COVERING THE BULLDOGSThe Offi ce of Athletics Communication produces stories, pertinent notes about upcoming games, and cumulative statistics, all of which are available at www.uncabulldogs.com, the on-line home of Bulldog athletics.

Interview Policy: The UNC Asheville Offi ce of Athletics Communication and the track & fi eld coaching staff are eager to assist the media with player and coach interview requests. Please contact the Offi ce of Athletics Communication for all player interviews. On the road, please make coach interview arrangements through the Athletics Commincation representative for that sport. Athletes will not be available for interviews on days of games until the completion of the contest. Your cooperation is appreciated.

Media Guides: UNC Asheville will not print media guides to assist in the department’s cost-containment efforts. The Athletics Communications Offi ce will provide the same material it has in the past through on-line supplements and enhanced notes packages.

Athletics Media Communications

Mike Gore Associate Athletics Director for

External Affairs / Track & Field ContactOffi ce Phone: (828) 251-6923Cell Phone: (828) 215-6387

Email: mgore@unca.edu

Matt PellegrinDirector of Athletics

Media CommunicationOffi ce Phone: (828) 251-6931Cell Phone: (828) 545-1121Email: mpellegr@unca.edu

Offi ce Fax: (828) 251-6386Web Site: www.uncabulldogs.com

Mailing Address:One University Heights

Justice Center, CPO #2600Asheville, N.C. 28804

MEDIA INFORMATION

• IT’S UNC ASHEVILLE When referring to our school, please call us

UNC Asheville in the fi rst reference. The sec-

ond reference can be just Asheville. There is

no hyphen in our name, and we have never

used North Carolina-Asheville. We do not use

UNCA anymore. Please go with UNC Asheville

or just Asheville. When abbreviating for video

or web streaming please use ASHVL or AVL,

depending on how much room you have. The

UNC Asheville Athletics Communications Of-

fi ce is thankful for your help.

NEWSPAPERS

Asheville Citizen-TimesPO Box 2090Asheville, NC 28802828/232-5867800/800-4204Fax: 828/251-0585

Hendersonville Times-NewsPO Box 490Hendersonville, NC 28739828/692-0505Fax: 828/692-2319

The MountaineerPO Box 129Waynesville, NC 28786828/452-0661Fax: 828/452-0665

The Charlotte ObserverPO Box 32188Charlotte, NC 28232704/379-6448Fax: 704/379-6506

WIRE SERVICEAssociated Press219 South McDowell St.Raleigh, NC 27602800/662-7075Fax: 919/834-1078

TELEVISION

WLOS-TV110 Technology DriveAsheville, NC 28803828/651-4563Fax: 828/651-4618

WSPA-TVPO Box 1717Spartanburg, SC 29304864/576-7777Fax: 864/587-5430

WYFF-TV505 Rutherford Rd.Greenville, SC 29602864/242-4404Fax: 864/240-5305

RADIO STATIONS1310 WISE Radio1190 Patton Ave.Asheville, NC 28804828/253-1310

WWNC RadioPO Box 6447Asheville, NC 28816828/253-3835

WCQS Radio70 Broadway St.Asheville, NC 28801828/253-6875

PRIMARY ATHLETICS LOGO

SECONDARY ATHLETICS LOGOS

Location: Asheville, North CarolinaEnrollment: 3,700Founded: 1927Nickname: BulldogsAffi liation: NCAA Division IConference: Big SouthColors: Royal Blue and WhiteChancellor: Dr. Anne PonderFaculty Representative: Dr. Herman HoltDirector of Athletics: Janet R. ConeAssociate Athletics Director forExternal Affairs: Mike GoreAssociate Athletics Director of Internal Affairs and Compliance: Terri BrneDirector of Development and Alumni Relations: Ken Hogue Athletics Business Manager: Judith BohanDirector of Marketing: Erin Punter SpenceTicket Manager: Harmon TurnerTicket Offi ce Phone: (828) 251-6904

THE TEAMMEN

Jay Barringer Distance Sr. Charlotte, N.C. (Myers Park HS)Eliud Chirchir Distance Sr. Eldoret, Kenya, (Wyoming ) (Kalyet)Simon Haake Throws Sr. Chapel Hill, N.C. (East Chapel Hill HS)Jeremy Harn Throws Jr. Chapel Hill , N.C. (East Chapel Hill HS)Courtney Henry Jumps Fr. Jonesboro, GA (Ola High)Kurt Hibert Throws So. Vista, Calif. (Rancho Buena Vista HS )Stuart Johnson Sprints Fr. Burnsville, N.C. (Mountain Heritage HS)Derek Larsen Sprints So. Fairview Park, Ohio (St. Edward HS)Carlos Lopez Distance Sr. Scottsdale, , Ariz. (Scottsdale JC)Sam Maynard Distance Jr. Medina, Ohio (Medina HS)Tyler Michael Distance Fr. Asheville, N.C. (Erwin HS)Chris Murray Distance So. Jamestown, N.C. (Ragsdale HS)Aaron Nix Sprints So. Powder Springs, Ga. (Dominion Christian HS)Zach Odum Sprints So. Jacksonville, N.C. (Jacksonville HS)Sebastian Paniagua Distance Fr. Haymarket, Va. (Battlefi eld HS)Kent Rankin Distance Jr. Medina , Ohio (Medina HS)Milan Ristic Sprints Fr. Belgrade, Serbia (Serbia-Nikola Tesla )Adam Schnapp Distance Jr. Silver Spring, Md. (Blake HS)Nick Summers Mid Distance Fr. Salisbury, NC (Salisbury)

WOMEN

Claire Anderson Throws Sr. Chapel Hill, N.C. (Centre College) (East Chapel Hill HS)Jennifer Black Distance So. Charlotte, N.C. (Providence HS)Ginger Buchanan Distance Fr. Hayesville , N.C. (Hayesville HS)Emma Bussard Distance Jr. Carrolton, Ga. (Carrolton HS)Rachel Carson Distance Fr. Winchester, Va. (James Wood HS)Ashlei Clodfelter Jumps So. Whitsett, N.C. (North Davidson HS)Meredith Foster Jumps Fr. Hendersonville, N.C. (West Henderson HS)Sarah Gentry Sprints So. Plano, Texas (Canyon Creek Christian Academy)Ashley Hunt Sprints So. Trinity , N.C. (Trinity HS)Alyska Kalmeijer Mid Distance So. Marietta, Ga. (Alan C. Pope HS)Melanie Kulesz Distance So. Oak Ridge, Tenn. (Oak Ridge HS)Shelby Lott Distance Fr. Morganton, N.C. (Patton HS)Corey McClintock Sprints So. Black Mountain, N.C. (North Carolina School for Science & Math)Charlotte Mull Sprints So. Connely Springs, N.C. (East Burke HS)Natalie Pearson Sprints Sr. Sheffi eld, England (Tapton School)Emily Pineda Sprints Jr. Boone, N.C. (Watauga HS)Clair Powell Distance So. Mooresville, N.C. (Mooresville HS)Erin Putnam Distance Jr. Jacksonville, N.C. (Jacksonville HS)Kylie Smith Distance So. Fairview, N.C. (Roberson HS)Whitney Stafford Sprints So. Fairview, N.C. (Reynolds HS)

NCAA QUALIFIERSNATALIE PEARSON - SPRINTER

Honorable Mention All-American – 200 Meters(2010, 2011)NCAA Qualifi er – 200 Meters(2010, 2011)East Regional Qualifi er – 100 & 200 meters(2009, 2010, 2011) Big South Conference Track And Field Athlete of the Year (2010, 2011)Big South Conference Most Outstanding Female Track for Outdoor (2010)Top Female Collegiate Athlete in Western North Carolina (2010)Outdoor Big South Conference Champion – 200 me-ters (2010, 2011)Big South All Conference Indoor – 60 meters (2009, 2011)Big South All-Conference Indoor – 200 meters (2009, 2001)Big South All Conference Outdoor- 100 meters (2010)Indoor Big South Conference Champion – 60 meters (2007)Big South Indoor Freshman of the Year (2006)

SIMON HAAKE - JAVELIN

East Regional Qualifi er (2010, 2011)

Big South All Conference (2011)

Ranked nationally (2010, 2011)

Big South All Academic Team Indoor Track (2010, 2011)

Big South All Academic Team Outdoor Track (2010, 2011)

Jesse NormanAlma Mater: .............................Western Carolina, 2003Year: ..............................................................................Fifth

Former Western Carolina standout and assistant coach Jesse Norman just fi nished up his fourth year as head coach of the UNC Asheville Cross Country and Track and Field programs. Norman earned his fi rst Big South Coach of the Year honors in 2011 when the Bulldog women’s indoor squad stunned the fi eld at the Big South Meet and fi nished in third place. It was easily the highest fi nish ever for and Bulldog track and fi eld program. Also in 2011, senior sprinter Natalie Pearson completed her Bulldog career as the champion in outdoor in the 100 and 200 meters. In the 200 meters, she qualifi ed for the National Champi-onships for the second consecutive year. Pearson was named Big South Conference Women’s Track and Field Athlete of the Year for the second straight season. In addition, Simon Haake qualfi ed for the Eastern Region for the second straight year in the javelin in 2011. The former walk-on showed tremendous improvment each year and became one of the top javelin throwers in the region the past two years.

Both cross country programs have steadily improved each season under Norman’s guidance.

Norman worked for two years at Western Carolina with the Catamounts men’s and women’s distance teams before coming to UNC Asheville. He helped guide WCU cross country runner Dan Fassinger to an all-conference fi nish in cross country last season and Deanna Kulesz to an all-conference fi nish in the 1500 and 3000 meters. Norman was part of a Catamount coaching staff that helped WCU win two straight Southern Conference Outdoor Track and Field championships.

Norman enjoyed a great career at Western Carolina from 1999-2003. He won the Southern Conference individual championship in cross country in 2001, the only Catamount ever to accomplish such a feat. Norman was the squad’s MVP in 2000 and 2001. He earned all-conference honors in the 10,000 meters during the 2000 outdoor season. Norman had a sensational prep career at Fuquay-Varina HS where he was a fi ve-time state champion in cross country, 1600 meters and 3200 meters.

He also worked at Robbinsville HS for one year as the program’s head coach for cross country and track and fi eld. Norman earned a degree in physical education from Western Carolina in 2003 and then picked up his master’s in physical education in May of 2007.

Jesse and his wife Melanie have a daughter Eliza.

THE COACHES

Norman (left) was name the 2011 Women’s Indoor Track & Field Coach of the Year for the Big South Conference

Joel WilliamsAlma Mater: ............................. Appalachian State, 2004Year: ..............................................................................Fifth Joel Williams completed his fourth year assistant track and fi eld coach with the UNC Asheville men’s and women’s programs. He was hired during the fall of 2007. He is in charge of coaching the throws, sprints, and hurdle events. “We’re lucky to have Joel Williams,” stated head Bulldog track and fi eld coach Jesse Norman. “He has a lot of experience in a lot of different events and has made a wonderful impact on our program.” One of the highlights of Williams’ tenure at UNC Asheville has been the emergence of Simon Haake as one of the top throwers in the region. Haake, who had never participated in track and fi eld until walking on to the Bulldog program four years ago, made it to the Eastern Regionals in 2010 and 2011. He fi nished in fourth place in the Big South in 2010 and then moved to a platform fi nish with a third-place fi nish in 2011. Williams worked at Watauga High School in Boone, N.C. from 1994-2005 as the head coach of the indoor track and fi eld team and was an assistant coach for the outdoor track team. During his tenure as head coach of the indoor team, he coached 10 different student-athletes to North Carolina state championships and led the school to its fi rst ever state championship for indoor track in 1997.

Watauga had a great deal of success in outdoor track during that time with Williams as an assistant coach as he coached 12 State champions. He helped the Pioneer girls program to three 4A outdoor championships in 1995, 1996 and 1997. The boy’s team had their best fi nishes in 2000 when they were runners-up and prior to that in 1997 when they fi nished tied for third place. At the conference level, both the boy’s and girl’s teams won eight consecu-tive conference championships during his twelve season. He planned complete training/strength training programs for all sprinters up to and including 800m runners, hurdlers, and jumpers. Later, he also designed the strength programs for several school record-setting throwers.

During his time at Watauga, Williams was the high school coach to Abraham Morlu from his freshmen year in high school on to a spot with the Liberian national 400m relay team, for the 2000 Sydney Olympic Games. Morlu made his national team for the 2003 World Championships.

Williams served as the high school coach to Brenda Taylor who later won the 2001 NCAA 400m hurdles champion while at Harvard and in 2004 was a U.S. Olympian in Athens, Greece fi nishing 7th in that event. Her second place time of 53.36 at the U.S. Olympic Trials ended the year as the number fi ve time in the world for 2004. Williams coached Taylor to nine state individual and relay state track championships while at Watauga.

Additionally, Williams was a high school coach for Brenda’s twin sister, Lindsay, who, in addition to being a top high hurdler in North Carolina, was a 5’11 ½” high jumper while at Watauga. As a result of her best marks, a top 2 fi nish at the USATF junior nationals and a fourth place fi nish at the Pan Am junior championships in Cuba, she was voted top three in the high jump nationally by Track and Field News for the 1997 outdoor season. Taylor won numerous conference championships while a student at Brown University, qualifi ed for two NCAA championships in the Heptathlon, and later became an elite pole vaulter fi nishing top three at the 2003 USATF indoor national championships.

Williams’ most successful 800m runner was Donna Bealer. She ran 2:16.78 in 1998 to win a state championship in that event as a junior in high school. Bealer teamed up with both Taylors and Garrie Storie to win both indoor and outdoor state championships in the 4 x 400m relay running a best time of 3:53.01 in 1997.

During the 2000 outdoor track season, two of his athletes, Patrick Murphy and Nathan Giles were one half of Watauga’s then state high school record-setting 4 x 800m team of 7:49.00.

In August of 2009, Daniel Duckworth, one of his former athletes at Watauga who was a Southern Conference champion in the weight throw while competing for Appalachian State, was invited to try out for one of the two-man bobsled teams for the U.S.

Williams is a 2004 graduate of Appalachian State University with a Bachelor’s of Science in Health Promotion with minors in Exercise Science and Sociology. He is a USATF level II certifi ed coach in both Sprints/Hurdles/Relays and the Throws. He also holds a USAW (USA weightlifting federation) Club Coach certifi cation for teaching/coaching the Olympic lifts.

THE COACHES

Adam PuettAlma Mater: .............................Western Carolina, 2006Year: ..............................................................................First

Adam Puett is in his fi rst year as an assistant coach with the UNC Asheville cross country and track and fi eld programs. The for-mer Western Carolina standout will work with the Bulldog distance runners.

Puett enjoyed an outstanding career for the Catamounts. He was the 2005 Western Carolina Male Athlete of the Year and 2006 Southern Conference Outdoor Performer of the Year. Adam earned All Conference honors three times in cross country and 10 times in indoor and outdoor track. He was a fi ve-time So-Con champion in indoor and outdoor track plus a four-time NCAA outdoor regional qualifi er in the 1500. The Alabama native won the Southern Confer-ence 1500 meters for three consecutive years.

Before coming to UNC Asheville, Puett served as an assistant coach at WCU for three years. He coached events ranging from the 800 meters to the 10,000 meters. The Alabama native coached 13 All-Conference performers and six Southern Conference champi-ons during his tenure. He helped lead the Catamount programs to fi ve different league championships.

Puett graduated from Western Carolina in 2006 and then earned his Masters in Physical Education from WCU in 2009.

THE COACHES

Since its founding in 1983, the Big South Conference has matured into a competitive leader in college athletics, actively pursuing excellence on the fi eld of play and in the classroom. The League’s growing presence as an NCAA Division I athletic conference is evident by athletic accomplishments on the national stage, innovative marketing and media partnerships, increased television packages, and quality athletic competition while intentionally fostering the academic, personal, social, athletic and leadership development of each student-athlete. This has evolved into the Conference’s mission of “Developing Leaders Through Athletics.”

The Big South Conference was formed on August 21, 1983, when Charleston Southern (then Baptist College) Athletic Director Howard Bagwell and Augusta President George Christenberry began recruiting members into the Big South, receiving initial commitments from Augusta, Charleston Southern, Campbell, Coastal Carolina and Winthrop. One month later, Dr. Edward M. Singleton was selected as the League’s fi rst Commissioner and continued to solicit new members. His efforts led to the additions of Armstrong State, Radford and UNC Asheville, giving the Big South more than the required six members to constitute an offi cial conference. The Big South’s fi rst year of competition was in the Fall of 1984, and in September 1986, the Big South Conference was granted full-fl edged NCAA Division I status.

During its infancy and prior to securing automatic bids to NCAA Championships, the Big South made early strides in earning at-large berths in several national postseason events, including volleyball, women’s basketball and women’s golf. In 1989, George F. “Buddy” Sasser replaced the retiring Dr. Singleton as Commissioner, and in 1990, the League received its fi rst automatic bid – receiving an automatic qualifi er to the NCAA Baseball Championship. Under Sasser’s seven years of leadership, the Conference implemented its public relations and compliance programs, and introduced its fi rst-ever men’s basketball television package, featuring the Big South competing among some of the fi nest teams in the nation. In August 1996, Kyle B. Kallander replaced Sasser as the League’s third Commissioner, and in his 13 years at the helm of the Big South, Kallander has been instrumental in aggressively promoting the Conference to new levels. The Conference has enjoyed record levels in marketing revenue during the past several years, he has brought television coverage to Big South women’s basketball, baseball and softball for the fi rst time in Conference history, as well as increased national television exposure to the League as a whole through aggressive and unique television packages.

Under Kallander’s leadership, the Big South developed and initiated its fi rst long-range strategic plan, re-affi rming the League’s vision as a distinctive athletic Conference committed to the quality of institutional life through athletic competition. He also spearheaded the efforts to add football as a championship sport, which came to fruition in 2002, and has solidifi ed Conference membership with the additions of High Point, Gardner-Webb and Presbyterian, and in 2011-12, the return of charter member Campbell University. Kallander’s long range vision has also included technological advancements, as the Conference introduced its fi rst live event video streaming in 2005 and has since expanded its video offerings to more than 600 events annually through a partnership with the member institutions, as well as the creation of several online and social media platforms.

In the last 15 years alone, the Big South Conference has experienced monumental growth and success in nearly every sport. During this time, the Conference has had two individual National Champions, more than 200 All-Americans, has reached the “Sweet 16” in men’s soccer, women’s basketball and baseball, has received national Top 25 rankings in men’s soccer, men’s basketball, women’s basketball, baseball, men’s outdoor track & fi eld, and men’s golf, had an individual selected to play in the NCAA Singles Championship four times in addition to the fi rst men’s tennis doubles at-large selection, had the No. 1 ranked men’s golfer in the country, has had the nation’s top scoring men’s basketball team three consecutive years as well as the national men’s basketball scoring leader twice, received an at-large playoff berth in the Football Championship Subdivision in 2006, and had an institution fi nish fi fth in the NCAA Men’s Golf Championships – the Conference’s highest-ever team fi nish in an NCAA event.

The Conference’s tagline, “Developing Leaders Through Athletics” was unveiled in 2008-09 in conjunction with the Conference’s 25th Anniversary. The League also honored its heritage with the Top 25 “Best of the Best” moments in League history from 1983-2008, with Liberty University’s 10-year women’s basketball championship run from 1996-2007 being crowned the No. 1 moment in the Big South’s fi rst 25 years. The Conference’s on-fi eld accomplishments have been duplicated in the classroom. Annually, more than 40 percent of Conference student-athletes are named to the Big South’s Presidential Honor Roll for maintaining a cumulative 3.0 grade-point average, and the League has had more than 95 Academic All-Americans in its quarter-century of existence.

Big South Quick FactsFounded: 1983Headquarters: 7233 Pineville-Matthews Road, Suite 100Charlotte, NC 28226Phone: (704) 341-7990Fax: (704) 341-7991www.BigSouthSports.com

Full-Time Member Institutions (10): Charleston Southern University, Coastal Carolina University, Gardner-Webb University, High Point University, Liberty University, Presbyterian College, Radford University, Univeristy of North Carolina, Asheville, Virginia Military Institute, and Winthrop University.

THE RECORDS - MEN100 Meters1. Milan Ristic 10.92 20112. Enita Okodiko 10.93 20063. Brandon Hamilton 11.03 2007 Courtney Henry 11.03 20114. Eric Fitzgerald 11.07 19985. Jordan Yarbrough 11.09 2010Wind Aided Eric Fitzgerald 10.80 1998

200 Meters1. Milan Ristic 21.85 20112. Enita Okodiko 22.00 20063. Eric Fitzgerald 22.38 19984. Courtney Henry 22.47 20115. Raymond Urruitia 22.54 2010Wind Aided Raymond Urruitia 22.13 2010

400 Meters1. Dane Corriher 49.97 20072. Jeremy Twiggs 49.99 20013. Nelson Delgado 50.14 19944. Andrew Burnette 50.77 20085. Giovanni Freeman 51.42 1994

800 Meters1. Nelson Delgado 1:50.94 19942. Sam Maynard 1:51.08 20103. Jim Phillips 1:52.57 19984. Eliud Chirchir 1:53.32 20105. Brandon Trollip 1:54.33 1997

1500 Meters1. Brandon Trollip 3:51.14 19982. Taylor Little 3:53.08 20073. Ed Matthews 3:54.58 19974. Sam Maynard 3:56.14 20105. Eliud Chirchir 3:56.65 2010

3,000 Meters1. Phil Latter 8:33.96 20042. Brendan McGrane 8:34.21 19993. Taylor Little 8:34.46 20064. Brandon Trollip 8:44.69 19995. James Rogers 8:46.00 1998

5,000 Meters1. Taylor Little 14:19.16 20072. Chad Pearson 14:36.57 20003. James Rogers 14:36.80 19984. Phil Latter 14:47.64 20045. Martin Morales 14:52.55 1994

10,000 Meters1. Jon Harmon 31:08.20 20062. Root Kirbach 31:08.79 20073. Pat Spencer 31:43.90 19964. Martin Morales 32:28.10 19945. Jerrold Benally 32:43.90 1994

110 Meter Hurdles1. Milan Ristic 14.32 20112. Kris Fant 14.41 20043. Joel Collier 15.36 20044. Derek Larsen 15.76 20105. Andy Gainor 15.80 1997

400 Meter Hurdles1. Andy Guzy 53.25 20012. Joel Collier 54.29 20033. Brandon Hamilton 55.60 20074. Michael Eitelberg 57.77 2001

3,000 Meter Steeplechase1. Dave Bell 9:06.08 20062. Brendan McGrane 9:09.96 19993. Eddie Legair 9:30.26 19984. Sam MacGibbon 9:32.90 19945. Tim Gautreau 9:37.52 1999

4 x 100 Meter Relay1. Scott, Roseboro, Fant, Young 42.70 20052. Larsen, Yarbrough, Urruitia, Haake 43.30 20103. Creel, Northington, Gainor, Fitzgerald 43.38 19984. Hamilton, Corriher, Ahmad, Bandoly 43.65 20085. Corriher, Ahmad, Young, Hamilton 43.67 2007

4 x 400 Meter Relay1. Guzy, Roberts, Collier, Twiggs 3:20.97 20022. Phillips, Twiggs, Collier, Guzy 3:22.91 20013. Urruitia, Chirchir, Maynard, Lopez 3:24.57 20104. Corriher, Maynard, Burnette, Matthews 3:25.55 20095. Corriher, Burnette, Stepp, Holman 3:25.86 2008

High Jump1. Chad Wynens 1.98m 6-6.00 19962. Justin Bellamy 1.93m 6-4.00 20023. Nick Mozzone 1.90m 6-2.75 20104. Tom Barber 1.83m 6-0.00 20015. Simon Haake 1.75m 5-9.75 2010 Long Jump1. Jordan Yarbrough 6.83m 22-5.00 20102. Milan Ristic 6.73m 22-1.00 20113. Vince Kreiger 6.63m 21-9.00 19974. Omar Ahmad 6.61m 21-8.25 20065. Courtney Henry 6.55m 21-6.00 2011Wind Aided Milan Ristic 7.03m 23-0.75 2011 Triple Jump1. Will Beasley 13.78m 45-2.50 20092. Omar Ahmad 13.59m 44-7.00 20063. Giovonni Freeman 13.21m 43-4.25 19944. Dane Horne 11.76m 38-7.50 19995. Robbie Greene 11.70m 38-4.75 1999Wind Aided Omar Ahmad 13.85m 45-5.25 2006

Pole Vault1. Ian Boyd 3.96m 12-11.75 20102. K.C. Radford 3.85m 12-7.50 20073. Kelvin Howard 3.81m 12-6.00 2000 Michael Eitelberg 3.81m 12-6.00 2001 4. Simon Haake 3.21m 10-6.25 2010 5. Dane Horne 3.05m 10-0.00 1999

Shot Put1. Nathan Hedgpeth 17.00m 55-9.25 20052. Brian MacPhee 16.02m 52-6.75 20013. Simon Haake 14.25m 46-9.00 20114. Daniel Corriher 13.94m 45-9.00 20075. Adam Chacon 13.77m 45-2.25 2002

Discus1. Nathan Hedgpeth 53.83m 176-7 20052. Clint Barden 50.52m 165-9 20043. Brian MacPhee 48.86m 160-4 20014. Troy Young 45.36m 148-10 20055. Kurt Hibert 44.39m 151-05 2011 Hammer Throw1. Clint Barden 51.93m 170-4 20022. Simon Haake 49.94m 163-10 20113. Keith Scruggs 48.37m 158-8 20094. Adam Chacon 47.70m 156-6 20025. Brian MacPhee 47.28m 155-1 2002 Javelin1. Simon Haake 68.15m 223-7 20112. Troy Young 56.71m 186-0 20063. Erik Nabi 55.48m 182-0 2008 4. Brian MacPhee 53.62m 175-11 20015. Michael Creel 51.07m 167-6 1998 Decathalon1. Troy Young 5689 20062. Michael Eitleberg 5667 20023. Simon Haake 5510 2010

4 x 800 Relay1. Phillips, Matthews, Legair, Trollip 7:35.76 19972. Chirchir, Maynard, Lopez, Rankin 7:49.59 20103. Trollip, Phillips, Rogers, ???? 7:57.19 19984. Phillips, Matthews, Gautrea, Trollip 7:58.27 1997

4 x 1500m Relay1. Legair, Phillips, Halyburton, Trollip 15:58.12 19982. Phillips, Matthews, Legair, Trollip 16:07.91 19973. Fernandez, Trollip, J. Hill, McGrane 16:22.30 1999

Distance Medley Relay1. Legair, Rogers, Phillips, Trollip 10:01.68 19982. Legair, Northington, Trollip, Phillips 10:03.99 19983. McGrane, Guzy, J. Hill, Trollip 10:10.96 1999

OUTDOOR

THE RECORDS - MEN55 Meters1. Brandon Hamilton 6.49 2006 Milan Ristic 6.49 20102. Dante Roseboro 6.54 20043. Eric Fitzgerald 6.58 1998 Jordan Yarbrough 6.58 20104. Troy Young 6.71 20045. Kris Fant 6.72 2004

60 Meters1. Raymond Urruitia 7.04 20102. David Pickett 7.08 20103. Enita Okodiko 7.09 2006 Milan Ristic 7.09 20114. Dante Roseboro 7.10 20055. Jordan Yarbrough 7.13 2010

200 Meters1. Milan Ristic 22.32 20102. Enita Okodiko 22.38 20063. Ivan Scott 22.54 20054. Raymond Urruitia 22.64 20105. Dane Corriher 22.71 2005

400 Meters1. Dane Corriher 49.98 20092. Andy Guzy 50.55 20003. Jeremy Twiggs 50.67 20034. Ivan Scott 50.81 20055. Enita Okodiko 50.93 2005

800 Meters1. Eliud Chirchir 1:54.62 20102. Jim Phillips 1:55.09 19983. Nelson Delgado 1:55.36 19954. Sam Maynard 1:55.39 20105. Eddie Legair 1:56.27 1998

Mile1. James Rogers 4:16.84 19962. Taylor Little 4:17.26 20063. Travis Rudnick 4:17.31 19964. Brendan McGrane 4:17.44 19985. Brandon Trollip 4:17.56 1997

3,000 Meters1. Taylor Little 8:22.48 20072. Jon Harmon 8:29.68 20083. Phil Latter 8:32.62 20034. James Rogers 8:41.11 19985. Brendan McGrane 8:41.35 1998

5,000 Meters1. Jon Harmon 14:55.76 20082. Phil Latter 14:58.64 20033. James Rogers 15:07.01 19984. Chad Pearson 15:17.21 20005. Root Kirbach 15:17.63 2005

55 Meter Hurdles1. Kris Fant 7.49 20052. Derek Larsen 8.10 20103. Joel Collier 8.14 20044. Andy Gainor 8.40 19985. Brian Cain 8.60 2000

60 Meter Hurdles1. Kris Fant 8.13 20052. Milan Ristic 8.28 20113. Joel Collier 8.78 20044. Derek Larsen 8.81 20105. Dane Horne 9.06 1999

4 x 400 Meter Relay1. Freeman, Twiggs, Roberts, Collier 3:26.31 20022. Corriher, Stepp, Maynard, Burnette 3:26.68 20093. Corriher, Goodrum, Burnette, Okodiko 3:27.83 20064. Phillips, Eitelberg, Twiggs, Guzy 3:28.03 20015. Urruitia, Larsen, Chirchir, Maynard 3:28.47 2010

Distance Medley Relay1. Phillips, Trollip, Legair, McGrane 10:17.82 19982. Maynard, Urruitia, Chirchir, Lopez 10:21.37 20103. Gautreau, Guzy, Roberts, Trollip 10:27.10 19994. Bell, Goodrum, Jackson, Mazzotta 10:31.84 2004

High Jump1. Chad Wynens 1.93m 6-4 19962. Nick Mozzone 1.90m 6-2.75 20103. Andrew Heath 1.83m 6-0 20004. Marcus Bethea 1.78m 5-10 1999 5. Chris Nimsch 1.68m 5-6 1997

INDOORLong Jump1. Dante Roseboro 6.85m 22-5.75 2004 2. Omar Ahmad 6.58m 21-7.25 20083. Courtney Henry 6.55m 21-6.00 20114. Jordan Yarbrough 6.53m 21-5.25 2010 5. Troy Young 6.31m 20-8.50 2005

Triple Jump1. Omar Ahmad 13.62m 44-8.25 20082. Courtney Henry 12.80m 42-0.00 20103. Will Beasley 12.56m 41-6.00 2009 4. Simon Haake 12.11m 39-8.75 2010 5. Kevin Johnson 11.65m 38-3 2000 Shot Put1. Brian MacPhee 16.17m 53-0.75 2001 2. Nathan Hedgepeth 16.03m 52-7 20043. Simon Haake 14.21m 46-7.50 20114. Daniel Corriher 14.01m 45-11.75 2008 5. Adam Chacon 14.00m 45-11.25 1999

Weight Throw1. Clint Barden 16.22m 53-2 2002 2. Brian MacPhee 15.92m 52-2.75 20013. Simon Haake 15.45m 50-8.25 2011 4. Adam Chacon 14.55m 47-9 20025. Keith Scruggs 13.77m 45-2.25 2009 Pole Vault1. Ian Boyd 4.10m 13-5.25 20102. Kelvin Howard 3.66m 12-0 2000 3. Michael Eitelberg 3.65m 11-11.75 2001 4. K.C. Radford 3.51m 11-6 20075. Dane Horne 3.05m 10-0 1999

Milan Ristic

THE RECORDS - WOMEN100 Meters1. Natalie Pearson 11.60 20102. Tanya Harris 12.81 20063. Eureka Jones 12.84 20104. Jazmyn Williams 12.88 2004Wind Aided Natalie Pearson 11.59 2011 Tanya Harris 12.53 2005 Jennifer Harrison 12.76 2001

200 Meters1. Natalie Pearson 23.47 20102. Tanya Harris 24.77 20063. Tia Hill 25.50 19994. Eureka Jones 26.09 20105. Jazmyn Williams 26.20 2004Wind Aided Natalie Pearson 23.25 2010

400 Meters1. Tanya Harris 54.95 20062. Sarah Gentry 58.24 20113. Tia Hill 59.33 19994. Erika Walker 59.66 20075. Eureka Jones 59.68 2010

800 Meters1. Zola Davis 2:10.69 20012. Sarah Gentry 2:12.14 20113. Devon Nemire-Pepe 2:16.73 20034. Alyska Kalmeijer 2:17.66 20105. Melanie Kulesz 2 :17.81 2011

1500 Meters1. Loring Watkins 4:33.89 20032. Mandy Becker 4:34.22 19993. Micki Logue 4:38.18 20044. Zola Davis 4:39.05 20015. Melanie Kulesz 4:39.09 2011

3,000 Meters1. Micki Logue 9:52.08 20042. Mandy Becker 9:56.55 19993. Emily Olinger 10:11.50 19974. Macy Little 10:17.24 20035. Becky Vonderhaar 10:20.29 1997

5,000 Meters1. Emily Olinger 17:10.86 19972. Mandy Becker 17:20.10 19993. Micki Logue 17:20.46 20044. Loring Watkins 17:30.11 20045. Becky Vonderhaar 17:35.90 1998

10,000 Meters1. Becky Vonderhaar 35:44.00 19982. Macy Little 36:38.98 20043. Jenn Grooms 38:14.40 19994. Emily Mase 38:21.31 20075. Katie Harmuth 38:41.33 1998

100 Meter Hurdles1. Anna Walker 15.16 20042. Laura Lewandowski 15.16 20033. Marlene Silva 15.22 19964. Rhi Dundee 15.60 19965. Marlene Gardner 15.84 1994

400 Hurdles1. Marlene Silva 1:03.71 19962. Diana Manee 1:04.54 20033. Marlene Gardner 1:05.06 19944. Whitney Stafford 1:06.27 20105. Anna Walker 1:06.85 2001

3000 Steeplechase1. Emma Bussard 10:53.29 20112. Micki Logue 11:46.54 20013. Joyce Cacka 12:27.90 19964. Rachael Ambrosia 12:37.67 2009

4x100 Relay1. Clodfelter, Pearson, Gentry, Jones 48.39 20102. Knight, Thompson, Walker, Harrison 49.78 20013. Harris, Lewandowski, Thompson, Manee 49.79 20034. Rodevick, Hill, Thompson, Harrison 50.20 2000

4 x 400 Meter Relay1. Lewandowski, Harris, Thompson, Manee 3:58.16 20032. Harris, Scheifer, Walker, Allstaedt 4:00.65 20063. Gentry, Jones, Stafford, Kalmeijer 4:00.78 20104. Harris, Allstaedt, Carberry, Mase 4:01.16 2005

High Jump1. Corrie Trotter 1.60m 5-3 20072. Rhi Dundee 1.59m 5-2.50 19963. Crystal Goure 1.57m 5-1.75 20014. Meredith Foster 1.55m 5-1.00 20115. Dawn Stanford 1.54m 5-0.50 1998 Brooke Thompson 2002 Long Jump1. Lisa Roberts 5.43m 17-9.75 19942. Brooke Thompson 5.39m 17-8.25 20033. Rhi Dundee 5.21m 17-1.25 1996 4. Jenny Bain 5.11m 16-9.25 19995. Laura Lewandowski 5.07m 16-7.75 2003

Triple Jump1. Lisa Roberts 12.08m 39-7.75 19942. Jenny Bain 10.85m 35-7.25 19993. Ashlei Clodfelter 10.80m 35-5.25 2010 4. Brooke Thompson 10.64m 34-11 20005. Ahunna Onwuzurki 10.57m 34-8.25 2002

Pole Vault1. Crystal Goure 3.05m 10-0 20012. Jenny Bain 2.44m 8-0 1999 3. Shanley Ressler 2.13m 6-11.75 2000

Shot Put1. Crystal Durham 12.90m 42-4 19932. Garette Hunter 12.85m 42-2 20023. Laura Lewandowski 12.45m 40-10.25 20024. Tish Franklin 12.33m 40-5.50 20005. Crystal Goure 11.24m 36-10.50 2001

Discus1. Crystal Goure 44.84m 147-1 20012. Garette Hunter 41.89m 137-5 20043. Ashley Southern 40.86m 134-1 20004. Molly deMattos 39.36m 129-1 20015. Tish Franklin 37.79m 123-11 2002

Hammer Throw1. Crystal Goure 47.07m 154-5 20042. Michelle Ray 45.39m 148-11 20003. Tish Franklin 41.78m 137-1 20024. Natalie Williams 40.00m 131-3 20065. Molly deMattos 39.64m 130-1 2002

Javelin1. Crystal Goure 48.98m 160-8 20042. Ashlei Clodfelter 39.80m 130-7 20113. Heather Polgar 35.02m 114-11 19984. Kristi Cummings 33.33m 109-4 19955. Amy Pearson 31.17m 102-3 2000

Heptathlon1. Laura Lewandowski 4426 20022. Brooke Thompson 4169 20023. Crystal Goure 3945 20014. Morgan Weeks 3700 2007

Odd Events

4 x 800 Relay1. Allstaedt, Mase, Duncan, Scheifer 9:46.82 20062. Nemire-Pepe, Watkins, Carberry, Scheifer? 9:57.10 2003

OUTDOOR

Ashlei Clodfelter

THE RECORDS - WOMEN55 Meters1. Natalie Pearson 7.08 20072. Tanya Harris 7.40 20063. Jazmyn Williams 7.51 20044. Donetta Floyd 7.55 20025. Eureka Jones 7.60 2010

60 Meters1. Natalie Pearson 7.54 20072. Tanya Harris 7.99 20063. Jazmyn Williams 8.17 20044. Jennifer Harrison 8.28 20015. Eureka Jones 8.29 2010

200 Meters1. Natalie Pearson 24.79 20092. Tanya Harris 25.21 20063. Diana Manee 26.42 20044. Jazmyn Williams 26.64 20045. Brooke Thompson 26.66 2003

400 Meters1. Tanya Harris 56.14 20062. Natalie Pearson 57.76 20083. Katharina Riesenberg 58.71 20064. Sarah Gentry 59.85 20105. Carleigh Knight 1:00.75 2002

800 Meters1. Sarah Gentry 2:15.31 20112. Zola Davis 2:17.18 20013. Tiffany Carberry 2:18.00 20044. Siobhan Keenan 2:19.65 19975. Marlene Silva 2:20.71 1995

Mile1. Micki Logue 4:59.82 20042. Zola Davis 5:04.18 20013. Loring Watkins 5:04.37 20034. Mandy Becker 5:04.71 19995. Melanie Kulesz 5:04.78 2011

3,000 Meters1. Micki Logue 10:05.18 20042. Loring Watkins 10:07.94 20033. Melanie Kulesz 10:10.38 20114. Mandy Becker 10:12.81 20005. Tiffany Carberry 10:15.94 2004

5,000 Meters1. Becky Vonderhaar 17:36.60 19982. Macy Little 17:52.62 20033. Melanie Kulesz 17:56.59 20114. Mandy Becker 18:04.36 20005. Katie Harmuth 18:10.47 1998

55 Meter Hurdles1. Laura Lewandowski 8.50 20042. Anna Walker 8.73 20043. Rhi Dundee 8.98 19964. Brooke Thompson 9.03 20025. Marlene Silva 9.26 1996

60 Meter Hurdles1. Anna Walker 9.19 20042. Laura Lewandowski 9.37 20033. Rhi Dundee 9.43 19964. Ashlei Clodfelter 9.49 20115. Whitney Stafford 9.64 2010

4 x 400 Meter Relay1. Manee, Thompson, Lewandowski, Harris 4:00.81 20032. Gentry,Pearson,Pineda,Kalmeijer 4:02.03 20113. Harris, I. Allstaedt, Carberry, Mase 4:02.63 20054. Walker, Allstaedt, Riesenberg, Weeks 4:05.13 20075. Gentry, Jones, Stafford, Kalmeijer 4:05.46 2010

Distance Medley Relay1. Logue, Hill , Davis, Wicke 12:21.60 20012. Powell,Gentry,Kalmeijer,Smith 12:27.99 20113. Stanford, Rassler, Mooney, Becker 12:32.01 19994. Mooney, Fercha, Stanford, Becker 12:35.15 1998

INDOORHigh Jump1. Crystal Goure 1.68m 5-5 2001 2. Rhi Dundee 1.63m 5-4.25 19963. Brooke Thompson 1.58m 5-2 20024. Corrie Trotter 1.57m 5-1.75 2007 5. Mackenzie Miller 1.53m 5-0.75 1996 Meredith Foster 1.53m 5-0.75 2011

Long Jump1. Brooke Thompson 5.21m 17-1 2002 2. Jenny Bain 5.15m 16-10 1999 3. Laura Lewandowski 5.00m 16-5 20024. Ashlei Clodfelter 4.93m 16-2.25 20105. Morgan Weeks 4.82m 15-9.75 2008

Triple Jump1. Ashlei Clodfelter 11.81m 38-9 20112. Jenny Bain 10.85m 35-7 1999 3. Brooke Thompson 10.61m 34-9 2000 4. Ahunna Onwuzurki 10.08m 33-1 2002 5. Samia Fercha 9.60m 31-6 1998 Shot Put1. Garrett Hunter 12.67m 41-7 2003 2. Tish Franklin 12.12m 39-9 2002 3. Tia Hill 11.99m 39-4 20014. Laura Lewandowski 11.80m 38-8 20025. Jessica Keys 11.35m 37-3 1999 Weight Throw1. Crystal Goure 14.86m 48-9 20032. Michelle Ray 13.88m 45-6 2000 3. Tish Franklin 13.71m 44-11.75 2002 4. Molly deMattos 13.31m 43-11 2001 5. Sara Davis 12.89m 42-3.5 2006 Pole Vault1. Crystal Goure 3.05m 10-0 2001 2. Laura Lewandowski 2.30m 7-6 20013. Jenny Bain 2.16m 7-1 1999 4. Shanley Ressler 2.15m 7-0.50 2000 Pentathlon1. Morgan Weeks 2623 2008

Melanie Kulesz fi nished second at the 2011 Indoor Big South Conference Championship in the 3,000 meters

Fiske Guide Gives High Marks to UNC Asheville and its Environmental Studies ProgramFiske Guide Gives High Marks to UNC Asheville and its Environmental Studies Program

UNC Asheville is once again ranked among the nation’s top colleges in the 2011 edition of the “Fiske Guide UNC Asheville is once again ranked among the nation’s top colleges in the 2011 edition of the “Fiske Guide to Colleges” published in July. The Fiske Guide calls UNC Asheville “one of the best educational bargains in the to Colleges” published in July. The Fiske Guide calls UNC Asheville “one of the best educational bargains in the country.”country.” “This public liberal arts university offers all the perks that are generally associated with pricier private “This public liberal arts university offers all the perks that are generally associated with pricier private institutions: rigorous academics, small classes, and a beautiful setting,” says the Fiske Guide, noting that UNC Asheville institutions: rigorous academics, small classes, and a beautiful setting,” says the Fiske Guide, noting that UNC Asheville provides all this for a fraction of the cost of a private college.provides all this for a fraction of the cost of a private college. In addition, for the seventh consecutive year, UNC Asheville’s Environmental Studies Program was named In addition, for the seventh consecutive year, UNC Asheville’s Environmental Studies Program was named to the Fiske Guide’s list of pre-professional programs with unusual strength in preparing students for careers. to the Fiske Guide’s list of pre-professional programs with unusual strength in preparing students for careers. Students in UNC Asheville’s program learn to address environmental issues through a multidisciplinary approach that Students in UNC Asheville’s program learn to address environmental issues through a multidisciplinary approach that includes biology, ecology, geology, chemistry, physics, economics, public policy, and other natural and social sciences. includes biology, ecology, geology, chemistry, physics, economics, public policy, and other natural and social sciences. Undergraduate research is an important feature of the curriculum, and the Environmental Studies Department Undergraduate research is an important feature of the curriculum, and the Environmental Studies Department stresses on-the-job internships in organizations involved with environmental issues. stresses on-the-job internships in organizations involved with environmental issues. The Fiske Guide also fi nds plenty to appreciate in UNC Asheville’s “picturesque mountain location in one of the The Fiske Guide also fi nds plenty to appreciate in UNC Asheville’s “picturesque mountain location in one of the most liveable small cities anywhere.” According to the Fiske Guide, “whether it’s the lush environment or the money most liveable small cities anywhere.” According to the Fiske Guide, “whether it’s the lush environment or the money you’re saving, the University of North Carolina at Asheville will have you seeing green.” you’re saving, the University of North Carolina at Asheville will have you seeing green.”

UNC Asheville Ranked Among Nation’s Best Colleges by U.S. News & World Report UNC UNC Asheville received high marks in the 2011 edition of U.S. News & World Report’s “Best Colleges” rankings released on August 17. UNC Asheville ranked fi fth among National Liberal Arts Colleges in “The 2011 Up-and-Comers” list, which highlights schools with “the most promising and innovative changes.” This select list leads the overall rankings in the 2011 edition of the U.S. News & World Report “Best Colleges” guidebook, which will be available on-line August 17 and on newsstands August 24. UNC Asheville was also one of only 25 universities in the nation to make the U.S. News & World Report list of “stellar” schools for undergraduate research/creative projects. UNC Asheville, Duke, and UNC-Chapel Hill are the lone North Carolina representatives on this list. UNC Asheville, which founded the National Council for Undergraduate Research more than 20 years ago, has made this roster annually since it began nine years ago. In addition, UNC Asheville was included on the list of 39 National Liberal Arts Colleges with the strongest commitment to undergraduate teaching. U.S. News & World Report’s overall rankings include a number of factors, including fi nancial support from alumni, grades and test scores of incoming freshmen and admissions selectivity along with the quality of instruction and curriculum. UNC Asheville was ranked sixth among public institutions in the National Liberal Arts Colleges category and number 158 in the category overall. Again this year, UNC Asheville was recognized by U.S. News & World Report for affordability as measured by student debt. The university ranked 14th among National Liberal Arts Colleges for least debt among graduating students. This is consistent with fi ndings from other leading college rankings services. The 2011 edition of the “Fiske Guide to Colleges,” issued in July, called UNC Asheville “one of the best educational bargains in the country.” In January, Princeton Review named UNC Asheville to its “Best College Values for 2010” list.

UNC Asheville Named One of the 50 “Best Value” Public Colleges in the U.S. by Princeton Review

Rising costs in today’s challenging economy has pushed up the price of everything from gas to groceries. But there are still great values to be found in higher education, according to “Best Value Colleges for 2010” ranking released today from the Princeton Review. UNC Asheville was among just 50 institutions nationwide named to the “Best Value” Public Colleges list. The Princeton Review also published a 50 “Best Value” Private Colleges list, for a total of 100 colleges in all. UNC Asheville was the only college or university in Western North Carolina to make the list. This is the fourth year that UNC Asheville has been selected by the Princeton Review as one of the 50 best value public colleges in the country. According to the Princeton Review, the schools that made the “Best Value” list are “fi rst-rate institutions offering outstanding academics at a relatively low cost of attendance and/or generous fi nancial aid.” The Princeton Review praised UNC Asheville’s growing national academic reputation, noting that the University provides “students a private school experience at a public school cost.” It also favorably notes the University’s numerous academic options, small class size and strong focus on the liberal arts. The ranking applauds UNC Asheville’s accessible faculty and the diverse offering of student activities both on and off campus. The Princeton Review selected the top 100 institutions as its “Best Value” choices for 2010 based on its surveys of administrators and students at more than 650 public and private colleges and universities. The selection criteria covered more than 30 factors in three areas: academics, costs of attendance, and fi nancial aid, using the most recently reported data from each institution for the 2008-09 academic year.

UNC Asheville consistently ranks as one of the nation’s best values in higher education. It has made the Fiske Guide to Colleges’ “Best Buy” list for the past 16 years and is among the Kiplinger’s Personal Finance magazine’s 100 best value public colleges and universities. And according to U.S. News & World Report’s current college rankings, UNC Asheville is among the top 25 liberal arts colleges in the nation whose students graduated with the least debt in 2008.

WHAT OTHERS ARE SAYINGWHAT OTHERS ARE SAYING

WWWWWiWWiWiWiWWWWiWiWiWiW hhhhththththh a a a aaabobobobobobbbobboboboboboobobobooututututuu 3 333,7,7,700000 sstututudededeeeennntntntntttnts s ss sss frfrfrfrf omomomomomm 4 4 4 44 4422 2 2 2 ststststatatatatatesesese aaaa aaandndndndndndndndndndndndndndndnddndndndndnddndndndnn 11 9 9 cocococoooooococoocooooooooooooc uuunununuunuuuuunnnuunttrtrtttrtrt iieieies,s, UU UUUUNCNCNCNCNCNCCCCCCNCNCCNCCCCCNNCCCCCCCCCCCCCCCCCCC AAA A AA AAA AAAA A AAAA AAAAAAAAAAAAAAAAAAAAAAshshshshhshshshshshsshshhhshs eveveveveeveveeveeeeeeeeve ilililililillillli leeleeeeee is ononoonnne off tthhhehe nnnnnnnatatiiooo ’n’n’n’’n’nn sssssssssssstototototototototototottottotoooopp ppppppp p pp p p p pp ppp pp pupupupupupppupupupupuuupppppppppp blblbblicicicic l l llibibibibibbbbbbibbbbiberererererererereererererereerralalalalalaaaaaaa a artrttsss s unununununu ivivvivererererrsisisisisis titititititiesesee a aandndnddnd o oooneneneee o o o offfff f ffffffff ththtthththththe ee ee 171717717 iiinsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnsnn ttititittttttttitututt titions in t t t ttttttttt tttttttttttheheheheheheheheheheheheheheheheheheehehhheeeheeh U UU UU U UUUUUUU UUUUUUUUUUUUUUUUUUUUnininininnnininininininininininnnininnnininn vvevevevevevevevvevevevvevvvvvevvevvversrsrsrsrsrsrsrsrssssssssittitititttty y yyyyyyyy yyyyyyyyyyyyyyyyy ofofff NN NN NNN NNNNNNNNNorrrthhthhthtt CCCCCCCCCCCCCarrrrrrrrrrrolinaaaaasyssysysysyssssyystttttttttsttttstsssteememmmmmmm. . UNUNUNUUNUNUUNUNUNUNUUUNUNUNUNUNUUNUNUNUNUUUNUUUUUUUUUUUUNC C C C CCCCCCCCCC AsAsAshehehevviviviviviviviviviivviviilllllllllllllllllllllllle ee eeee ee ofofofofoffefefefeersrsrsrsrs m mmmororororre e ththhhhhananann 333 3 3 333 33333330 00000000000 0000 mmmmmmmamm jooojojojorsrsrsrsrsrsrs l l ll l lllleaeaeaeaeae dddididididdidididiiidddiidididid nnnnngnggnnnnnnnnnnnnnngggggg t to o ththe babababababababababababbabbabbbbbbachchchchchchchelelelelelllelelelelellelelelllle ororoorooororororororororororooroorrororrororrorr oooo oo oooooooooooooofffff f ff ff ff ff fffff f f fffff f f arararararararararararararararrrarrarrarararaarra tststststststststststststststssssssss, , , , , , , ,,, bababababaabababababbbababaabababbbbbabbachchchchchchchchchchhchchhchchchchchchchchcchchhchhcchhcchchhcccchhheleeeeeeeeeee or ooooooooooof ff ff fffffffffffffffffffff scscscscscscsssscscsccieieeieieieieei ncnceeeaaanananaand d d d mamamamaaaasttstststststtereeeeereeeeeeeeeeeeee ooooo of fffff ffffffffffff lilililililililillililiiiiiiiiiiibebebebbebebebbebebebebebeeebebbebbbebbbbbbbb rararararararrrr l l lllll l ararartstststststststsstss dd ddd egegegegegrereeesesssss.....

HHHeHeHeHHerererere a aa arerere a a a f f fewewewe m m mororore eeeee ee e fafafactctctssssss s ssssss aaanananaaaaaa d dd fi fi gugureeeeeereress.s.ss.s.s.s.s.s.s.s

AcAcAcAcAcAAcAcAcAcAcAAcAcAcA adadaddddadaaaaaaaaa ememememmmememmmmmicicicicicii sssssAAvAvAverereeeragagaaagge e ClClClCCClCClClCllCllasasasasaaaaaaaaaaa s s s s SiSiSiSizezezeeeezezee::: ::::: 1919191919191919

MoMoMoststst PP Popoppuulululaaaarararaaa M M MMaaaaaajaaaajajorororss sss s bbbbybybybybb E E EEEEEEEEEEEEEnrnrrrrrrrrroloollmlmenent:t: P PPPPPPPPPPPPPPPPsysyssysyyyysyyyyyyysyychchchhchhchhc oooololoololooolooolololoooolooloolo ogogogogooggogoogoogggogyyy,y,y,y,yy,yy L L L LLLLititittittererererereere atatatturururureeee,e,ee,e, EEEEEE EEEEEEEEEEnvnvnvnvnvvnvvvvvvvvvvnvvvviririrrrrrrononononnnnnnnonononnnnonnnnnnnnnno mmmemememeeeeeememeeemeeeem ntntntntntnntntntnntnntnnnnnnnntnntnn alalaalalalalalalaallllalallallalaaaaaa SSSSS SSSSSSSSSSSSSS S S S Stututututututututututtuutuututututututututututututututtuuutuuuudididdidididididdidddididdidididididididddddidid esesesesesesessesesesesssesessseseesssessessseeseessssseesss, , , ,, ,,,,,,,ArArArArAAArt ttt anand d HiHiHiHiHHiHHiiiiiistsstssssssss oroory y y

FuFuFulblblblbbriririighghghghght t t t AAAAwwwwwwwwarararardsdsdsdssssss:: :: ::::::::::::: 3434343444343434343434344334444444444 s s ssttututututtt ddddeeeeeeeeeeenttttntntntntntnntntntnts s s hahahahavevevev reeeeececceceeeee eeieieieiieieiiiveveveveveveeveveed d ddd d d dddddddd thththhththhhhthththhee prprprpresesesestitit gigig ououuuus ss s s sss s awawawawaaawawawawawawawaaawwwaaawawawwaaaaaaaa aaaaaaaarararaaaaraaaaaaaaaaa dddddddddddd

UnUnUnUnnnnnnnnnnnnUnnUnUnUnU ddddedededdddddddddd rgrgrgrgrgggggrgggrggggraraaaaaaaaadduuuuuuaatatate e e ReReReReReRReRRRRReeRRRReRRRReRReRReesseseseseseseeeseeseseseesesesesesearaararrrararchchchch:::::: : : MoooMM rerer t thahan hhhahahhahahaaahhhahhahhalflflfflffffflff ooo oo o offff f f fffff ststststststuuuuuududuuuuu eeneenenennenee tttsttstststststststs ccc c cc c comomomomplplplpleeeeeteettettteeeteteteete eeeee e ee eeeeeeee ee oorooooorrrrooorrorrorooooooooo igigggggggggggggininininininininininnnaaaalalaaaaaaaaa rrrrrrrrr reeeeeeeseseeseeeee eaeaeaeaeaeaeaaaeaaeaaeeaeaeeaeee rcrcrccrcccccchhhhhh hhhhh hhhhhhh ininininininnninnniinnininiinnn ttttt t t tttttttttthhehheheheeheehehehehehehehehhehhhehhehhhhhehhhheiriririririiirir fi fififi fififi fifi ee ee e eldldldldlddlddd ooo o o oof f f f ffff stsstststststss udududududyyyyythththththhthht rrorororoororoororrorororouguguguggugggugugguggguggghhhhhh h hhh ththhhhthhhhe e eeeeee UnUnUnUnUnUnUnUnivivivivivviiverererererersisisisitytytytytyyyyy’s’s’s’s nn aaaatata ioionanan lllllly yy rrerererereerrrrrecococococooooocogngngngnnngngngnnnnng iziziizizzeeededddedededde UUUUUUndnddddndndddddndndnddddddddddeeeeerererereeeeeeee grgrgrgradadadadaa uauauuuauauauauaaaaaaauauauuauaaaauauattteteteteteeeteteteeeee R RRRRR RRReeseseseseseseseseeseseeese eeeeeaeaeaeaeeaeeeee rcrcrcrcrcrccrcrcrcrcrcrcrrrrcr h h hhhhhhhhh PrPrPrPPrPPrPrPrPrPPPPP ogooooogogogogogoogggooo rarrrararrararraraarrrararrrrarrrrrarrararrrarrrrarrrararamm.m.mmm.mmmmmm.m.m.m.mmmm.mmmmmmmmmmmm UU UUUUU NCNCNCNCNCNCNCCN A A AAAshsshshshshshs evevevevevevevvvililililillilllleleleleleleefofofounundedeed dd ththhhhhthhhhhhhheeeeeeee eee e NaNaNNaNaNaNaNaNaNaNaNNaNaatititittitititittiiitiononononononononnononnalalalalalalaaaa C C C Coooouuuuuuuooouuuoo ncncncncncnncncncililil f f fororor U UUUndddddnddndddddererrrrreerrrrgrgrggrgrgrgggggg adadadadaddaadadadaadadaddaduauauaauauaauauaauau teteteteeeteeeeetettetetett RR RRRRRRRR RRR RRRR RRR RR RRRRRRRRRResesesesesesessessesssesseesseeesesesesseseesssessse eeaeeaeaeaeaeaeeaeaeeaeaeeaeeeaeaeae rcrcrcrcrcrrch hh h hhhh momomommomomomoomomommomoooomooooooomoorererererererererererererrereerererererere t thhhahahahahahhaaahahahahaaahahahahhahahahaahhaaaaahaannnnnn n nnnn nnnnnnnnnnn n 22225252525525255225252555252522255252555 y yyyyy y yyy yyyyy y yyyyyyyyy yy yyyyyyyyyyyyeaeaeaeaeaeaeaeaeaeaeaeeeaeaeaeeaeaaeee rsssssrsssssssssssssrsssssssssssssrss a a aaa aaa aa gogogogogggooogoogogogogogogoogoggogoggoggogggogogggogogoggogggggogggg .. . .... . ..

SSStStStStStStStSStSSStStSStStStttudududuuuuuuuuuu y y y yy yyyy AbAbAbroroaaaadaddda a aaaaaaaaaaaaaandnddndndndndndnddndndndndndnddnddddnd SS S S S SSSSSSSSS SSSStutttututututututututtututttttutt ddydydydydyddydyddddddy A A AAA A AAAAAwwaway:y:y: 1 1 7 7 7 pepepeeeeeeercrcrcrrcrceeeneneenenene tt tt fofofoff s sssssssstututututuuutuuuuuuuudedededddddddededededddddededddddddddddd ntntnntnnnnntntnttntnnnntnnnnnnnnntttn ss s ssssss s ss sssssssssss ttatatatatatttatatatattatatatataatatatatattatakkekekekkekekekekekekkkkekekkkekkke a aaaa aa a aaa aaa aaadvdvdvdvdvddddvdvddvvdddvdvvvvvvananananannnannnananannnnannnnnnnnnnnnnttataattatagegeeggeegeegegegeeegeeeeegeeeeeegeeeeee o oo o o o o o oooooffffffff f f lelelelelleleeleeararararararararrararaararrarraarnininninininiininingngngngngngngngngngnngngnn ooooo oooooo oooo ooooooo ooooppppppppppppppppppppppppppp ortutunin titiiesesess i iiinnnnnnnotototoootototototthehheheheheheheehhhhh r rrrrrrrr rrrrrrr ststsss atatesesesesesssesesese aaanndddddddddndddddddddddddd ccccccc cc c cccc ccouououoouououououooououuuoouoouoouuuuouounntntntntnttnntntntntntntntnnntririririrrrirrrrrrrrr esessesesss www wwhihilele e eenrnrroolollolllllleleeleddddd d d ddddd atatattattt U U U U NCNCNNNNCNCNCCCCNCNCCNC A AAAA AAAAAAAAAAAAAAAAAAAAAAAAAshshshshhhhhhhshhhhhhhhhhhhhhhevevevvvvvvvevvevvvvvvvvvvvvvvevvvvviilillllii lellllllelelelllllelell .. . .

StStStStStSttududududu enenenene ttttt t ttt AtAtAtAtAtAtAAtAttAAAthlhlhlhhlhlhhhletetttttteee eeeeeeeeee GrGGrGrGrGrGrGrGGGrGGrG adddduauauauauauaauattiiititt onononnoon R R RRatatatate:e:ee: U UUUNCNCCCC AAAAshshhshevevevvilililililillelleell ss ssssssstuttuudededdennnnnntnntntnntntnnnnntnn -a---a-a-aththhleleeleteetetetet sss s ss ssss hahahahaahahahahahahaaahhaahahahavevevevvevevvveveve oooo oonnenenneneee o oo ooooooooooooooooff fffff ff ffffffffffffff thtttththththththththththttheeeee e hihhihihihihhihhhii hghhghghhghgheseseeeestt grr daduauaaatititionononnrarar tetess s s inininininninn t t t t tthheheeeeehe NNNNN N NNNNNCCCACAACAACAACAACAA.AA.A.AA.AAA. O OOOOOOOOOururururururururruurrururru s s ss s stututututttutudddeeeeeeeededeeedededeeeeedeennnnnnttttntnntnnnnntnntnnt aaa-a-athththththtththhthleleleleleleeletetetetetetetesssss s onononononon aaaa a aaththhtthhththllleleleelll tititit c scsssssscssssssssssssschohooooooooolallalalaalalalaaaaalalalal rsrsrsrsrssrsrsrsrsrsrsrssshihhihhihihihihihihhihihihhhihihiihihhihhihippspspspspspspspspspspspsspspspsppspspspspspspspsppsp w w wwwwwwwwww wwww ww ww wwhhhhohhohohhohohohohohhhho ppllalall y y lala l l fof urur y yyeaearsrsrsrssrsrss aaaaaa aat tttt tt UUNUNUNUNCCCCAAsAsAsAAAAAAAsAAsheheehheheheh viviiiviiivivivilllllllllllll e e e e ee hhhahahahahaveeeve aaa aaaaa 9999 9 999999999 99 pepepepepepepercrcrcrcrcrccenenenenenennntttttt t t grgrgrgrgrgradadadadadddaduuauauauauaatitititititit ononnoo rrratattatte.e..ee

FaFFaFacucucucucucultlttltlty:y:yy:y:yy: 222 2 222 211111111111 fff ff fulululuu l-l-l-l titititimemememee p prororooofefefesssssssorororororororoo s,s,sss,ssss 8 888885%5%5%5%5%%5%% ww w w ww wwwitititititititth h hhhhhh tetettettermrmrrrmrmmrminnnininnalalalalllaaal ddddddd d ddegegegegegegeggeggrerererererereeerr esesesesesesesesessessssess

COCCOCCCOCOPLPLPLPLACACACCAC::: UNNUNUNUNCCCCC AAsAAsAAsAsAsheheheheehevivivivillllllllleee e iiiiisisississ ttttttt t thhhhhehehhhhheeh nnnn newewewewew hhhhhhhhh heaeaeaeaeaddddqddqdqdquaauauaartrtrtttttrterereererersssss ffffofffofofoforrrrr thththththee ee CoCCCoCCoCoCoCoCoCoununununun iiicicicicicilllllll offofofofof PPPP P P bubbbbbububububu lilillililililiccccc c LiLLLLiLiLLLiLiLiLiLibbbbbebebbebbbeberararalllll AArAAAAAAAAArArArArtttststststs CCCCCCC C llollolololllleleeegegeges, a2525-member r ororgaganinizazatitionon of ff sts atte-e susupppporortetedd lililibebeberaral l artsts c c lolllelegeges s thaatat rrrecececooognize theh impmporortance offff lilibeberarall arartsts aa dnd sssccicienee cecc s education for succeess s innn a complex gloobbaball societetety.y.

CaCaCaaaaaaaaaaaaaaaampmmmmmmmmmmm us LifeRRRRReReReReRRReRReRReRR sisisisiss dedededededeeeeedeeencnnnnnnnnn e Halls: AAbooutt one-third of ststududenentsts l livive e on campus, whileeeeeeeeeeeeeee aa a a a a a a a a a aa aaaa aaa aaaanononononononnonononononononoonononooonononnonon ththththththththththththhththhthththththththththhthherererrerrrrrrrr t t tttt ttt ttttttttttt thihihihihihihihihihihihiihiihihihiihihihhihihhh rdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrdrrdrdrdrdrddrdrddddddr lll l l l l lllivivivivivivivvvivivvvivvvvvvve withthinin a a one-milleerararrrarararaaaddididiididd usususususususus o oo o oo o oofffffff ffff f ff f cacccccccc mpmpusus.

AtAtAtAtAtAtAtAttA hlhlhlhlhlhlhletetetetetetticicicicicci ss:s:s:s:s:s:s: 11 11111444444 444 4 44444 NNNNNCNCNNNNNNNNNNNNN AAAA DDivvision 1 1 tetetetettettetetttttteet amamamamamamammammmamammmmmmmmms s ssssssssss

StStStSStStStStStSSStStStSStudududdudududuuududuuudenenenenneneneeenenent t ttt tttttt GrGrGrGrGrGGrGrGrGrGGrououououououououououo pspspspspspspspspsps:::: :: :: MoMoMoMoMoMoMMMoMMMMMMoooooooooMM rereeee t hah n 606006006006000600060006000000 c c cccccc c c c cccccccccccc clululululululululululuulullululululllulululululuuuubsbsbsbsbsbsbsbsbsbsbbsbssbsbbsbssbbsbbsbbs aandnd o ooorgrrrrrr annizizatatioonsns, raaaaaaaaaaaaaaaaaangngngngngnngngngngngngngngnggngnggngngngngnngnggininininininininininninininninnininnnninnnnnng ggg g gg g g g gg gggggggggggg frfrfrfrfrfrfrfrfrfrfrfrfrfrfrrfrfrfrrfrfrrromomomomomomomomomomomomomomomomomomomoomomomoomomoomomoommomoom h h h h hhh hhhhh hhhhhhhhhhhhhhhhonoooononononononononononononononoonoonoonoonnooonnnnnnoooroooorooooorooorororoorororooroooor s s s s s sococococoocieieieieietitititit esesesese ttttttttttto o ooo oooooo iniinininnnninnnntttttrttrtrtrtrtrtrtrttrttrrttrtt amamamamamamamaaamamaamaaaaaa uurururuuurururururuurrrrrruuuuu alaalalalalalalalalaaalalalalaaalaallaspspspsppspspspspspspororororororororororrtstststsstststststststststs

InInInInInInnIInnnInInIIntettttettetetetetetercrcrcrcrcrcrcuullulullullulululu ttttuttuttuturaaaaaararall l CeCCeCeCCeC ntntnttttttttttttterererererererererererererererrerre :: : : :: :::::: :: :: ThThThThThThThThThThThThThTTT e e eeee ee eeeee neneneeeeneennnneewwwwwwww wwwww InInInInInInntercultural Center houses coomfffffmfffffforororororororororooorortatatatatatatatatattatablblblblblblbblblbbblblbb eeeeeee ee spspspspspspsspspspsppacacacacacaa esesesese ffffoororrrrrrrrrrr m m m m m m m m m mmeeeeeeeeeeeeeeeeeeeeeeeetitititititittitittitingngngngngngngngngngngngs,s,s,s,sss s sss sssssssssssssssssssssococococococooocococococoocococooooocooocoococoococoococoocociaiaiaiaiaiaiaiaiaiaiaaaiaaiaiaiaiaiaaiaaaiaaaaiaiaai lllllllllllllllllllllllevevevvvvvvenennne tstsss a aaaaaaaandnndndndndnnd pp p p ppppppppppprorororororooogggrgrgrggggggggg amamamamamamammamamamamamamammms sssssssssssss inininnininiinininininninnninnvovovovovovovovovovovovovov lvlvlvlvvlvlvlvvlvlvlvlvlvininininninini g gggggggggg sussusuususssuchchchchccch dddddddivivivvviviviverererererererersesesesesesesesesse gg g gggg g g gggroroorororooorororor upupupupupuupuupuupupupuppsss ssssss ss s asasasasasasasasasasaassass AA AAAAAAAAAAAAAllllllllllllllllllllllliaiaiaaiaiaiiaaiaiaiancnncncncncncnncnccnncncnnnccce,e,e,e,e,e,e,e,e,e,eee, B B B B B B B B B Blaack Studddededdedededentntntntnnnnttttssss sss ss AsAsAsAAsAssAsssssssosososososososososoosocicicicicicicccc atatatatatioioioiioionn,n,n,n,n,n,n,nn, IIIIII III IIntntntntntntntntntnnn eeereererrrrrrrrrrreeerrrerrnanananananananananaanananannaanananaaanananananan ----------------------iiiitititititititittiititttitiionooononoonnnonoonnoonononnaaaalalallllalalalalal SS SSSSSSSSSS SStttututututuuttuudeeddddededdedededeenntntnnnttt AA A A AAAssssssssssss ococococcococococoocococococococcciaiaiaiaiaiaiaiaiaiaiaiaaiaiaiaatitititititititttititittittitionononoononononononononononononononon, ,,,,,, ,AsAsAsAsAsAsAsAAAAsAsAAAsAsAsA iaiaiaaiaiaiaiaiaiaiaiaiann nnnnnnnn nnnnnnn StStStStStSStSttS uudu entsss iin n n nnAsAsAsAsAshehehehehehehevivivivivivivilllllllllllllee,ee,e,eeeeeee HHHererererere mmmaaaammananananas ss s ssss OrOOOrOOOOrOOOOO guguggguuuuuuguulllllllllllllllllllllllllllosososososososososososososoososo osososososososososososo e ee ee e e eennnnnnnnnn LaLaaLaaLaLaaLaLaLaas sssAmA errrriiiciciiicicicicasasasasasasasasasasas ( (( ((((((((( (HOHOHHOHOHOHOHOHHHH LLLLALALALALALALALALALALALALALLALLLALAALALALALAALALALLAAALALALLA)))))))))))))))))))))))))))))))))))))

aannnnnnaaanna d ddd d d dd HHHiiiHH llllllllleleleleleeeeele . . . .

CCCCeCeCeCCeCeCeCeeC ntntnteeerrrereeee ffffororororr JJJJ ewewewewewewewewisisisisssssssisisi hh hh StStStStStStStStStStStStStSttS ududududududududududududududududieieieieieieieieieieieieieieieieees:s:s:s:ss:s:s:s:sss:s:s:s:s TT T T TT T T TT TTT TTTThehehehehehehehehehehehehehehehehee 2 2 222222222222266-6-6-6----666-6666666 yyeyeyyeyeeeeaarararararararar o o ooooooooooldldddddddddddd U U U U U U U U UUU UU UUUUUUUUNCNCNCNCNCNCNCCNCNCNCCNCCNCNNNNCNNNNN A A A A A AAAAAAAAAAsshsshshshshshsssshs evevevevvveveve ilililllelelelelee C C CCCCCCCCCCCCCCCeeneneenenennnnennneeenenentttttttteteeteeteteteteteter r rr r r r rrrrrrr ffffofofofofofofofofoffoffofofoff r rrrrrrrrrr r JeJJJJeJeeJeJeeeeeeeeeJeeeewiwwwiwwiwiwwwiiwiiwwwwww shhshshshshshshhsshsh S SSS tututututuudidididd eeesesesesseseseeeesssessesss p p p ppp p ppp pp pprrrrrorororrrrrrror vivividededeessss s sssssss aaaaaa a aaaaaaaaaa rereeeeeerere----------sosososososssssososoosososoururururururururururcecececececececcece f ff fffffffffffforororororororororor J J JJ JJ J JJJJeweweweweweweweweewwissisisisisisisi h hh h hhhh stststststststststststststs ududududdududududududdududududenenenenneneneenenentstststtstststsststs a aaaaaa aaaaas s sss ssssss wewewewewewewewewewewewelllllllllllllllllllllll a a aa aa aa aaaasssssssss sss hhhhohooststininnng g gg lelelectttururururesesesesesesssessessese ,,,, , fifi fi fifififififififififififififillmlmlmlmmllmmlmlm sssssssss ssssss sereerererererererrererererereeereerereeererrieieieieiieieieieieieeieieieieieieieeiei sss ss s sss s sssssssss ananananananananananananannaanaannndd dd d d dddddddddd otootototototototootototottoo hehhhhhehhhh rrr r rr r spssppppececececiiiaaaaaaaaaaaaial l l ll ll eveveveveveevevevvevvevevvvvvevvvvevvenenenentstststs f fff ororooorororrrrror tttthheheheheheheheheheeheheheeheheeheheheheeeheheeheeeAsAsAsAsAAsAAAAshehehhh viviv lllllle e cococommmmmmunununuu itittitititity.y.y.y.y.y.

KKuKuKuKKKKuKKuKuKuKKKuKuKKuKuKuKKKuKuKuKuKuKKKuKuKKuKKuKuKuuKudodododododododododododododododdodododdddoododdddododododossssssssssssssUUNUNUNUNUNUNUNUNUUNUUUNUNUUNNUNNNNUNUUU C CC CCCCCCCCCCCC AsAsAsAAAAAsAsAsAssAsAssAsAAssssheheheheheheheeeheheeeeeeeeeeevivivivivivivivivivivivivvivivivvvvvv lllllllllllllllllllll ee e e eeeeeeeeeeee isisisisisisisisiisisiis ““ “ “ononononononononononononononnononnonoonoo e ee ee e e ee eeeeeeeeee ofoofoofofofofofofoofoofoofoffffoof ttt tt tttttttttthehehehehehehehhhhhheeeee b b bb bbbbbbbbbbeseseseseseseseseesesessesest t t tttttt ttttttt edededededededdededdeddddducucucuccucucucucucucuuucuuuu atatatatattatatatatatatatataa ioioioiooioioioioioiooiooioioiooooonanananaanannaananananannnaanaaaaal ll l llll bababababababaabababaababbaargrgrgrgrgrgrgrgrgrrgrgrggrgrgrgggggaaiaiaiaiaiaiaiaiaiaiaiaaaaaa nnsnsnsnsnsnsnssnnnn iiiiiiiinnnnn nnnnn nnnn thththtthhhhtththtththtthhthhe ee e ee e e eeeee e eee cococococococococooocococooooocococouununununununununuunuunuunuunununuuuntrtrtrtrtrtrtrtrttrrry.y.y.y.yyy.y.yyyy.y...” ”” ” ” ””””””””” -- -- - - FiFiFiFiFiFFiiiFiFiFiFiFiFiFiskskskskskkksksksksksksksksskkeeee ee eeee e e eeeeee GuGuGuGuGuGuGuuGuGuGuGuGuuuGuuGGGGGG ididididididdidiidddddddidddddddddee e ee eee eeee ee e eee ttttototototottttt CCCololollo leleeeleeeeeeegegegeggegeggeegegeggegegeeegeggggg s,s,s,sss, 2 2201010001000100 11111111

FoFoFFoFoFFoF r rr rr r sseseseseseseeseseeeseeseeseseseeeseevevevevevevvvvevvven nn nn n n cococococococococoooonnsnsnsnnsnsnsnsssnsnsnsnnnsnssnnsnnnn ececeecececeecececececececececececeececeeeecutututtututtuttttuttu ivivivivivivvivivivvvvvveee ee eee ee e eee yeyeyeyeyeyeyeyeyeyeyeeeeyeeeeyyeeyeyy aararararss,ss,, U UUU NCNCNCNCNCNC AA A AAA hshshshhss evevevvililillillelelele’ssssss EE E EEnvvnvnvnvirriririronoonononno memmemememm ntntntntnn alalalallal SSS S S Stututututtuudididididididiesseseseseses PPP PP Prorororororoooogrgrggrgrgrgrgrgrgrggggggg amamamamammmmm hhh hh hhassasasasaaa b b b bb beeeeeeeeeeeeeeeeeeeeeennnnnn nnnnn nananannanananaananamememememememmeddddd d totottotootototoo tttt t t t tthehhehehheeehehehe lilililililiistststststststtststststtsttsttt o ooooo ooooooooooo oof f fff fffffffff pprprpprprprprprrrre-e-e-e-e-e--e---e---ee prprprprprprprpprprprofofofofofoooooofoofofofofoooffofffofoofooooo eseseseseseseseseeeseeseeeseseseseseseesssesee sisisisissisisisisisissisisisiississss onononononononononononnonononononononoonnoonnonnonalalalaaalaalalalaa p p p pppp ppp pp pppproororoororogrgrgrgrgrgrgramamamamam wwww ww wwwiiiititttitiitttiitti hhhhhhhhhhhhh hhh h h unununuunu ususususuu uauauauauallllllllll ll ttttstssstststs rererererengngngngng hthhthhthhhthhthththtththhthth iiiiiiii ii innnnnn n prrprprprprp epepeepepeppparrararariiiiiiinininini gggg g tttststststs ddddddddddududududenenenenttttststststss ffffffffffff forororor ccc carararareeeeeeeersrrsrsr . . - FiFiFFiFiFiiFiFiFiiFiFiF kkkkkkkskskskkeeee GGGGGGGGGGGGGGGuGuGuGuGuididiidididddddddididididideeee etotototototttttottototo C C C CCCCCCC CC CCoololooololooololleleeleeleleeeeleeeeelegegegegegeegeegegegegeggggggggg sssssssssssssss

UNUNNUNUNNUNUNUNUNUNUNUNUNNUU C CCCCCCCCCCCCCCCCC AsAAsAsAAAsAsAAssAssAssAsAsAAAAssAssAsAAAAshehehehheheeheheehehhehhhehheeeeh vivivvvvivivivivivvvvvivivvvivvviviviiillllllllllllllllllllllllle eeeeee e iiisiisisiisisisisisisisisisssssss o o oo ooooooooooooooooooooneneneeeeeene o o oo oooofffff ffff thththe ee nannn titit onon’ss 1000000000 b besst t vavaavavavalullll eses in n pupublblicciccc ccolo leeleeegegeg s. -- - - -- - KiKiKiKiKiKiKiKKKKiplplplplplplppplpp ininnininniiniinnnnnnnnnnnngegegegeegeggegggggegegeggegggggggggg r’r’r’r’’’’’r’r’r sss s ssssssssss PePePPePePePePePePePePePPePPePePeePePeeePePP rrrrrrrsrsrsssssrrrrr ooooononnonoononnoo alalalallaalllaaaa FFF F F FFFFFiiinnnnninnnnanannnnnnnnnnana cececececececececeececeeee MMMMMMM MMMM M MMMM MMMagagagagagagagagggagaagaagagggazazaaazazazazazazazazazazzzza inininininininininininiinininii e,e,e,e,e,e,e,ee,eeee,e, 222 22 2 22222 222222220101010100101001000101010101010 0000000000000000000000

UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUNNNNNCNNCCNCNNNCNNNNCNCNNCCCCNCNNCNN A AAAAA AAA A AAAAAAAAAshshshshshshshshshhhhhshshsshsheeevevevevvvvveeveeevvilililiililiiilililiiiililiiiiillllii lelleleleleleeeeeleleeee iiii i iiii sssss sss s s ss s ssssss aaamamamamamammamammaa ononoonoononnnnnnnonnno g g jujujujujuujujuststststsststst 5 5555555555550 0 00000000000 inininnnininininststsststststtstsststststs itititititititutututuuuuuutuuutututioioioioioiioonsnsnsnsnnssnsnsns nnnnn n natattttatatatattataatatttioioioioioioooioooiooonwnwwwnwnwnnwnwwwnwwnwwwidididddiddididde ee eeeeee nonoteted d d asasa a a “ “BeBeBeststst V V Vala ueuee” ” ” pupup blblicic c cololleleleeeeeeeleleeeeeeegegegegegegegegegegegegeegegegege. . .. ..- --- -- - PPrPrPrPrPrPrPP inininnnnnninnnninnnnnnnnnceccecececececcccetototootoooon nnnnnn ReeReReReReReRReReReReReReReReReReRReeRRReReRReeeviiiivivivivivviiviv ewewewewewewewwwewwwwwwewwewwww,, , , 20202020202020200202020002020202022020202202222020011111000001

NUNNUNNNNC CCCCCC AsAshehevvvvvviviviviiivivvivvvvvvviv llllllleeeeee e eee isis t thehe ooooooooooooooonlnlnlnlnnnnnnnnlnlnnnlnlyyyy yy yyyyyyyy NoNoNoNNNooNorrtrtrthh h CaCaarorooolilinanaaaaaa i iinsnnsnn tititututitioonoo listeeeeed d d amamonong g NaNaN titiononnnalal L Libibereralala A AArtrts s CoCoC llllllllllllegegegegegegegesesesesesesses whwhosose e ststududddddddddddddddddenenenenenttttststtttttttttt g graraduduatate eeeeeeee wiwiw thththh tt hehheehe llllllllleaeastst aaamomooununnnt t fffofof ddddd d d bebbbbbbebebebe t.tttttttttt. - - UUUUUUUUUUUUU UU UU SSSSSSSSSS.S.SSSSSS. . NeNeNeNeNeNeNNeNeNeeeNeNeNeNeNewswswswswswswwswwswswswwsws &&&&&&&&& &&&& & && WWWWWWWWWWWWW W W WW Worororoorororooororoorooorldlddldldd RRRRR R RR RR RRRRRRepepepeepepeeepepepepeepeeppport’s s “AAmem rir caca’s’s BeBeBeBBBestst C Colleegegegegeggegegeegeeeegegggegegeeees,s,ssss,s,ss ”””” ”””””””””””” 20220202020202020220202022022000020202020202022202010101010011010101010000000101010000

ThThe e UNUNCC AsAsheheheeheehevivvivivivivivivivvvvviv lllllllllllllllllllllll eeeeeeeeeeeeeeee eeee “f“f“ff“ffffffffffffffacacacacacaaaacacaacacacacacaaacculllululuulluuuluuuluuluululultytytytytyttytytyytytyttyt hhhhhhhhhhhhhhhhhh hhhasasasasasasaaasasasasasaasaaasss a a aaaaaaa aaaannnnnnnnn n nnn unuuununununununununuunununununu ususuuuususususuusususususususssussuauauauauauuauauuaauauauauauuauuuau llllllllllllllllllllllllllyyyyyyyyyyyyyyyyy y stststtsttttstststsststttttrororrorororoorororoorororoorororongngngngngnngngngngngngngggnggg c c ccccccomomomomomomomommmmmimimmimmimim tmtmtmtmtmtmttmmeneneneenent t t ttt tototototototottt u uu uuuuuuuuuuuundndnnndndnndnndddddderererereeeeee grggrgrgg adadadaadaduauaauaauaaatetetetetetetetttte t ttt tt t ttteaeaeaeaeaeaeae hhhchchchhhhhchhchhhchhhchhhc iniinininininniiinininggggg.ggg.gg.g.gg” ”” ” ”””””””””””” - - - U.U.UUUUUUUUU S.S.SSS NeNews & & W Worldd R Repeeporort’t’s s “A“Amemeriricaca’s’s B Besest t CoCollllegegeses,”,” 2 20100100

UNNC C AsAshevillee is the onlly y pup blic liberall arts colleggee nonotted asa aa ““ToTop p UpUp-aandnd-C-Comomining g ScSchohoolol” ” amamonong g NaNaN tional Libeeral AArtrts Collllegges. UNNC Asheville is rrannkeed d fi fth h inin t thhis distinguisishehed d cac tegog ry. - UU.SS. NeN ws & Wororldd R Reporrt’t s “AAmeriricac ’s Best Colleges,”, 2201100

UUNC Ashevillle’s UnUndergrgradduate Reseearch Program haas bbeeeen ranknkeded aamom ng theh bbesest t inin tthehe n natatioion n fof r rnnine conseccutivee y yeaearrs. - - U.U S.S. N Newews & WoW rld Report’ss “AmAmerica’s Best Colleges,”” 200100

UUNC AsAsAsAsAsssshheheheheheeevivivivivivvilllllllllllleee eee isisisisisss aaaa a amoomomomomonngngngngngggg jj j j jjjjjusususuuuu t tt 212121 s s smamamallllll ss stattatatatetetete ss sschchchchchoooooooooooolslslslsls o ooonnnn nnnnn ththhhhhthththeee ee “““C“CCCoolo lllelegegegg AAA AAAA-LLisist”t”t” forrrrr offfffferrrriinining ggggg a aaa “a bbbbigigigigigg-leaguee eeducatioion.n.nn.n.nn””””””-- PaParararararararararaarr dedededeedededeedede m m m mm m mmmagagagggazzzzazazzazazazazazininininninininine,e,e,e,, 222 2 20101010 00000000

UNUNUNUNUNUNUNUNUNNUNNUNNCCCCC C CCCCC C AsAsAsAsAsAsAAsAsAsA hehehehehhhehehhhhhh vivivivvivivvivillllllllllllllle eeeeeeee isisisisisisisis o oooooo o o o oonenenenenenenennenneeenen oo oooooooff ff fff ththththththththththht ee e e eeee totototototopppp p p ppppp grgrgrrrrrrrggrreeeeeeeeeeeee nnn n nnn cococcooccc lllllllegegegegeeeeegegegegesesesesesesessse ii iiii i i innnnnn nn nn thhhhtht e eee SoSoSoSSooooooSoS ututututututututututhhhheeehehhhehhh aasaast.t.tt.t.ttt. -- -- Blueeee eeeeee RiRiRiRiRiRiRRiRiR dgdgdggdgdgdgdgdgdge OOuuuuuuuttdtdtdtddoooooooooooorsrsrsrsrsrsrsr ,, , , , , 20202002222 100000

UNUNUNUNUNUNUUNUNUNUUUNUNNCCCC CCCC C CC C AsAsAsAsAsAAsAsAAsAsAsAAAAshehehehheheheheeheheheheheheeeeevivivivivivivivivivivivivivvvv llllllllllllllllll e is lissteted d aammononnooononononononnnngggggggggg ggg jjjujujujujujustst 228686 UU.S.S. . cococococococoooccooollllllllleeeegegegeggegee eseseseseeeeseseseses a aaaaa aaaaa ddndndndnn uu uu inininininivevevevevvvvevv rsrsrsrssrsititititittieieieieieessss s thththhthtttt atatatatatt hhh hhavavavavavvaa eeeee eee dededededeedd momomomomoonsnsnsnsnsssn trtrtrtrtrrrratatatatatataatatttedededededededeeededeeee “ ““ “ anananaananaanananaa exexexexxxxxxxemememeeeeeeeemplplplplplplplplpllpplpppp aaarrrrararrararararraraaaaaa yyyyyyy yyyyyyyy cococococommmmmmmmmmmiiititititititititmememmemeememmeeemm ttntntntntnntntntntnnt ttt ttt tt ttoo ooooooo suuuusuusuusus stststst iiiiiaiiiaiaiaiinanaaaaanaannabibibbibibibbibibibbbibiib lililililillililililiillittytytytytyytytytytyt ”””””””.””.””. - - ---- “““ “ ““““ThThThThThThTThThThThTThhThThTT ee ee ee eeeee PrPrPrPrPrPrPrPrPrPrPrPPrPPP iniinninnnncecccetttooooonn n ReReeeReee iviviiivivivvv eewewewewewewwwewee ’’’sssss GGGGG GGG G GGGuiuiuiuiuiuiuiuiuiuuuiuuuuidededededededddedededdededde tt tttt t t oo oo ooo 2828228288282828282822822822 6 666 66 6 6666 GrGrGGGGrGrGrrGreeeee nnnn nn n CoCoCoCoCoCoooCoCCooooooollllllllllllllllllllllllllllegegegegegegggeseseseseeses””,,, 20202020200000202010101010010001000000010101001010100101010

AdAdAdAdAdAdAdAdAAAdAddmmimimimiimmmmimmiim ssssssssssssssssssssssssssssiioioooioooioioooioiooioi nsnsnsnsnsnsnsnnsnsnsnsnsnsnsssMiMiMiMiMiMiMiMiMiMiMMMiiddddddddddddddddddddddddddddd leleleelelleleleleeeeeeee 55555 55555555 555 550%0%0%0%0%0%%00%0%0%%0%0%0%0%0%0%%%%0%0%00%00%00000%0 o o ooooo ooooooooofffffffffffffff fffffffff ininininininiinnnninnnnnnnnncccococococococccccccococococcococcoocccccccccc mimimmimimiimimimmmimiiinnngnngngngngngggnnngnngnnnngnnggnggggg fff f fffff ffffrrereereererererererrererrererereererrrrr shshhshsshsssssshshhshhhshhhshsssss mmememememememememmememennnnnnnnnnnnnnn nnn n SASASASAASAASASASASASASASASASASAAASASASASASASASAAASSAAAATTTT TTTTTTTTTTTTTT TTTTTT TTTTTTT sssscscccscscss orororororrrrrrorrrrrorrrrrrrrrrrooree:e:ee:ee:ee:e:e:e:e:eeeee 1 1 111 111111111111111111111110-0-000-0-0-0-0-000-000-0-0-0-0-0-0-00000 12111222122222211112212121212212211212909090909090900090900909000909090990090909999999090000

AnAAAAAAAnAAnAAAnAnAnAnAnAAAAA nnnnnunuuunuunuuuuuuuuuaaalalalalaaaaaaaaaa II IIIIIIIn-n-n-nnn-nn-nnnnn StStStStStStStStttStttS atatatattatte eeeeee eee eeeeeee ee TuTTuTuTTuTuTuTuTuTuTTTuTuTuuitittititiii iioioioionnnnnn n nnn anannaaaaanaaaaaaaaa dddddddddddddd dddd FeFeFeFFeFFeFFeFeFeFeFeFeFeFeFeeeeseeeseseseseseseseeeseseeeese :::: : $4$4$4$44$ ,7,77,7,777777,777777777777772722772727272777277272727777727777 (((((( ( ((((((( (((((202020202020202020202020202222222 10101010101010100100000100100--1111-1-1-1-1-1-1-1-- 1)1)1)1)11))))11)1)1))

AnAnAnnnAAnnnnnnAnnnnnnuununuununununnnunnuunn aala OOOOOOOOOOOOuuututututututuuutut-o-of-f-f-f-StStStSttStS atatttttatattttttteeeeeee e eee TuTuTTuTuTuuTuuTTuuTTuTuTTuuTuTTTuTTuuTTuTuuuT ititttiittititioioiooioioioion n n aaanaananananaaaaannnnnd d FeFeeeesesesesssesessseses:::::::: $1$1$1$$1$1$1$1$$1$1$$$$$$1$$$1$$$$$$1$1$1$1$$ 7777777777,7777777777,7,554545454455454545545455545454545455545544555554444454445554545444444444444 4444 4 444444444444 (((2(2(2(2(2(2(2(2(2001010111000-0-0-0-0-000-000-0000 111111111111))))))))))))) ))) )

AvAAAAAvererererererraaggggagagagagaaaagagagggee e eeee e HHoHoHoHooousususuuuuu inininnnnnininnnnnnnnnnnnnnnnnnnnnnnngggg ggggggggg anand ddd MeMeMeeMeeaalalalalalala PPPPPPPPPPPPPPPP PPPP alllaaaaaaaaaaaaaalalaaaaalannnnnnn nn n FeFeFeFeFeFeFeFeFeFeFeFeeFeFeFFFeFeeeseseseseeeeeeee : : $7$7$7$7$7777777 00000000,0,04044040404040400440404040 (((( (((((((((( ((((2222020202022222 11010101 ---1111- 1)11)))1)1)1)1))))111

FiFiFFFFFFFiFFiFiFFFiFiFiFinananananannanananannannncncncnccccccccccccnccciiiaiiiiiiiiaiall l AAiAiAiAiAiAiiAAiAAid:d:d:d:d:d:d:dd:ddd:d:dd MMMMMMM MMMMororee ththanan h hallllllllllla ffffffff f ofofofofofofofofoffo ss sss s sstutuuuttt dddddedededdeedd ntntntntttts s ss sss rerererererereeeeeeerer cccceceeeeeceeececceeeeecec iviviivivivvvvvvvivvivivvviviivi eee eee eeeeeeeee fi fi fifi fi fi fifififififififififififi fi nnnnnanananann ncnciaial l aiaiiid,dd,d,d w w wwwwitiitititittittthhhhhhh hhhh hh h momomomomoomorerererererereeee t tthahahhahhhahahahahahahhhahh nn n 8555585858555 pp ppppppereerererereeee ccccececececccecececececeeentntntntntntntntntnnn ooo ooooffff fff stststttstudududududududududududududududdddudeneneneneeneneneeeneneneneneennnttttststststttststts’ ’’ fi fifi nannn ncnccccccccciaaiaiaiaiaiai l ll neneeeneneneenenenen edededededededddded m m mmmmmmmmmmmmmmmmeteteteteet..

Dr. Anne Ponder became the sixth Chancellor of the University of North Caro-lina Asheville in October 2005.

Chancellor Ponder is a native of Asheville and a lifelong educator. She earned her bachelor’s, master’s and doctoral degrees in English from the University of North Carolina-Chapel Hill. She began her academic career at Elon College (now Elon University) in North Carolina, where she was the fi rst woman and fi rst pre-tenure professor to receive the Daniels-Danieley Award for Excellence in Teaching. During her nine years at Elon, she taught English and communications, and founded the college’s Honors Program.

She later joined Guilford College in North Carolina, where she was an associate professor of English and interdisciplinary studies and served as associate academic dean. At Kenyon College in Ohio, she served as professor of English and drama, academic dean, adding ‘vice president for information technology’ to her portfolio.

In 1995, she was selected to become president at Colby-Sawyer College, a private liberal arts college in New London, N.H., where she would serve for ten years.

At UNC Asheville, Chancellor Ponder has led a campuswide collaboration resulting in a fi ve-year Strategic Plan and then imple-mented an administrative reorganization that focuses University resources on the Strategic Plan’s highest priorities. As part of that strategy, the UNC Asheville campus now serves as the new na-tional headquarters for the Council of Public Liberal Arts Col-leges.

Chancellor Ponder is a nationally known expert on institu-tional effectiveness, strategic planning, and fundraising and re-source development. She has been a frequent faculty member of Harvard University’s Institutes for Higher Education, and has writ-ten a chapter on strategic planning for the book “Leading Ameri-ca’s Branch Campuses,” edited by Samuel Schuman and published by the American Council on Education.

In addition to serving the University, Chancellor Ponder is a member of the Mission Hospitals Audit Committee, and the Unit-ed Way of Asheville and Buncombe County Board of Directors. She also serves as a member of the Asheville Community and Economic Development Alliance.

Chancellor Ponder is the daughter of Eleanor Ponder, and the late Herschel Ponder, both of whom trace their Asheville family roots back to the 1780’s. She is married to Christopher Brook-house, an award-winning writer and publisher previously on the English faculty at UNC Chapel Hill.

Dr. Anne PonderChancellor

University of North Carolina Asheville

Janet R. Cone is in her seventh year as Director of Athletics at UNC Asheville. Since arriving in 2004, she has led the Department of Athletics through a fi ve-year strategic plan that has resulted in improvements in the student-athlete experience, resources for coaches and staff, facilities, competition levels and increased community support.

Last year, Chancellor Anne Ponder appointed Cone to the newly-created position of Senior Administrator for University Enterprises. In this position, Cone will oversee the North Carolina Center for Health and Wellness, manage specifi c community relationships and serve as a member of UNC Asheville’s fundraising team. She will continue as a member of the Chancellor’s Senior Staff and assist Chancellor Ponder in more closely aligning the university with the North Carolina Center for Creative Retirement.

Student-Athletes have excelled in the classroom under Cone’s leadership. In 2004, she created the Athletic Director’s 3.0 + Club that recognizes all student-athletes who make a 3.0 or better grade point average each semester. More than 600 student-athletes have made the club during Cone’s six years, and in 2009-10, a record number of student-athletes earned that distinction.

During that same time period, more than 500 student-athletes have been named to the Big South Presidential Honor Roll, and in 2009-10 more than 60 percent of UNC Asheville’s student-athletes have earned this impressive academic distinction. The Department of Athletics has also successfully hosted two Big South Conference Tournaments that produced revenue for the school.

Cone has overseen construction projects that will dramatically improve the facilities in which UNC Asheville’s Bulldog student-athletes compete and train. (1) The North Carolina Center for Health and Wellness/Kimmel Arena is presently under construction. Funded partly through a $35 million state appropriation, Cone helped raise more than seven million dollars in private funds to construct the Kimmel Arena, a major convocation space that will accommodate larger group events than the campus has been able to host before. Among other things, this will allow the university to host its own graduation on campus, attract major venue speakers and performances, and will secure a future home for men’s and women’s basketball teams. (2) Renovation and repairs to the Karl Straus Track began in the spring of 2009. Cone helped raised more than one million dollars in private funding for the track project. (3) Cone negotiated a partnership with the Crowne Plaza Hotel and Resort for construction of a new Bulldog tennis facility which has indoor courts, composition courts and six hard courts that each Bulldog team has played in the last two seasons.

She has also been a leader in the Asheville community. Last year, Cone helped create the Asheville Sports Commission which helps bring athletic events to Buncombe County. She worked closely with the commission to help bring the Southern Conference Men’s and Women’s Basketball Tournament back to Asheville starting in March of 2012 with some of the games being played at Kimmel Arena.

The 2007-08 year was another outstanding year for Cone and the Department of Athletics. The men’s basketball team was co-regular season champions of the Big South Conference and earned a bid to the National Invitational Tournament, making UNC Asheville the fi rst men’s basketball team in Big South history to receive a bid to the NIT. Cone helped the department successfully host the Big South Conference Men’s Basketball Tournament and Women’s Basketball Tournament in back-to-back weekends. In October of 2007, Cone was named the 2007 Division I-AAA Administrator of the Year by the National Association of Collegiate Women Athletic Administrators. UNC Asheville Chancellor Anne Ponder was delighted to see Cone receive the award. “Janet Cone’s inspirational leadership has set a very high standard for our student-athletes and our coaches, all of whom continue to be winners both on and off the fi eld,” stated Ponder. “We are thrilled that she is being recognized in this way for her vision, her energy, and her tenacity, qualities our University benefi ts from each and every day.”

Janet R. ConeDirector of AthleticsSenior Administrator for University Enterprises

In 2006-07, UNC Asheville three different teams UNC Asheville teams won Big South Conference championships and advance to the NCAA Tournament. In May of 2006, the UNC Asheville baseball team completed an amazing run with their fi rst ever championship and a trip to Clemson for the NCAA Regional. In the fall of 2006, the women’s soccer team became the fi rst women’s team in school history to qualify for the NCAA Tournament when the Bulldogs won the league title and earned a spot against top-seed UNC Chapel Hill in the College Cup. In March of 2007, the UNC Asheville women’s basketball team won its fi rst ever Big South Conference championship Asheville advanced to the NCAA Tournament for the fi rst time where it took on Final Four-bound LSU.

The South Carolina native has promulgated a signifi cant increase in corporate sponsorships and Bulldog Athletic Association donations, critical to an organization that is not allowed to receive state funds of any kind. She has also overseen a new partnership with the Asheville City and Buncombe County Parks and Recreation Departments, an improved Athletics web-site, and the implementation of internet broadcasts and video-streaming for six different sports.

In September of 2008, she began a four-year term on the NCAA Division I Leadership Council. In July of 2006, the Summerville, S.C. native was one of just 14 female athletic administrators to be picked by the NCAA/NACWAA to attend The Institute of Athletics Executives in Denver.

Cone is extremely active in the community. In the spring of 2006, she was named as an Outstanding Executive Manager by the Asheville-Buncombe Excellence in Public Service. In the summer of the 2006, she helped lead a group of community leaders to bring the Big South Conference Women’s Basketball Tournament to UNC Asheville’s Justice Center in 2007 and 2008. Cone also initiated the “Our Turn to Play” women’s luncheon for local business, civic, and community leaders the past two years. Cone was recognized as one of “10 Women to know in Western North Carolina.” In March of 2009, she earned a YWCA Twin Award for her leadership skills. Cone was tapped to be a member of the Clear Channel Local Advisory Committee. She also was the task force leader for the formation of the new Asheville Sports Commission.

Cone was born and raised in Summerville, South Carolina. She was a four-year letterwinner on the basketball team and was an all-conference performer at Summerville HS for two years. Cone is a member of that schools’ Athletics Hall of Fame. She graduated magna cum laude from Furman University in 1978 and was named Physical Education Student of the Year while lettering in basketball and fi eld hockey as an undergraduate. While earning her Masters from the University of South Carolina in 1986, she completed her studies with a perfect 4.0 grade point average.

Cone came to Asheville from Samford University where she served as the fi rst head women’s basketball coach in 1996. She coached the Bulldogs for fi ve seasons and, in 1999-2000, the team posted a 19-10 record. Cone was named Assistant Athletics Director before being promoted to Associate Athletics Director in 2003. Prior to Samford, Cone served as the fi rst full time Assistant Athletics Director, and the head women’s basketball and volleyball coaches at Saint Leo University in Florida. She also directed programs at Western Carolina University and Mars Hill College. Cone fi rst began her career as a teacher and coach in Gilbert, South Carolina. She coached against UNC Asheville eight times in her career and had a 5-3 record against the Bulldogs.

A life-long learner, Cone is a 2003 graduate of the NACWAA/HERS Institute of Administrative Advancement. She is a member of NACDA, NACWAA, NCAA Division I-AAA Athletics Directors Association, Women’s Sports Foundation, and the Fellowship of Christian Athletes.

Terri BrneAssociate Director of Athletics of Internal Affairs

Terri Brne is in her sixth year at UNC Asheville. She serves as Associate Athletics Director of Internal Affairs and is also the athletic department’s Director of Compliance and Sport Oversight. Brne came to UNC Asheville in the fall of 2006. She is responsible for the interpretation of rules by the NCAA and Big South Conference. Brne is the department’s liaison with Admissions, Financial Aid, Registrar and the Big South Conference. She educates UNC Asheville’s student-athletes and staff on all of the NCAA rules and regulations. In addition, Brne is the administrator for men’s and women’s soccer and baseball. She also serves as the Game Administrator for women’s basketball. The Illinois native was an assistant basketball coach at both South Dakota State and St. Andrews Presbyterian College. While at St. Andrews, she assisted in NCAA Compliance in NCAA Compliance. Brne earned a Bachelor of Science degree in physical education from Illinois State. She earned her Master’s degree at Tarleton State in Exercise and Sports Studies and is currently completing a doctorate in Sports Administration.

Mike GoreAssociate Director of Athletics for External Affairs

Mike Gore is in his 25th year of service to the UNC Asheville Athletics Department. He currently serves the school as an Associate Athletics Director for External Affairs. In his post, Gore is the liaison with the media, handling all media-related activities concerning the athletic department. He also assists with game management and sport oversight. In 2004, Gore served as the school’s Interim Athletics Director for six months prior to the hiring of Janet Cone. He is the chairman of the school’s Athletics Department Hall of Fame and the Big South Conference Hall of Fame committee. The Buffalo native has been a longtime contributor to the Asheville Citizen-Times , Hendersonville Times-News and has written for Blue Ribbon Basketball Magazine. For the past 20 years, Gore has been the offi cial scorer for the Class A Asheville Tourists baseball team. In 2005, Gore was honored with the fi rst ever Mike Gore Bulldog Service Award at UNC Asheville’s Athletics Banquet. Gore is a 1984 graduate of Appalachian State University with a bachelor’s degree in communications. His wife Lisa is an Assistant District Attorney for the 28th Judicial District.

UNC ASHEVILLE SUPPORT STAFF

Judith BohanBusiness Manager

Linda MarshallAssistant

Business Manager

Ken Hogue Director of

Development

Megan OcasioAssistant

Athletic Trainer, ATC

Harmon TurnerTicket Manager

Tim WhiteHead

Athletic Trainer, ATC

Omar AhmadAssistant Strength

& Conditioning

Josiah HagemannAssistant

Athletic Trainer, ATC

Dr. Herman HoltFaculty AthleticsRepresentative

Rebecca Nelms-KeilDirector of Student

Athlete Affairs

Erin Punter-SpenceDirector of Marketing

and Promotions

Matt PellegrinDirector of Athletics

Media Communications

UNC ASHEVILLE SUPPORT STAFF

Betsy BloseWomen’s Basketball

9th year as head coach

Michele DemkoWomen’s Soccer

1st year as head coach

Matt KernMen’s Soccer

1st year as head coach

Tom SmithBaseball

2nd year as head coach

Jesse NormanCross Country/Track

4th year as head coach

Lise GregoryTennis

4th year as head coach

Eddie BiedenbachMen’s Basketball

15th Year as head coach

UNC ASHEVILLE HEAD COACHES

Since UNC Asheville fi rst fi elded athletics teams in the 1930s (then known as Biltmore College), the bulldog has been its mascot. Early students chose the bulldog for its fi erce and tenacious reputation. In the decades that have followed, the bulldog has become a beloved symbol of our University.

In 1948, “Puck,” arrived on campus and began a tradition of live bulldog mascots that lasted into the 1980s. Puck, named after the character in Shakespeare’s A Midsummer Night’s Dream, was followed by Puck II and in the 1960s by Chug-a-lug. In the 1980s the campus welcomed Winston, named after British Prime Minister Winston Churchill, both for his bulldogged resolve as well as his appearance. Winston appeared for only a year and the tradition of a live mascot fell out of use. In 2009 thanks to a group of student organizers, UNC Asheville welcomed a new bulldog mascot to the University community. “Rocky I” made his fi rst public appearance at halftime of UNC Asheville’s homecoming basketball game on Feb. 21, 2009. Alumni couple, Alexis Johnson (’97) and Ed Johnson (’96), also a member of the math faculty, are his keepers.

The name “Rocky” was suggested by staff member Nancy Williams during a naming contest sponsored by the Athletics Department in 1995. Though the rumor has often been that the name came from Sylvester Stallone’s famous character, Rocky Balboa, which is based on the American prize fi ghter Rocky Marciano, the name was chosen because it means steadfast, much like the mountains that surround campus. Ironically, the name “Rocky,” which is of English origin, is a derivation of the name “Roch” (also Rocco and Roque) after St. Roch, the Patron Saint of Dogs.

In addition to the live bulldogs, the UNC Asheville mascot has also been depicted by an army of costumed students. Since the 1960s, students dressed as the bulldog have rallied the fans at thousands of games in support of Bulldog Athletics. The present incarnation of Rocky was introduced during the 2006-2007 season and is the fi rst to accurately refl ect the logo image of the bulldog used on signs and in print publications. That image, introduced during the 2004-05 season is the fi fth offi cial incarnation of the UNC Asheville bulldog logo.

In the late 1990s, the image of the bulldog, or “Rocky,” was immortalized in aluminum through a gift by the Class of 1998. Sculpted by Matt West (‘00) and modeled after a canine friend of the University, Pete “Bubba” McGill, the statue of Rocky stands in front of the Justice Center as a sentinel over campus. Careful observers will note a chipped tooth and a torn ear, signs of his ferocity. Despite his tough outward appearance, the statue of Rocky is beloved by fans. Continuing a tradition begun by the Class of 1998, each year, during convocation and commencement, freshman and seniors rub his head for good luck before going to the ceremonies. Seniors are also often spotted getting their picture made riding Rocky in the days leading up to graduation.

UNC Asheville is proud of its bulldog heritage. Today, Rocky, in all of his forms serves as a rallying point for fans far and wide.

1990-2003

2004-Present

ROCKY

Important NCAA Terms

A prospective student-athlete is a student who has started classes for the ninth grade. In addition, a student who has not started classes for the ninth grade be-comes a prospective student-athlete if the institution provides such an individual (or the individual’s relatives or friends) any fi nancial assistance or other benefi ts that the institution does not provide to prospective students generally. An indi-vidual remains a prospective student-athlete until one of the following occurs (whichever is earlier):

(a) The individual offi cially registers and enrolls in a minimum full-time program of studies and attends classes in any term of a four-year collegiate institution’s regular academic year (excluding summer); or(b) The individual participates in a regular squad practice or competition at a four-year collegiate institution that occurs before the beginning of any term; or (Re-vised: 1/11/89, 1/10/90)(c) The individual offi cially registers and enrolls and attends classes during the sum-mer prior to initial enrollment. (Adopted: 4/28/05, Revised: 1/17/09)

Contact: A contact is any face-to-face encounter between a prospective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians and an institutional staff member or athletics representative during which any dialogue occurs in excess of an exchange of a greeting. Any such face-to-face encounter that is prearranged (e.g., staff member positions himself or herself in a location where contact is possible) or that takes place on the grounds of the prospective student-athlete’s educational institution or at the site of organized competition or practice involving the prospective student-athlete or the prospective student-athlete’s high school, preparatory school, two-year college or all-star team shall be considered a contact, regardless of whether any conversation occurs. However, an institutional staff member or athletics representative who is approached by a pro-spective student-athlete or the prospective student-athlete’s parents, relatives or legal guardians at any location shall not use a contact, provided the encounter was not prearranged and the staff member or athletics representative does not engage in any dialogue in excess of a greeting and takes appropriate steps to immediately terminate the encounter.

Contact Period: A contact period is that period of time when it is permissible for authorized athletics department staff members to make in-person, off-campus recruiting contacts and evaluations.

Evaluation: Evaluation is any off-campus activity designed to assess the academic qualifi cations or athletics ability of a prospective student-athlete, including any visit to a prospec-tive student-athlete’s educational institution (during which no contact occurs) or the observation of a prospective student-athlete participating in any practice or competition at any site.

Evaluation Period:An evaluation period is a period of time when it is permissible for authorized ath-letics department staff members to be involved in off-campus activities designed to assess the academic qualifi cations and playing ability of prospective student-athletes. No in-person, off-campus recruiting contacts shall be made with the pro-spective student-athlete during an evaluation period.

Quiet Period: A quiet period is a period of time when it is permissible to make in-person recruit-ing contacts only on the institution’s campus. No in-person, off-campus recruiting contacts or evaluations may be made during the quiet period.

Dead period: A dead period is a period of time when it is not permissible to make in-person recruiting contacts or evaluations on or off the institution’s campus or to permit offi cial or unoffi cial visits by prospective student-athletes to the institution’s cam-pus. The provision of complimentary admissions to a prospective student-athlete during a dead period is prohibited, except as provided in Bylaw 13.7.2.5 for a pro-spective student-athlete who visits an institution as part of a group. During a dead period, a coaching staff member may not serve as a speaker at or attend a meeting or banquet at which prospective student-athletes are in attendance, except as provided in Bylaw 13.1.8.1, and may not visit a prospective student-athlete’s educa-tional institution. It remains permissible, however, for an institutional staff member to write or telephone a prospective student-athlete during a dead period.

Initial Eligibility: A student-athlete who enrolls in a member institution as an entering freshman with no previous full-time college attendance shall meet specifi c NCAA academic requirements, as certifi ed by the NCAA Eligibility Center, as approved by the Ex-ecutive Committee, and any applicable institutional and conference regulations, to be considered a qualifi er and thus be eligible for fi nancial aid, practice and compe-tition during the fi rst academic year in residence. For further information please visit, www.eligibilitycenter.org.

Frequently Asked Questions

What is the National Letter of Intent (NLI)?The NLI is a contract between a prospect and an institution. By signing a NLI, a prospect agrees to attend UNC Asheville for at least one academic year. In ex-change, UNC Asheville must provide athletic fi nancial aid for one academic year. The NLI early signing period for Basketball, Baseball, Tennis and Volleyball is No-vember 10-17, 2010. The regular signing period for Basketball is April 13 - May 18, 2011. The regular signing period for Baseball, Tennis and Volleyball is April 13- August 1, 2011. The NLI signing period for Soccer and Track is February 2-August 1, 2011. The NLI regular signing period for all other sports is April 13-August 1 2011. For more information, visit the NLI website: http://www.ncaa.org/wps/wcm/connect/nli/nli.

What is the difference between an offi cial visit and unoffi cial visit?After opening day of classes of the prospect’s senior year, the prospect may take fi ve offi cial visits to different Division I or II schools. Before the visit, the prospect must present a high school transcript, proof of SAT, ACT, PACT, PSAT test to UNC Asheville, register with the NCAA Eligibility Center, and be placed on the Institu-tion’s IRL. An offi cial visit may not occur if the prospect is not registered with the NCAA Eligibility Center. Offi cial visits are paid in part and extended by UNC Asheville coaches only. All visits must be comparable to normal student life.

Prospects may make unlimited number of unoffi cial visits and may visit UNC Asheville anytime except during a dead period. Prospects are solely responsible for all expenses of unoffi cial visits. However, prospects may receive three compli-mentary admissions to any home athletic contest, excluding Big South Conference Post Season Tournaments.

What is the NCAA Eligibility Center?It is the agency that certifi es both a prospect’s academic and amateur eligibility for Division I and II. A prospect should register with the NCAA Eligibility Center at the beginning of their senior year in high school. Visit the NCAA Eligibility Center website for registration information.

This is a brief summary of regulations which outlines the basic recruiting rules to help prospective student-athletes and parents better understand the recruiting process. UNC Asheville is committed to recruiting and conducting its athletics program with the highest level of integrity. If you have any questions about NCAA rules, please contact Terri Brne, Associate Athletics Director, at 828-251-6930.

THE NCAA

For over 30 years, the Bulldog Athletics Association has been the athletics scholarship fundraising arm of the UNC Asheville Athletics Department, but in its simplest terms, the Bulldog Athletics Club is YOU. Construction workers, doctors, teachers, lawyers, bankers, manufacturers, brokers, and technicians who are friends, fans, alumni, and countless combinations of others from Asheville, Weaverville, Arden, Hendersonville, …and places all over North Carolina, the United States, and the world. They all have one thing in common—a passion for Bulldog Athletics. While we have high expectations for conference and NCAA competition, we also have high expectations for outstanding graduation rates, personal growth, and community involvement. As a member of the Bulldog Athletics Association, you become a critical part of a successful athletics program with a tradition of developing a student-athlete. We must raise funds not only to increase the amount of scholarship money we can offer but also to offset the rising costs of a college education. The confi dence of knowing your investment will be maximized is one reason supporting UNC Asheville Bulldog Athletics is a great investment. UNC Asheville Athletics receives no state funding for scholarships, so 100 percent of your gift will enable UNC Asheville to recruit and retain student-athletes who will succeed in the classroom, athletics arena, and the community – following our motto:

Champions in Athletics, Leaders in Life.

For more information about the Bulldog Athletics Association, please contact us:UNC Asheville Athletics

Justice Center, CPO #2600One University Heights

Asheville, NC 28804Phone: (828) 251-6459

Fax: (828) 251-6386www.uncabulldogs.com

“UNC Asheville is a point of pride for this community, as an alumnus and business owner. We are proud to support the athletics department and student-athletes as they represent our community and bring attention to WNC.”

--Rich Davis ’93, Jan Davis Tire Store

“The athletics scholarship I received from UNC Asheville allowed me to focus solely on my academics and soccer, without being concerned about how to pay for school. I donate to the Bulldog Athletics Club now so that current and future student-athletes can enjoy the same experience I did. Being a student-athlete at UNC Asheville was one of the best experiences of my life and the values and lessons I learned have helped me in my professional career and my personal life. Go Bulldogs!”

--Pat Britz ’90; former men’s soccer player

THE BULLDOG ATHLETICS ASSOCIATION