2012 Imatinib Resistant BCR-ABL1 Mutations at Relapse in Children With PH ALL

7/28/2019 2012 Imatinib Resistant BCR-ABL1 Mutations at Relapse in Children With PH ALL

1/4

liver biopsies and hepatitis virus testing were not required in

the protocol.

Acute mutiorgan failure is a common cause of death in

adult sickle cell patients without Hepatitis-C (Perronne et al,

2002; Manci et al, 2003; Darbari et al, 2006). Cirrhosis with

severe iron overload is often found on autopsy studies in

adults with sickle cell disease. Close monitoring of the liver

functions in patients on deferasirox is indicated. However,multiple studies have found that deferasirox protects against

iron-induced hepatic injury as well as fulminant hepatitis

(Al-Rousan et al, 2011; Deugnier et al, 2011; Sato et al,

2011).

In summary, the acute multiorgan failure observed in this

patient was secondary to the underlying sickle cell disease and

the evidence does not indicate deferasirox as a causal agent.

Elliott Vichinsky

Childrens Hospital and Research Center at Oakland, Oakland, CA,

USA

E-mail: [email protected]

First published online 8 February 2012

doi: 10.1111/j.1365-2141.2012.09038.x

References

Al-Rousan, R.M., Rice, K.M., Katta, A., Laurino,

J., Walker, E.M., Wu, M., Triest, W.E. &

Blough, E.R. (2011) Deferasirox protects against

iron-induced hepatic injury in Mongolian gerbil.

Translational Research: the journal of laboratory

and clinical medicine, 157, 368377.

Darbari, D.S., Kple-Faget, P., Kwagyan, J., Rana, S.,

Gordeuk, V.R. & Castro, O. (2006) Circumstances

of death in adult sickle cell disease patients. Ameri-

can Journal of Hematology, 81, 858863.

Deugnier, Y., Turlin, B., Ropert, M., Cappellini,

M.D., Porter, J.B., Giannone, V., Zhang, Y.,

Griffel, L. & Brissot, P. (2011) Improvement in

liver pathology of patients with beta-thalassemia

treated with deferasirox for at least 3 years.

Gastroenterology, 141, 12021211.

Manci, E.A., Culberson, D.E., Yang, Y.M.,

Gardner, T.M., Powell, R., Haynes, Jr, J., Shah,

A.K. & Mankad, V.N. (2003) Causes of death in

sickle cell disease: an autopsy study. British Jour-

nal of Haematology, 123, 359365.

Perronne, V., Roberts-Harewood, M., Bachir, D.,

Roudot-Thoraval, F., Delord, J.M., Thuret, I.,

Schaeffer, A., Davies, S.C., Galacteros, F. &

Godeau, B. (2002) Patterns of mortality in

sickle cell disease in adults in France and England.

The Hematology Journal: the official journal of the

European Haematology Association/EHA, 3, 5660.

Sato, T., Kobune, M., Murase, K., Kado, Y.,

Okamoto, T., Tanaka, S., Kikuchi, S., Nagashi-

ma, H., Kawano, Y., Takada, K., Iyama, S.,

Miyanishi, K., Sato, Y., Takimoto, R. & Kato, J.

(2011) Iron chelator deferasirox rescued mice

from Fas-induced fulminant hepatitis. Hepatolo-

gy Research: the official journal of the Japan Soci-

ety of Hepatology, 41, 660667.

8Vichinsky, E, Bernaudin, F, Forni, GL, Gardner,

R, Hassell, K, Heeney, MM, Inusa, B, Kutlar,

A, Lane, P, Mathias, L, Porter, J, Tebbi, C,

Wilson, F, Griffel, L, Deng, W, Giannone, V &

Coates, T. (2011) Long-term safety and efficacy

of deferasirox (Exjade) for up to 5 years in

transfusional iron-overloaded patients with

sickle cell disease. British Journal of Haematolo-

gy, 154, 38797.

Imatinib resistant BCR-ABL1 mutations at relapse in children

with Ph+

ALL: a Childrens Oncology Group (COG) study

Philadelphia chromosome positive acute lymphoblastic

leukaemia (Ph+ALL) occurs in 25% of paediatric ALL and

is historically associated with a poor prognosis. Although

8090% of children achieve remission, their event-free-

survival (EFS) with conventional chemotherapy prior to

tyrosine kinase inhibitors (TKI) was poor, with a 7-year EFS

rate of 32% (Arico et al, 2010). The addition of imatinib as

monotherapy appeared promising in initial treatment ofadults with Ph+ALL, despite a high rate of relapse (Druker

et al, 2001). Many relapsed adults on imatinib monotherapy

were found to have a resistant mutation within the kinase

domain of BCR-ABL1 (Jones et al, 2008). Other studies have

shown that TKIs, such as imatinib or dasatinib, as mono-

therapy can select for TKI resistant clones, which may then

be overcome by the addition of cytotoxic chemotherapy in

the mouse model (Boulos et al, 2011).

The Childrens Oncology Group (COG) clinical trial,

AALL0031, used imatinib (340 mg/m2/d) in conjunction

with intensive chemotherapy to treat children and adoles-

cents with Ph+ALL (Schultz et al, 2009). This dosage is

equivalent to approximately 600 mg/d in adults and was well

tolerated with minimal additional side effects as compared to

the identical chemotherapy arm without imatinib. AALL0031

differed from adult protocols in several aspects: use of drug

combinations not common in adult protocols, intensive dos-

ing of imatinib that was given continuously for the majorityof 2.5 years and no continuation of TKI after completion of

therapy. Three-year EFS on this treatment was 84% (more

than double those of patients treated in the pre-imatinib

era). Thus far, it remains unknown whether patients that

relapse following this treatment approach have recurred due

to development of imatinib resistance.

A 2-year-old male with Ph+ALL and initial white blood

cell count of 117 9 109/l was initially treated with a standard

four-drug induction of vincristine, asparginase, doxorubicin,

and prednisone. At presentation he showed no evidence of

2012 Blackwell Publishing Ltd, 507

British Journal of Haematology, 2012, 157, 493516

Correspondence


2/4

extramedullary disease. He achieved complete morphological

and cytogenetic remission at the end of induction. He then

received post-induction therapy according to COG

AALL0031 cohort 5 (not on study). His therapy included the

intensive systemic regimen with central nervous system

(CNS)-directed therapy without cranial radiation. Twenty-

four months into treatment he presented with headaches and

mental status changes caused by a CNS relapse. BCR-ABL1

sequence analysis of his cerebrospinal fluid (CSF) blasts iden-

tified a guanine substitution for adenine, producing the mis-

sense mutation methionine 244 to valine (M244V) (Fig 1A).

Concomitant bone marrow aspiration showed no leukaemia

by morphology, flow cytometry or by fluorescent in situ

hybridization. However, sequence analysis of the marrow

sample identified the same mutation found in his CSF. BCR-

ABL1 sequencing of the bone marrow specimen from initialdiagnosis identified no mutation (Fig 1A).

A biological correlate study to AALL0031 was developed

to determine whether or not BCR-ABL1 kinase domain

mutations were present in medullary relapse samples from

Ph+ALL patients. COG AALL0031 enrolled 93 patients with

Ph+ALL aged 121 years from 2002 to 2006 (Schultz et al,

2009). From this study, nine relapsed bone marrow samples

were available for sequence analysis (Table I). Eight of the

nine samples from imatinib-treated patients showed no BCR-

ABL1 kinase domain mutation (Table I). One sample, from a

patient who relapsed 15 months after diagnosis, carried the

histidine 396 to proline (H396P) mutation (Fig 1B). A bone

marrow sample from initial diagnosis of this child identified

no mutation (Fig 1B).

These results further validate that BCR-ABL1 kinase

domain mutations can occur after treatment of Ph+ALL with

imatinib and intensive multiple chemotherapeutic agents.

From these 10 samples we identified two resistant mutations

A C C A T G A

A C G T G A

Met 244

Val

Diagnosis

Relapse

(A) (B)

A A T G A G A T G C

G C C T G C

Diagnosis

Relapse

His 396

Pro

C CC

C C CC C

Fig 1. Sequence chromatograms. (A) Sequence results of the presented case at diagnosis and relapse. Briefly, patient total RNA was isolated frommononuclear cells and cDNA was synthesized with random hexamers using Superscript III (Invitrogen, Grand Island, NY, USA). Patient cDNA

(1 ll) was amplified by polymerase chain reaction (PCR) using B2A forward (TTCAGAAGCTTCTCCCTGACAT) and ABL1 4317 reverse (AGC

TCT CCT GGA GGT CCT C) in a 20-ll reaction (Table I). PCR product (1 ll) was used as template in the second round (nested) 50-ll reaction

with BCR F4 forward (ACAGCATTCCGCTGACCATCAATA) and ABL1 4307 reverse (GAGGTCCTCGTCTTGGTGG) primers.

All PCR reactions were performed with Accuprime TAQ, (Invitrogen) and 20 pmol of each primer. Resulting PCR products were

sequenced with two forward and two reverse sequencing primers. Sequences were aligned with Sequencher (Gene Codes, Ann

Arbor, MI, USA) sequence analysis program. (B) Sequence results of Case 9 from bone marrow samples from diagnosis and

relapse.

Table I. Patient samples.

Case Time to relapse* Imatinib exposure BCR-ABL1

Presented case 24 months >1 year M244V

1 26 months


3/4

from patients who received imatinib and combination

chemotherapy for more than 1 year. This mutation rate

appears to be less than previously published in adults treated

with imatinib monotherapy (Jones et al, 2008) (15 of 17

relapsed patients) or with hyperCVAD (hyperfractionated

cyclophosphamide, vincristine, doxorubicin, dexamethasone,

methotrexate, cytarabine) combination therapy (Ravandi

et al, 2010) where mutations were observed in three of fiverelapsed patients.

Neither mutation was detected in samples obtained at

diagnosis suggesting that the vast majority of the leukaemic

cells did not have the mutation. This does not preclude the

concept of a low level of mutations at diagnosis, as previ-

ously shown (Pfeifer et al, 2007). M244V and H396 muta-

tions have been shown to be more resistant to imatinib but

both have been shown to be sensitive to second generation

TKIs, such as nilotinib and dasatinib (OHare et al, 2005).

Treatment with dasatinib has been shown to overcome

H396R resistance in CML (Talpaz et al, 2006).

Our results are the first to describe BCR-ABL1 kinasedomain mutations in paediatric patients with Ph+ALL treated

with intensive chemotherapy and imatinib. We are also the

first to report an imatinib-resistant BCR-ABL1 kinase muta-

tion from a CNS recurrence in a paediatric patient. It has

been previously shown that imatinib has low penetrance into

the CNS, which implies that selective pressure occurred sys-

temically followed by expansion in the sanctuary of the CNS.

The two mutations identified here are predicted to be sen-

sitive to second generation TKIs, suggesting that these TKIs

may be effective reinduction therapy for relapse following

treatment of Ph+ALL with chemotherapy and imatinib.

Importantly, dasatinib penetrates the CNS, a property that

may help to decrease the risk of CNS recurrence in Ph+ALL.

These next generation TKIs may further decrease relapse

rates when used for initial therapy of Ph+ALL. Many patients

who experience a relapse with combination chemotherapy

and a TKI do not appear to carry a TKI-resistant mutation,

suggesting that other BCR-ABL1 independent pathways play

critical roles in leukaemia cell survival. Other tyrosine kinas-

es, such as HCK, FGR, and LYN, are essential for Ph+ALL

transformation (Hu et al, 2004). Therefore, less selective

inhibitors like dasatinib may play an important role in sal-

vage therapy for these patients. The current and planned

COG Ph+ALL trials combine dasatinib rather than imatinib

with intensive chemotherapy. Future studies will addresswhether dasatinib-resistant BCR-ABL1 mutants develop in

patients who relapse on these studies.

Acknowledgements

COG samples were obtained through the ALL Cell Bank

(#2004-04) with local Institutional Review Board approval.

Portions of this research was funded by the National Child-

hood Cancer Foundation (NCCF Laura and Greg Norman

Research Fellowship); Childrens Oncology Group grants

CA098543 (Chairs Award), U10 CA98413 supporting the

COG Statistical Center, and U24 CA114766 supporting

Human Specimen Banking in NCI Supported Cancer Trials.

B.H.C. is supported in part by the Oregon Child Health

Research Center (National Institute of Child Health and

Development K12) and the St. Baldricks Foundation. SPH is

the Ergen Family Chair in Pediatric Cancer.

Author contributions

BHC, SGW, LS, SPH, BJD, and KRS designed the research

and analysed the data. BHC, SGW, LS, WLC, BMC, NJW,

SPH, BJD, and KRS wrote the manuscript.

Conflict of interest

BHC, SGW, LS, WLC, BMC, NJW and KRS have no compet-

ing financial interests. SPH is a member of the Bristol Myers

Squibb Dasatinib Pediatric Advisory Committee (without com-

pensation). His children own stock in Bristol Myers Squibb. B.J.D. has financial interest in MolecularMD and receives clinical

trial funding from Novartis and Bristol Myers Squibb.

Bill H. Chang1

Stephanie G. Willis2

Linda Stork1

Stephen P. Hunger3

William L. Carroll4

Bruce M. Camitta5

Naomi J. Winick6

Brian J. Druker2,7

Kirk R. Schultz8

1Division of Pediatric Hematology and Oncology, Department of

Pediatrics and OHSU Knight Cancer Institute, Oregon Health &

Science University, Portland, OR, USA, 2Division of Hematology and

Medical Oncology, OHSU Knight Cancer Institute, Oregon Health &

Science University, Portland, OR, USA, 3Division of Pediatric

Hematology, Oncology, BMT, Childrens Hospital Colorado, University

of Colorado School of Medicine, Aurora, CO, USA, 4NYU Cancer

Institute, New York University Medical Center, New York, NY,

USA, 5Midwest Center for Cancer and Blood Disorders, Childrens

Hospital and the Medical College of Wisconsin, Milwaukee, WI,

USA, 6Department of Pediatric Hematology/Oncology, University of

Texas Southwestern Medical Center, Dallas, TX, USA, 7Howard

Hughes Medical Center, Portland, OR, USA, and8

PediatricHematology/Oncology/BMT, University of British Columbia and BC

Childrens Hospital, Vancouver, BC, Canada

E-mail: [email protected]

Keywords: leukaemia, BCR-ABL1, mutations, childhood

First published online 2 February 2012

doi: 10.1111/j.1365-2141.2012.09039.x

2012 Blackwell Publishing Ltd, 509


Correspondence


4/4

References

Arico, M., Schrappe, M., Hunger, S.P., Carroll, W.

L., Conter, V., Galimberti, S., Manabe, A., Saha,

V., Baruchel, A., Vettenranta, K., Horibe, K., Be-

noit, Y., Pieters, R., Escherich, G., Silverman, L.

B., Pui, C.H. & Valsecchi, M.G. (2010) Clinical

outcome of children with newly diagnosed Phil-

adelphia chromosome-positive acute lympho-blastic leukemia treated between 1995 and 2005.

Journal of Clinical Oncology, 28, 47554761.

Boulos, N., Mulder, H.L., Calabrese, C.R., Morri-

son, J.B., Rehg, J.E., Relling, M.V., Sherr, C.J. &

Williams, R.T. (2011) Chemotherapeutic agents

circumvent emergence of dasatinib-resistant

BCR-ABL kinase mutations in a precise mouse

model of Philadelphia chromosome-positive

acute lymphoblastic leukemia. Blood, 117, 3585

3595.

Druker, B., Sawyers, C., Kantarjian, H., Resta, D.,

Reese, S., Ford, J., Capdeville, R. & Talpaz, M.

(2001) Activity of a specific inhibitor of the

BCR-ABL tyrosine kinase in the blast crisis of

chronic myeloid leukemia and acute lympho-blastic leukemia with the philadelphia chromo-

some. The New England Journal of Medicine,

344, 10381042.

Hu, Y., Liu, Y. & Pelletier, S. (2004) Requirement

of Src kinases Lyn, Hck, and Fgr for BCR-ABL

1-induced B-lymphoblastic leukemia but not

chronic myeloid leukemia. Nature Genetics, 36,

453461.

Jones, D., Thomas, D., Yin, C.C., OBrien, S., Cor-

tes, J.E., Jabbour, E., Breeden, M., Giles, F.J.,

Zhao, W. & Kantarjian, H.M. (2008) Kinase

domain point mutations in Philadelphia chro-mosome-positive acute lymphoblastic leukemia

emerge after therapy with BCR-ABL kinase

inhibitors. Cancer, 113, 985994.

OHare, T., Walters, D., Stoffregen, E., Taiping, J.,

Manley, P., Mestan, J., Cowan-Jacob, S., Lee, F.,

Heinrich, M., Deininger, M. & Druker, B.

(2005) In vitro activity of Bcr-Abl inhibitors

AMN107 and BMS-354825 against clinically rel-

evant imatinib-resistant Abl kinase domain

mutants. Cancer Research, 65, 45004505.

Pfeifer, H., Wassmann, B., Pavlova, A., Wunderle,

L., Oldenburg, J., Binckebanck, A., Lange, T.,

Hochhaus, A., Wystub, S., Bruck, P., Hoelzer,

D. & Ottmann, O.G. (2007) Kinase domain

mutations of BCR-ABL frequently precede i-matinib-based therapy and give rise to relapse in

patients with de novo Philadelphia-positive

acute lymphoblastic leukemia (Ph+ ALL). Blood,

110, 727734.

Ravandi, F., OBrien, S., Thomas, D., Faderl, S.,

Jones, D., Garris, R., Dara, S., Jorgensen, J.,

Kebriaei, P., Champlin, R., Borthakur, G., Bur-

ger, J., Ferrajoli, A., Garcia-Manero, G., Wierda,

W., Cortes, J. & Kantarjian, H. (2010) First

report of phase 2 study of dasatinib with hyper-

CVAD for the frontline treatment of patientswith Philadelphia chromosome-positive (Ph+)

acute lymphoblastic leukemia. Blood, 116, 2070

2077.

Schultz, K.R., Bowman, W.P., Aledo, A., Slayton,

W.B., Sather, H., Devidas, M., Wang, C., Davies,

S.M., Gaynon, P.S., Trigg, M., Rutledge, R., Bur-

den, L., Jorstad, D., Carroll, A., Heerema, N.A.,

Winick, N., Borowitz, M.J., Hunger, S.P., Car-

roll, W.L. & Camitta, B. (2009) Improved early

event-free survival with imatinib in Philadelphia

chromosome-positive acute lymphoblastic leuke-

mia: a childrens oncology group study. Journal

of Clinical Oncology, 27, 51755181.

MCL1 down-regulation plays a critical role in mediating

the higher anti-leukaemic activity of the multi-kinase

inhibitor Sorafenib with respect to Dasatinib

Acute myeloid leukaemia (AML) is the most frequent acute

leukaemia of adults. Mutations in the FMS-like tyrosine

kinase-3 (FLT3) occur in 2530% of AML patients, leading

to internal tandem duplications in the juxtamembrane

domain of the receptor (FLT3-ITD) (Stirewalt & Radich,

2003). Since the FLT3-ITD mutation dictates a particularly

poor clinical outcome (Stirewalt & Radich, 2003), several

specific FLT3 inhibitors have been developed and evaluated

in clinical trials, but their overall clinical efficacy in AML to

date must be considered as minor. A new class of pharmaco-logical compounds with the potential to target FLT3-ITD is

represented by the second generation of protein kinase inhib-

itors. Therefore, we have compared the anti-leukaemic activ-

ity of the multi-kinase inhibitors Dasatinib and Sorafenib in

a panel of myeloid leukaemic cells and primary AML blasts

with different FLT3 (FLT3wild-type and FLT3mutated) status.

Dasatinib (BMS-354825), which is currently used in clinical

trials for the treatment of chronic myeloid leukaemia, was

chosen based on recent data suggesting that it might also dis-

play potential cytotoxic activity in AML (Guerrouahen et al,

2010), while Sorafenib (Nexavar) was chosen based on preli-

minary clinical studies in which it was found particularly

active in FLT3-ITD positive patients (Metzelder et al, 2009).

Dasatinib and Sorafenib (both from Selleck Chemicals,

Houston, TX, USA) were comparatively analysed on five AML

cell lines characterized by different FLT3 and TP53 status:

FLT3wild-type/TP53wild-type (OCI), FLT3wild-type/TP53mutated

(NB4), FLT3wild-type/TP53deleted (HL60), FLT3mutated/TP53wild-

type (MOLM), FLT3mutated/TP53mutated (MV4-11). Results wereevaluated by using analysis of variance with subsequent com-

parisons by Students t-test and with the MannWhitney rank-

sum test. Treatment with Sorafenib for 48 h exhibited a

marked cytotoxicity, resulting in cell viability lower than 40%

of the untreated cultures in all leukaemic cell lines (Fig 1A), as

evaluated by Trypan blue dye exclusion (Zauli et al, 1992). As

documented also by the 50% inhibitory concentration (IC50)

values, Sorafenib showed maximal citotoxicity on FLT3mutated

MV4-11 (IC50 < 1 lmol/l) and MOLM (IC50 < 1 lmol/l) fol-

510 2012 Blackwell Publishing Ltd,


Correspondence

Documents

2012 Imatinib Resistant BCR-ABL1 Mutations at Relapse in Children With PH ALL