÿ cÿ_w4ÿvhen molecules still%
49, What is facilitated diffusion7 IVÿ0ÿ.ÿ.(£ÿ!ÿ#-ÿ
rÿOvÿ._ but stay ÿ)ÿ.
50. How do transport proteins work?
vz ÿÿ ÿ 1ÿi# ckÿ-ÿ_/ ÿ ÿ,'ÿ ÿ kÿA ÿÿÿ'ÿ'51, What types of molecules require facilitated diffusion? Give an example.
52. In facilitated diffusion, molecules move from ÿLÿ concentration to \(')UO/I
concentration, u
53. What is osmosis?
54. Fill in the table Statement Isotonic Hypotonic Hypertonicsolution solution solution
Match the term with itscorrect description:
Causes a cell toswell
Doesn't change theshape of a cell
Causes osmosis
Causes a cell toshrink
/
/
f / ÿ LJ/
a. energy e. active transport
b. facilitated diffusion f. exocytosis
c. endocytosis g. carrier protein
d. passive transport h. channel protein
55. Transport protein that provides a tube-like opening in the plasma membrane through which particles
can diffuse
56. Is used during active transport but not passive transport
/
57. Process by which a cell takes in material by forming a vacuole around it
58. ÿ Particle movement from an area of higher concentration to an area of lower concentration
59. Process by which a cell expels wastes from a vacuole
60. ..../ P A form of passive transport that uses transport proteins
Particle movement from an area of lower concentration to an area of higher concentration
;p/
62. ' Transport protein that changes shape when a particle binds with it
Match the term with its correct description:
a. transport protein
b. active transport
c. diffusion
63. ÿ,_,
d. passive transport
e. osmosis
f. endocytosis
The diffusion of water through a cell membrane
g, exocytosis
h. equilibrium
64.ÿ The movement of substances through the cell membrane without the use of cellular energy
65. ÿ Used to help substances enter or exit the cell membrane
66. ÿ When energy is required to move materials through a cell membrane
67. When the molecules of one substance are spread evenly throughout another substance to become
balanced
/68. L7 A vacuole membrane fuses (becomes a part of) the cell membrane and the contents are released
69.2 The cell membrane forms around another substance, for example, how the amoeba gets its food
70. 0 When molecules move from areas of high concentration to areas of low concentration
71.
95% NaCl a. Water w/ill41ÿ (into thecell, oÿn both directions).
5% H20
b. The cell willstay the same).
s(shrinÿburst,
72. 5% NaCI
95% H20
a. Water will flow ------:-- ÿ------ÿ
of the celÿ(into the cell, out
(shrink, burst, stay
73.
5% NaCI
95% H20
a. Water will flowof the cell, in both directions).
b. The cell willthe same).
(into the cellÿ out
(shrink,(burst, stay
74. At which solution of concentration gradient is each cell diagram? (Hypotonic, Hypertonic, Isotonic)
@@
@
@@
*ÿute lÿleÿe free v, ater moÿufe
&o oooÿooo€oooÿo0 o 0 o 0|o 0 qO o 0 o 0
01o0 o 0"o 0 o'0 o 0o'ÿ0
Ok° O oAO o 0 o Oÿo 0 oi0o ÿ oio ° o° oT°ÿ; o0 o 0 oÿ,0 o 0 o 0ÿ,o 0 o 0o o o o'O %0 2_.g'o o o o
, e eÿ e ÿe*tee e
" g ee
e ÿe e e e
75. This diagram is moving from a high to a low concentration: /. , ) 0\
@ ÿ,OVBtÿ Btglr OF
@ ®., @ @
@ @@ @@ @@° ;@o° o
:: o4°
76. Using a transport protein to move particles across the membrane:
77. Describe the processes occurring in the following pictures:
-L
+++
++
LOÿ
+@o
+
++++++++
++
+++++++++ .ÿo. +
78. Protein pumps move molecules from ares of /()ÿ-/
79. Which cells have villi to increase nutrient absorption?
concentration to areas of concentration.
80. Which of the specialized plant cells contains many large vacuoles in order to maximize water absorption?
8::[. Which types of cells contains the most mitochondria?
82. What is the purpose of dendrites on nerve cells?
CELl. ENERGY
83, The original source of all energy on the Earth is Su ,V c
84. During the process of photosynthesis, energy from the sun is converted into
85. What is the name of the energy all cells use for activity?
A -P
86. Cellular respiration converts the energy in nutrients into energy that the cells can use.step in cellular respiration is the breakdown of what?
An important
87. What is the formula for photosynthesis and cellular respiration?
88. What are the reactants and products of photosynthesis?
dot
Vgÿ,k89. What are the reactantÿand product of cellu ar respira ion,
90. The temporary storage of energy irÿ ATP molecules is part of what process?
91, ÿ%
TU
Y
V
Identify structures T and V in the above diagram,
92 During cellular respiration, nergyÿ transf e fro to
93. Which type of energy transformation occurs in photosynthes'J7 "ÿ'ÿ 's ÿ ÿ, *ÿ energy to
{'ÿAÿ,ÿ!;4 ÿ4ÿ,) energy. 0
94. What gas do plants produce? Take in?
95. How do plants and animals help each other in terms of breathing and exhaling?
96. In an energy storing molecule, energy is released when the bond is broker False?
The following is a model of ATP, and energy storing molecule.
97, Where is the energy stored in this molecule?
98. In the diagram below, what cellular process is being illustrated?
zC6H:].206
02CO2
ATP H20
99. is t yp of Anaerobic Respiration and give examples of each.
, rhv ct CeLLj
100. List the steps of Photosynthesis.
101. List the steps of Cellular Respiration,
The concept map below shows the flow of energy and materials in photosynthesis and cellularrespiration.
102. Which molecules are represented in the figure by the numbÿ
103. Describe the process of photosynthesis and cellular respiration.
104. What is the difference between autotrophs and heterotrophs?
105. What is the relationship between the reactants and products in photosynthetic and cellular
respiration reactions? ÿ!ÿ:ÿ,ÿ ÿ(0ÿ. Oÿ ÿ
106. Light energy is captured in which organelle? Which organelle releases energy for the cellsactivities? ÿ ÿ,ÿ
107. What is the formula for alcoholic fermentation?
108. What is the formula for lactic acid?
109. Coach Mike prepared a test tube containing yeast, glucose, and water. After 24 hours, the testtube was analyzed for the presence of (-ÿ
/1
110. Ms. Uddin went to the gym and after a great workout her muscles were functioninganaerobically (without 02). There was a buildup of which of the following compounds in her musclecells?
111. Not all of the energy contained in glucose is put into ATP. What is the rest of the energyreleased as?
112. Ms. B has a very large healthy plant that she leave in total darkness while you away onvacation. What do you think the plant was using for an energysource while in the dark?,
DNA/ Cell Growth and Development Review ÿt3ÿO-ÿ G-ÿ-4 ÿV'ÿ ÿ @tx.ÿ
DNA
1. What are the names of the two guys that developed the model ofa DNA molecule?
, DNA replication takes place in which part of an animal cell? What is the function of DNA?
.
T-A-G-G-CA-T-C-C-G
Circle the segment that has an error?
Segment I ÿÿ'ÿ
/ G-G-T-G-C )
L,,... C-A-A-Cÿ
Segment 3
G-A-T-T-AC-T-A-A-T
. If a DNA molecule contains 10% Guanine. What complimentary base would bind to Guanine and atwhat concentration would the base be measured? Circle correct answer
10% Thymine 90% Cytosine
5. ATTCG - ATTAG, is this error because of a mutatioÿ FALSE.
90% Adenine
. What are the building blocks of nucleic acids?
. What are the three parts of a nucleotide?
i
-) (i J'ÿ iLA ÿ\2,
9. The fact that a strain of yeast with a certain defective gene can use the human version of the geneto repair itself is evidence that yeast and humans --
a. depend on the same food supply( iiÿ share a genetic code
c. both have eukaryotic cellsd. have identical genomes
10. What enzyme breaks the hydrogen molecules in the DNA structure allowing the DNA molecule tounzip and allow free nucleotides to attach to complimentary nucleotides?
8. Cytosine is always connected to
11. What is Chargaff's Base pair rule?
12. What type of bonds are in between the nitrogen bases? How many are in between Guanine and
Cytosine? How many are in between Adenine and Thymine?
13. DNA is single stranded. True oP'False? Circle answer.
14. How does DNA carry the genetic code for an organism?
15. What makes up the backbone of the DNA molecule?
,z
Cell Growth and Development
Jt16. What is the correct sequence of stages in the cell cycle? ÿ ÿ , S, G2,
17. Which process is represented by the diagram below?
18. In the mitotic phase the parent cell divides into identical daughter cells.
19. If a parent cell has 15 chromosomes, how many chromosomes will the two daughter cells produce
each? ion---
20. Describe how cancer cells occur.
21. The ÿ'.ÿ. i / cvcle is the series of events that cell go through as they grow and divide.
22. In mitosis the daughter cells receive how many chromosomes from the parent cell? Circle correct
answer.
22. Place the illustrations in order of appearance during mitosis...
none ¾
!-¢
D O/
23. Which stage of mitosis is represented below?
24. Which stage of mitosis is represented below? What structure is meeting in the middle?
25. Which stage of mitosis is represented below?
26. What is the difference b t nÿc osome'ÿ ÿ] \tÿ1%"\lÿL{ÿ' ÿX
2_7. What organism did we talk about goes through asexual reproduction?
PROTEIN SYNTHESIS #IND /14u'rRTION5
1. The
a.
RNA sequence below encodes a very short yeast protein:
5' ACÿ UAÿGÿCÿuÿUCÿAÿAÿCC GAUC 3'
Circle the codon where translation (protein synthesis) by the ribosome will start.Put a box around the codon where it will stop.
b. Use a codon chart and decode this message: what will be the sequence of amino acids in the protein?
c. If the underlined base changed from U to G, What would be the effect on the pÿotein? What do we call this
kind of mutation? ::, ..... ÿ ,<\-\ ÿ,
d. If the underlined base changed from U to C, what would be the effect on the protein? What do we call thiskind of mutation? iÿ,i,i:: "-_ÿ:ÿ-C
2. Which of the following is NOT a way in which DNA is different from RNA?
A) The nitrogenous bases.
B) The number of strands.
C) The kind of sugar in the sugar-phosphate backbone.IID) All of the above in which differ.theyare ways
Use the terms below to answer questions 4-5:
,
4.
5.
6.
A) mRNAs/'LJ
B) Ribosomes C) tRNAs D) RNA polymerases E) amino acids
have anticodons
are enzymes involved in transcription
True / False: A genetic mutation of a single nucleotide will always result in a different amino acid.
What mRNA sequence would the DNA sequence AGTCCG code for?A)MCAGGC B) TCAGGCC) lie Ser D) ACAUUAE) Ser Gly
7. One codon of an mRNA reads GUA, which specifies valine. If a mutation changes the first nucleotide of
the DNA coding for this RNA to an A, use the genetic code to determine what amino acid will be put in after themutation.
: ÿ%)ÿleucine (Leu)"B) valine (Val)C) aspartic acid (Asp)D) histidine (His)
8. Why do genetic mutations often lead to a disease?
\
A) Protein can no longer be synthesized from the DNA.
::III311)ÿA change in amino acid sequence can change protein shape.C) The mutant DNA itself directly interferes with the organism's normal functioning.
D) Genetic mutations are usually beneficial and lead to development of time-traveling capabilities.
9. What amino acid sequence would the DNA sequence TAAAGT code for?
10. The genetic code is an inventory of which __ specify(ies) which
iJ3 mRNA bases ... amino acid
B) mRNA base ... amino acid
C) amino acids ... proteins
_23 DNA bases 3 mRNA basesEJ
11. The transfer of genetic information from DNA to RNA is called
A) translationB) elongationC) initiation
qÿ transcription
E) replication
12. Translation consists of which of the following?
(ÿthe conversion of genetic information from the language of nucleic acids to the language of proteins.
B) the conversion of genetic information from DNA nucleotides into RNA nucleotides
C) the addition of nucleotides to a DNA templateD) the conversion of genetic information from the language of proteins to the language of nucleic acids.
13. Wrbiÿ of the following bring amino acids to the ribosomes?)ÿtransfer RNAs B) messenger RNAs
"Cÿ replicated DNAs D) enzymes
14. Where in the cell do mRNA and amino acids on tRNAs come together?
A) in the nucleus(ÿat the ribosomes
¢) on the chromosomes
D) on genomes
15. What molecules are produced in translation?
A) nucleotides
B) DNA C ÿ "C) ribosomes - • ÿ- :. ÿ,(ÿ .
D) RNA(('ÿ3 rotei n s ÿ ÿ i/
16'ÿ/L'ÿ" ÿ"ÿ'ÿue/False: tRNA is n°t translated int° pr°teingÿ,r -ÿ
17. To the right is a molecule of DNA. Label the following: su , phosphate, ÿ-N !ÿ ÿD
adenine, cytosine, guanine, thymine, nucleotide, hydrogen bond.
18. Through the process of ÿ{ÿ[ ((ÿ'ÿ ÿIÿNA makes a copy of itself. ÿ"
19. Identify the type of mutation in each sequence below. Circle the location of the error.
Original: AAUGGCGUUAAC
A. AAUÿ'GCGUUAAC
B. AAUGGCGCIJUAACt>i
<.>
C. AAUGGCGU;AAC ÿÿ ÿ,ÿ20. List two ways that matations could affect the organism.
2:1.. Label the parts in the diagram below, then answer ÿhe questions that follow.
//
;
A
{s /ÿ"%; <+ÿ>. t;ÿt t t
\
/
? > :; ,
< /:> ...... .,
5ÿ
lhr
7!, ÿ:,, c7+ .
<
/,, %,
...... '" 7/..,
• ÿ -:7 ,'
. I
1,
a. What is the molecuÿ/labeled "A" in the diagram above?// //,,
/./
b. Label the nucleysln the diagram above./J/
C. Name the process occurring in the nucleus of the cell.
d. Where in the cell will the mRNA go once it has been constructed?
e. There, the mRNA will be divided into groups of 3 bases called !" 'ii ,.'i, (ÿ
f. Label the ribosome in the diagram above. xÿ//
g. Name the process occurring in the ribosome.
h. At the rioosome, the mRNA will meet with what (labeled "B" in the diagram above)?
i. The group of 3 bases attached to "B" in the diagram is called a(n)/ÿ $/LÿlA/l't Cÿ'Lÿ',ÿ!"]n'
j. If the codon is "AAC", the anticodon would be
The molecules labeled "C" in the diagram are called
I. Joining amino acids together builds a ÿlÿ)ÿcÿtV-x
m. Amino acids are held together by ÿ6/ÿ/tÿC¢ÿ:ÿ bonds.
/ // /
n. How are proteins importanl living organisms?.
22. A gene is specific section of L:)ÿ , Each gene codes for a
23. What are proteins made of?
24. Protein synthesis is such an important topic to learn because ..,
25. Protein are made in several steps as shown below, Fill in the blanks.
26. What are the differences and similarities of DNA & RNA?
T k/
c C27. What is the process called when RNA is made using the DNA template strand? ÿ-VCdÿC iÿ IPqÿ3 '6ÿA
I .
28. Why must DNA be transcribed into mRNA? (ÿQ) -Jÿ-t%ÿ ÿl/ÿi'ÿ,bÿ'/ÿ ('£ÿL"ÿ(£H
29, In which direction does the RNA polymerase build the RNA strand? ÿ - ÿ
30. What is at the beginning ofa gene that controls where transcribing begins?///
/3":[. What must happen to the RNA before it leaves the nucleus?// i'
.i Define the following terms: intron, exon, and splicing.
33. What is the process called when mRNA is read and a protein is made?
34. What is the purpose of a tRNA (transfer RNA)?
F
35. What is the purpose of mRNA {messenger RNA)?
36.
37. What does RNA Polymerase do?
38. Transcription takes place in the
the
• % i %
, "ÿ is the molecule that assembles the amino acids in the correct order based on
the information carried to it by the mRNA.
i
and translation takes place in
39. How does the ribosome know to stop adding on amino acids to the protein?
40. In the end, what is really responsible for how the protein is built? In other words what really gives the instructionson what order to put the amino acids in? ÿ, ..
/4t. Which strand of the DNA is always used to transcribe mRNA? '" ÿ"/42. How many amino acids would be in a protein translated from the following strands of mRNA?
a. mRNA- AUGCCGAACGCACUUCAU
b. mRNA- AUGUCGGGCUUUACUGACUAC
# of amino acids
# of amino acids
43. Using the template DNA given, show the protein that would be translated.
a. TTCCCGGAAACT --) Protein: % ÿ:i ......... ÿ.. ÿ ÿ.-
b. AAGGGCTTCTCAGTA -->Protein: iÿ:,ÿ; ÿ :-,,i/
s .-
f F44. Transcribe this template DNA:TACGGACTAAAA-ÿ ,i], ÿ!- " 'ÿ J , -ÿ ,:
45. Translate the above sequence into a protein. ' ÿ"ÿ ? "46. Acodon is found on the ,ÿt: while an anticodon is found on the
% ', ÿ,!
47. How many different codons code for Glycine?f
48. What tRNA anticodon would match up with the mRNA sequence UAC? /:. What amino acid
would it be transferring? "ÿ (Remember the chart you use is an mRNA codon chart
not a tRNA anticodon chart!l!!!)s
i[ ÿ\/.
S49. Explain the steps of protein synthesis. Start with the DNA in the nucleus unzipping./
50. Fill in the chart below.
Template DNA TCTTCA t, jlÿljÿmRNA (codon) ÿtÿ ÿiÿ L/ctRNA (anti-codon) t,!! (. ÿli.,' (_ IÿAmino Acid [-k f C,\ - C.Cÿ
AUAUUUUCUAAG
/I fi"
Ala -HIS -
51. Why is ÿg-ÿ-__.i_ÿÿmp°rtant?
52. Define dif in relation to cells
53. Be able to label all of the following figures
Genetics
Show all Punnett square and scratch work on another piece of paper. Staple your scratch work to this
review.
2. The study of how traits are passed from parents to offspring:
2. Different genes for the same traits are called:
3. Genes contain instructions for making
4. What is used to predict the possible gene makeup of offspring?
5. Chromosomes are pieces of " ÿ ÿ ÿ material.
6. What does homozygous mean? ÿ"ÿ :'iÿ" ÿ: ÿ;
7. A sex-linked trait is located on theÿ'-i
8.
f
__ chromosome and missing on the iÿ chromosome.
Use the following information to answer the following questions:
In dogs spotted coat (A) is dominant to solid coat (a).
a,
b.
C.
d.
e,
f.
Give the genotype of a hybrid animal:
Give the genotype of a homozygous spotted coat dog:
Give the genotype of a solid coat dog: i c 'ÿ.
Give the phenotype of an animal with 2 dominant genes:
Give the phenotype of an animal with 2 recessive genes:
Give the phenotype with I dominant and 1 recessive gene:21 ............
9. Describe the genotype of the offspring with parents where one is homozygous dominant and one is reÿssive:
/ I !
Brown eyes are dominant to blue eyes.
10. For a child to show a recessive trait such as blue eyes, the child must have what genes? /?;'/ ......
/ .......Each parent of the child must have what gene in them for the child to have blue eyes? .... • •,. +
/ÿ: .k L{
/- m+ .... .x - cÿ ,'
11. A man with blue eyes, whose mother had brown eyes and father had blue eyes, marries a woman with brownÿ"eyes, whose father had blue eyes.
i, >\
: a. What isthe man's genotype? t
b. What is the woman's genotype? I%
c. What is the genotype of the man's mother?
d. What is the genotype of the man's father?; i
_ÿ...H.+ .....................................
e. What is the genotype of the woman's father?
f,
g.
h.
If the man and woman have 4 children, how many would be expected to be heterozvgous for eyecolor? ..ÿ i, ÿ ÿ-ÿ:t \,.t ÿ- ÿ< 7 )
; )How many of the children would be expected to have blue eyes? _ ÿL: j
,.,.,nea p,gs. b,o<k <oat €01's om,.o.<to w,,te °oo, Cbl
12. Give the cross between a heterozygous black pig and white guinea pig: 9 ÿ"
Givetheexpectedgenotypicratiooftheoffspring: ÿ0 '[ , ÿ ID / ÿ 0 '/. Iÿ! (,.
Give the expected phenotypic ratio ofthe offspring: ÿ0 '/, ÿlf/(ÿ ÿ ,ÿ0'/i V)V,':ÿf •
13. Give the cross between two heterozygous pigs:
Give the expected genotypic ratio of the offspring:
Give the expected phenotypic ratio of the offspring:f
14. When RR is a red flower, WW is a white flower, and RW is aDink flower, this is an example of what type ofinheritance? ÿ[&, ÿ(:ÿh\ ÿ21ÿ-ÿ )ÿ (ÿ (ft 01ÿ( ÿ"ÿ,cÿ<_ (-ÿ
:[5. A sudden genetic change is called a ÿG (J (:{'
16. What are the two types of mutations? ÿ i"ÿ ÿ'ÿI"YÿO ÿ 0\%ÿI-CÿI1 and
17. What is the least common type of mutation and usually the most drastic?
J
18. What is the most common type of mutation and usually is the least drastic?
19. What is identical in every cell of an organism?
20. Two black labs produce a litter of four puppies. Three are black and one is yellow.The yellow coat is probably what type oftrait (dominant or recessive)? 'If ÿ ÿJ(ÿ ÿ ÿl V'ÿ
21. Having Freckles is a dominant trait. 1"- ("What is the mother's genotype? t:
Can child #4 pass the freckle trait on to his offspring?
Freckles
1 4
1ÿ]0 No Freckles
22. In humans free ear-lobes (F) is dominant to attached ear-lobes (f). Joe and Mary are heterozygous for theirfree ear-lobes.
-What is the probability (%) of their children having free ear-lobes?
-What is the probability (%) of their children having attached ear-lobes?
23. If a body cell of an organism contains a mutation, will the mutation be passed to the offspring? __
24. If a sex cell of an organism contains a mutation will the mutation be passed to the offspring? !.//
25. If a couple wants a boy, what letter (chromosome) must the dad donate in his sperm cell?26. In carnations, blue flowers (BB) and yellow flowers (YY) make green flowers (BY). Can two green carnations
, / ./make a blue flower? ÿ ; ÿ ;" .....
27. Cinderella has type AA blood. Prince Charming, her husband, has type O blood (OO). What/are the possibleblood types of their children? ;. What is the probability (%) of having a child with 0 bloodylJ .ÿ+"ÿeÿ /, / iÿ
28. Ariel has hemophilia xhxh. Prince Eric, her husband is xHy. They have two girls and two boys. Figure out theirchildren's genotypes/phenotypes and make a pedigree for their family.
Genotypes: .:ÿ: /.
Phenotypes: • .7 .. -/
/ " .h¢ÿ t s. \
• fÿ
/
s
/
/
/
S ÿ ÿ f................... 7-
29. According to the table, which of the following phenotypes would probably occur in all the offspring from theparents shown below?
GgBb (male) x ggBB (female
j
l
/?..:./:I>I=;L" ' >
+s
U< 7-
/ /
/ , }
i j ;.¢
Allele Trait Type
G Solid 8ray fur Dominant
g Striped gray fur Recessive
B Green eyes Dominant
b Blue eyes Recessive
30. If a lemming that is homozygous brown with long fur and is crossed with a white, short furred lemming,found in the first-generation offspring?whichpercentage ofgenotypes would most likely be
/ i:L, g
- f •!
B
b
L
Brown
White
Long fur
Short fur
31. How many different allele combinations would be found in gameteÿ-q:rrcÿlucgd byÿ rat whose genotype isT TS 7
32. This is an example of a normaI DNA sequence. O A T O A T C A T
What would a segment of DNA look like with a single base change?
33. A mutation in DNA replaces proline with alanine, as shown below.
Original DNA sequence: TAT GAAiÿ_ÿC GAAI\ I
Mutated DNA sequence: TAT GAAÿG¢C GAA
UHow many amino acids are affected by this mutation?
C,,. 6 ÿ-,,,,x -ÿ ¢'
Meiosis Vocabulary ÿÿ {
1. The process that results in the reduction of chromosome numbers.
2. The term for body cells (aka- liver, skin, heart).
3. The term for sex cells.
4. The uniting of an egg and a sperm cell.
5. A cell formed by the fertilization of a sperm and egg cell.
6. Division that results in the production of somatic cells.
7. Division that results in the production of gametes.
8. Thesymbol for the female sex chromosomes.
9. The symbol for the male sex chromosomes.
10. Number of original chromosomes found in an organism.
11. Half the number of chromosomes found in gametes.
If the first base pair is deleted, what type of mutation is this?
34. The diagram on the right represents a portion of a DNA molecule.
d A
L,/C i,l;tS,.Ykÿ, 0",,,'.€,ÿ
0
12. A pair of chromosomes that contain the same traits.
13. The exchanging of genes to increase genetic variation.
Label the following diagrams as mitosis or meiosis.
14. !i-ÿ %ÿ ÿ!iÿ 15.
A
x
° @o
o ©©
A
B
C
D © ©
Cornpnete the following: questions:
1ÿ A body cell is called aÿÿ,ÿt" 'ÿ
2. A sex cell is called a <.ÿ" --:\-<ii %
3. Female gametes are called ÿ" ,ÿÿ ÿ" ÿ %
4. Male gametes are called ÿ (ÿ ÿ 'ÿ :ÿ, iÿ
5. What is the name of the cell division process in which sperm and egg cells are produced?
,,ÿi:ÿ , ....
6. Give 3 differences between the processes of mitosis and meiosis:
- /
i ÿ,ÿ ÿ iÿ¸ÿ/ÿ ÿ iÿ
, A pair of chromosomes that contain the same information and look alike are called
8. Where does meiosis occur in the male?
,
Where does meiosis occur in the female? ÿL) ÿ ¢-.)
Would a gamete have the same number of chromosomes as somatic cells? Jÿ',l/ÿ(ÿi
Why?
10. What is the termQor a cell,wit) half the number of chromosomes?
11. What is the term fpr a cell withithe complete number of chromosomes?
12. Joining of egg and sperm is called ÿ'qÿ k!'ÿ--ÿ jÿl 'ÿV'I.
13. What is the term for a fertilized egg?
Is it haploid or diploid? tÿ
Why?
14. How many chromosomes are in a human egg cell? 7-1 'ÿ'ÿ
How many chromosomes are in a human sperm cell? ÿ'-b.p
Are egg and sperm cells haploid or diploid? \Pÿ Ck ÿ\ÿ ÿo.ÿ_ c- " "
15. How many chromosomes are in a human somatic cell? "L'I (-Pÿ
Is it haploid or diploid? ÿJÿ 'ÿ2 (ÿ>, Cÿ,
