2 8 7 % 5 ( $ . 6 2 ) $ 9 ,$ 1 & + 2 / ( 5 $ ,1 - BioOne · OUTBREAKS OF AVIAN CHOLERA IN HOPE BAY, ANTARCTICA G. A. Leotta,1,2,4 I. Chinen,2 G. B. Vigo,1 M. Pecoraro,3 and M. Rivas2

OUTBREAKS OF AVIAN CHOLERA IN HOPE BAY,ANTARCTICA

Authors: Leotta, G. A., Chinen, I., Vigo, G. B., Pecoraro, M., and Rivas,M.

Source: Journal of Wildlife Diseases, 42(2) : 259-270

Published By: Wildlife Disease AssociationURL: https://doi.org/10.7589/0090-3558-42.2.259

BioOne Complete (complete.BioOne.org) is a full-text database of 200 subscribed and open-access titlesin the biological, ecological, and environmental sciences published by nonprofit societies, associations,museums, institutions, and presses.

Your use of this PDF, the BioOne Complete website, and all posted and associated content indicates youracceptance of BioOne’s Terms of Use, available at www.bioone.org/terms-of-use.

Usage of BioOne Complete content is strictly limited to personal, educational, and non - commercial use.Commercial inquiries or rights and permissions requests should be directed to the individual publisher ascopyright holder.

BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofitpublishers, academic institutions, research libraries, and research funders in the common goal of maximizing access tocritical research.

Downloaded From: https://bioone.org/journals/Journal-of-Wildlife-Diseases on 09 Oct 2020Terms of Use: https://bioone.org/terms-of-use

OUTBREAKS OF AVIAN CHOLERA IN HOPE BAY, ANTARCTICA

G. A. Leotta,1,2,4 I. Chinen,2 G. B. Vigo,1 M. Pecoraro,3 and M. Rivas2

1 Laboratorio de Diagnostico e Investigaciones Bacteriologicas, Facultad de Ciencias Veterinarias, Universidad Nacionalde La Plata, Calle 60 y 118, La Plata (1900), Buenos Aires, Argentina2 Servicio Fisiopatogenia, Instituto Nacional de Enfermedades Infecciosas—ANLIS ‘‘Dr. Carlos G. Malbran,’’Velez Sarsfield 563, Buenos Aires, Argentina3 Catedra de Virologıa, Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata, Calle 60 y 118,La Plata (1900), Buenos Aires, Argentina4 Corresponding author (email: [email protected])

ABSTRACT: During austral summers 1999–2000 and 2000–01, two outbreaks of avian choleraoccurred in the Hope Bay area (63u249S, 56u599W), located on the tip of the Antarctic Peninsula.Eighty-six dead birds were found: five kelp gulls (Larus dominicanus), 36 skuas (Stercorarius sp.),and 45 Adelie penguins (Pygoscelis adeliae). The carcasses were studied using clinical,pathological, and microbiological criteria. Water samples from ponds where birds were settledand samples from 90 healthy birds also were analyzed during the second outbreak. Pasteurellamultocida isolates were identified by biochemical tests, capsular type, somatic serotype, andsusceptibility to nine antibiotics. Molecular subtyping was performed by ApaI and SmaI pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC-PCR). In February 2000, mortality in skuas was 16% and 2% in kelp gulls. In the 2000–01breeding season, mortality in south polar skuas was 47%, 24% in brown skuas, 1.4% in kelp gulls,and 0.01% in Adelie penguins. All birds had lesions of avian cholera. In kelp gulls the presentationwas chronic, whereas skuas and penguins suffered subacute and acute disease, respectively. Fifty-five isolates recovered from dead birds and one from water were identified as P. multocidagallicida, type A:1. The strains presented a unique molecular pattern by PFGE and ERIC-PCR. Apossible hypothesis to explain the origin of the outbreaks was that nonbreeder kelp gulls carried P.multocida gallicida to Hope Bay, and avian cholera was transmitted through water to skuas andpenguins. This study reports avian cholera in new bird species, their potential role in thetransmission of the disease, and the different responses of these species to the disease.

Key words: Adelie penguin, Antarctica, avian cholera, ERIC-PCR, kelp gull, Pasteurellamultocida, PFGE, skua.

INTRODUCTION

Avian cholera is an infectious diseasecaused by Pasteurella multocida. Trans-mission is thought to be either by in-halation of a bacteria-ladened aerosol(Simensen and Olson, 1980) or by con-sumption of contaminated water or food(Botzler, 1991). The disease can be eitheracute or chronic in poultry, but in wildbirds the predominant clinical presenta-tion is acute (Wobeser, 1997). Morbidityand mortality are variable, and suscepti-bility is species dependent. Avian cholerahas been documented in over 100 differ-ent wild bird species and in NorthAmerica epizootics, killing thousands ofwaterfowl annually (Botzler, 1991). Mor-tality due to avian cholera also has beenreported in Japan (Nakamine et al., 1992),Canada (Wobeser et al., 1979), NewZealand (de Lisle et al., 1990), the Arctic

(Samuel et al., 1997), and Denmark(Pedersen et al., 2003). Mortality of brownskuas (Parmelee et al., 1979) and kelpgulls (Kaschula and Truter, 1951) hasbeen reported previously.

Two potential reservoirs for P. multocidain waterfowl populations have been sug-gested: carrier birds and wetland sites. P.multocida occasionally has been isolatedfrom healthy waterfowl (Vaught et al., 1967;Korschgen et al., 1978), and a recent studyshowed evidence that birds serve as a reser-voir for avian cholera (Samuel et al., 2005).

The Hope Bay area, located on the tipof the Antarctic Peninsula, encompassesBase Antartica Esperanza, the northern-most continental Antarctic Station(63u249S, 56u599W). During spring andsummer seasons, Adelie penguins (Pygos-celis adeliae), gentoo penguins (Pygoscelispapua), kelp gulls (Larus dominicanus),brown skuas (Stercorarius antarctica lonn-

Journal of Wildlife Diseases, 42(2), 2006, pp. 259–270# Wildlife Disease Association 2006

259


bergi), south polar skuas (Stercorariusmaccormicki), snowy sheathbills (Chionisalbus), Antarctic terns (Sterna vittata),and Wilson’s storm petrels (Oceanitesoceanicus) are breeding in Hope Bay;and six species—southern giant petrels(Macronectes giganteus), southern fulmars(Fulmarus glacialoides), cape petrels(Daption capense), snow petrels (Pago-droma nivea), black-bellied storm petrels(Fregetta tropica), and imperial shags(Phalacrocorax albiventer)—are visitingthe area (Coria and Montalti, 1993). Thisstudy describes two outbreaks of aviancholera among wild birds in Hope Bayduring the 1999–2000 and 2000–01 breed-ing seasons.

MATERIALS AND METHODS

Study areas and populations

Hope Bay (63u 249S, 56u 599W) is separatedfrom Bransfield, Joinville, and Dundee Islands

by the Antarctic Strait. In general, thesurroundings of the bay are covered byglaciers except for its southern face, whichhas an ice-free area of approximately 10 km2.The southwestern limit is the Deposit Glacier,and the northeastern margin is defined bya lighthouse. There are two coves in theabovementioned area, Hut Cove and EagleCove, separated by Seal Point. Hope Bay ischaracterized by the presence of 12 waterbodies, mostly of glacial origin, the mostimportant of which is Boeckella Lake (Fig. 1).

On 15 February 2000, during the 1999–2000breeding season and an avian cholera outbreak,a population census of skuas and kelp gulls wasconducted by direct counting. During the 2000–01 breeding season (between November 2000and February 2001), breeding areas for brownskuas, south polar skuas, kelp gulls, and snowysheathbills were identified (Fig. 1), and activenests with at least one egg were marked.Population census was performed again bydirect counting. Four transects between 1,000and 3,000 m2 each were established, andbreeding areas were surveyed during walksalong these transects at seven-day intervals.

FIGURE 1. Location of birds in Hope Bay during the 2000–01 breeding season: (s) nesting areas of southpolar skuas, (b) nesting areas of brown skuas, (L) nesting areas of kelp gulls, (NB) settlement of nonbreederskuas and kelp gulls, (C) nesting areas of snowy sheathbills, (G) gentoo penguin colony, (T) nesting area ofAntarctic terns, (W) nesting areas of Wilson’s storm petrels, (nb) settlement of nonbreeders skuas and kelpgulls during the 1999–2000 breeding season.

260 JOURNAL OF WILDLIFE DISEASES, VOL. 42, NO. 2, APRIL 2006


Egg-laying and hatching data were re-corded, and a population census of nonbreed-ing south polar skuas, brown skuas, and kelpgulls was performed by direct counting. Inaddition, walks through the four transectswere carried out each day to record mortality,and six additional transects of 1,500 m2 wereestablished through the Adelie penguin colo-ny.

Sample collection and histopathology

Carcasses collected during the 1999–2000breeding season were frozen and sent toLaboratorio de Diagnostico e InvestigacionesBacteriologicas (LADIB; Facultad de CienciasVeterinarias, Universidad Nacional de LaPlata, Argentina) for microbiological andpathological studies. Dead birds involved inthe 2001 outbreak were collected and identi-fied; they were necropsied at Hope Bay.Tissue samples were collected for microbio-logic and histopathologic studies. Samplesfrom trachea, lung, air sacs, pericardiac sacs,esophagus, stomach, intestine, heart, spleen,brain, liver, and kidney from carcasses takenduring the two outbreaks were fixed in 10%buffered formalin for histopathologic studies.After embedding in paraffin, the samples weresectioned (3 mm) and stained with hematoxylinand eosin and periodic acid–Schiff (PAS).

Microbiological studies

Samples from lung, liver, spleen, and heartfrom carcasses collected during February 2000were streaked on a blood agar plate (bloodagar base, Difco, Becton Dickinson, Le Pontde Claix, France, with 5% defibrinated sheepblood) and incubated at 37 C for 48 hr.Samples from blood, liver, spleen, lung, airsacs, pericardiac sacs, and pharynx from allbirds collected during 2001 were streaked ona blood agar plate, P. multocida selective agarPMSA (Moore et al., 1994) and hektoenenteric agar (Becton Dickinson); all plateswere incubated at 37 C for 48 hr. Forenterobacteria isolation, samples from cloacaswabs were streaked on hektoen enteric agarand incubated at 37 C for 48 hr. Bacterialcolonies were stored at 220 C in brain-heartinfusion (Difco Laboratories, Detroit, Michi-gan, USA) with 30% glycerol and sent toLADIB for identification. Samples from in-testine, lung, and trachea were stored at220 C for isolation and identification ofCampylobacter spp. (Lior, 1984; Giacoboniet al., 1993) and Mycoplasma spp., as well asfor detection of Chlamydophila psittaci(Leotta et al., 2003).

For fungus isolation, samples from trachea

were streaked in duplicate on Sabourauddextrose agar containing yeast extract andchloramphenicol (Difco, Becton Dickinson),and incubated at 28 and 37 C for 10 days.Thelebolus microsporus was identified as pre-viously described (Leotta et al., 2002; de Hooget al., 2005), and yeasts were identified bycolony and cell morphology and by physiologicand biochemistry tests (Fell and Statzell-Tall-man, 1998a, b).

Between January and February 2001, sam-ples from pharyngeal swabs were collectedfrom 90 healthy birds (30 Adelie penguins, 30skuas, and 30 snowy sheathbills). Thesesamples were streaked on PMSA and in-cubated at 37 C for 48 hr.

Between 19 January and 13 February 2001,30 surface water samples from 10 lakes andponds were collected. Water samples (250 ml)were collected at three different times fromeach of six lakes and four minor ponds. Foreach water sample, temperature and pH weremeasured in situ with a Hanna HI8314(Hanna Instruments Argentina, Buenos Aires,Argentina). In addition, for each water sample,salinity was measured with a Hanna HI8033(Hanna Instrument Argentina). One hundredmicroliters from each water sample werestreaked on a blood agar plate and on PMSAin duplicate and incubated at 37 C for 48 hr.

Characterization of Pasteurella multocida isolates

Isolates were identified by morphologic andbiochemistry characteristics (Fegan et al.,1995; Koneman et al., 1999). The capsularserotype was determined by a multiplex PCRassay (primers from Integrated DNA Tech-nologies, Coralville, Iowa, USA, and reagentsfrom Amersham Biosciences Corp., Piscat-away, New Jersey, USA) (Townsend et al.,2001). Heat-stable antigens were serotyped byimmunodiffusion according to the method ofHeddleston et al. (1972) using antisera fromthe National Veterinary Services Laboratory(Ames, Iowa, USA). All isolates were sero-typed by M. J. Wolcott at the USGS–NationalWildlife Health Center, Madison, Wisconsin,USA.

The susceptibility of P. multocida strains toampicillin, ceftiofur, cephalothin, enrofloxacin,florfenicol, gentamicin, streptomycin, tetracy-cline, and tiamulin was established. Theminimum inhibitory concentration was de-termined by the broth microdilution test, andgrowth inhibition was evaluated according tothe National Committee for Clinical Labora-tory Standards for P. multocida (NCCLS M31-A2 and M7), with the exception of gentamicin(according to other non-Enterobacteriaceae

LEOTTA ET AL.—AVIAN CHOLERA IN ANTARCTICA 261


values), ampicillin, tetracycline (according toEnterobacteriaceae values), tiamulin (accord-ing to Actinobacillus pleuropneumoniae val-ues), and streptomycin (according to NORM/NORM-VET 2002 for Escherichia coli values).

Molecular subtyping of Pasteurellamultocida isolates

All isolates of P. multocida from bothoutbreaks were subtyped by enterobacterialrepetitive intergenic consensus PCR (ERIC-PCR) and pulsed-field gel electrophoresis(PFGE). For molecular comparison, six P.multocida strains were included: P. multocidamultocida type A:1 (X-73), P. multocidagallicida type A:14 (NADC P-2225), P. multo-cida gallicida type A:1 from Australia poultry(donated by Dr. P. Blackall), P. multocidagallicida type A:1, and P. multocida septicatype A:1 from Argentina poultry, and onestrain isolated from a southern giant petrelduring February 2000 in the South ShetlandIslands at 200 km from Hope Bay (Leotta etal., 2003).

The ERIC-PCR was carried out essentiallyas described by Amonsin et al. (2002). Onemilliliter of P. multocida culture grown over-night in brain-heart infusion at 37 C(OD620:0.5 ml of culture) was used for geno-mic DNA extraction and purification bythe WizardTM kit (Promega, Madison, Wiscon-sin, USA). Oligonucleotide primers ERIC1R(59 ATGTAAGCTCCTGGGGATTCAC) andERIC2 (59 AAGTAAGTGACTGGGGTGAGCG)were used to generate DNA fingerprints. Thefragments obtained were separated by elec-trophoresis in 2% agarose gels containingethidium bromide (2 mg/ml). Electrophoresiswas carried out in a 1X tris-acetate-EDTAbuffer for 3.5 hr at 80 V; 1 kb DNA Ladder(Promega) as a fragment size marker wasused.

The PFGE was carried out essentially asdescribed by Gunawardana et al. (2000).Briefly, the plugs of agarose containing DNAwere digested with 40U of ApaI (Promega).Lambda Ladder PFGE Marker (New EnglandBioLabs, Beverly, Massachusetts, USA) asfragment size marker was used. The fragmentswere separated in a 1.2% agarose gel (PulsedField Certified Agarose, BioRad, Hercules,California, USA) in 0.5X tris-borate-EDTAbuffer at 14 C in a contour CHEF-DR IIIsystem (BioRad). The run time was 22 hr, witha constant voltage of 170 V, using a linearpulse ramp of 1–30 sec. The staining wascarried out with 0.5 mg/ml of aqueous ethid-ium bromide solution (BioRad). As a secondenzyme, 40U of SmaI (Promega) was used for

restriction with a linear pulse ramp of 0.5–40 sec for 22.5 hr (Pedersen et al., 2003).Salmonella Braenderup CDC H-9812 wasincluded as fragment size marker to analyzethe patterns generated with SmaI PFGE.

The gel images of PFGE and ERIC-PCRfingerprints obtained by Kodak Digital Sci-ence 1DTM were analyzed using BioNumericsversion 3.5 (Applied Maths, Kortrijk, Bel-gium). The relationship among the patternswas estimated by the proportions of sharedbands applying the Dice coefficient witha 1.5% band position tolerance, and a dendro-gram based on the UPGMA method wasgenerated.

RESULTS

Bird populations

On 15 February 2000, 100 kelp gullsand 84 skuas were counted. Kelp gullswere breeding in the Scar Hills andlighthouse areas, and skuas were breedingbetween Boeckella Lake and Flora Mount;nonbreeder kelp gulls and skuas weregrouped around three ponds (Fig. 1).During austral summer 2000–01, ninebreeding bird species were recorded inHope Bay: kelp gull, south polar skua,brown skua, snowy sheathbill, Wilson’sstorm petrel, antarctic tern, gentoo pen-guin, and Adelie penguin. The distributionof these species is shown in Figure. 1.Population estimates from direct countsfor kelp gulls, south polar skuas, brownskuas, and snowy sheathbills collected inthe 2000–01 breeding season are shown inTables 1 and 2. Antarctic tern and Wil-son’s storm petrel colonies in Flora Mountwere observed.

Avian cholera outbreak descriptions

In February 2000 the mortality rate fornonbreeder kelp gulls was 2% (2/100), andfor nonbreeder skuas 16% (13/84). Theywere found dead around ponds wherenonbreeder flying birds were settled.Between 10 January and 7 February2001, three nonbreeder kelp gulls, repre-senting 2% of the population, were founddead. On 17 January nonbreeder skuasstarted to die, and 23 skua carcasses were



collected until 20 February. Of thesecarcasses, 10 were south polar skuas, and13 were brown skuas; the mortality for thesouth polar skua population was 47%, andfor brown skuas it was 24% (Table 3). Allbirds affected by avian cholera were foundaround ponds.

Between 22 January and 6 February, 40adults and five chick Adelie penguins werefound dead or dying. The estimatedmortality was 0.01% among 123,859 pairsof Adelie penguins (Myrcha et al., 1987).Dead penguins had been breeding aroundthe ponds used by both skuas and kelpgulls. No other bird species was founddead in the area.

Pathology

In the 1999–2000 breeding season, twokelp gulls and eight brown skuas were

studied. At necropsy, no ectoparasites orskin lesions were seen. Fibrin depositsover coelomic serous membranes, livercapsule, and pericardium of two kelp gullsand seven brown skuas were seen. Auto-lytic changes and damage due to freezingseverely hampered the histopathologicevaluation of the tissues. Severe conges-tion, edema, and fibrin in the pulmonaryparenchyma of all birds were observed.Lesions observed in skuas and kelp gullswere compatible with subacute aviancholera.

During the 2000–01 breeding season,71 birds were studied. Among them, foursouth polar skuas, two brown skuas, and14 Adelie penguins were found dying. Theskuas had polydipsia, tremors, and dys-pnea. Stertors, nostrils and mouth filledwith abundant secretions, inability to fly

TABLE 1. Data on population sizes of south polar skuas, brown skuas, kelp gulls, and snowy sheathbills in theHope Bay area during the 2000–2001 breeding season.

SpeciesActivenest

Egga Chickb Breeding adultc Nonbreedingd

TotalpopulationMean SE Range Mean SE Range Mean SE Range Mean SE Range

South polarskua

2 1b 0.5b 0–3b 0c 0c 0c 4 0.2 2–4 17 1.3 10–22 21

Brown skua 7 2 0.9 0–8 1 0.6 0–5 14 0.2 12–14 39 2.9 21–58 54Kelp gull 24 28 3.5 5–38 20 2.7 7–32 48 2.8 38–65 145 5.2 115–160 213Snowy

sheathbill18 26 4.3 3–45 22 2.5 5–29 36 1 32–40 29 1 25–33 87

SE 5 standard error.a Monitored from 1 November to 31 December 2000.b Monitored from 29 November 2000 to 31 January 2001.c Monitored from 1 November 2000 to 28 February 2001.d Monitored from 1 January to 28 February 2001.

TABLE 2. Data on population sizes of nonbreeding south polar skuas, brown skuas, kelp gulls, and snowysheathbills in Hope Bay area.

Species

Nonbreeding birds

1 November–31 December 2000 1 January–28 February 2001

Mean SE Range Mean SE Range

South polar skua 5 0.5 4–9 17 1.3 10–22Brown skua 42 4.1 32–58 39 2.9 29–45Kelp gull 38 0.7 26–46 145 5.2 115–158Snowy sheathbill 25 1 22–30 29 1 26–37

SE 5 Standard error.



and uncoordination, general weakness,and loss of a fear response to approachinghumans were also seen. Moreover, theyhad a body temperature above 43 C. Thepenguins were observed with nervoussigns, tremors, incoordination, andopisthotonos.

Field necropsies of 23 skuas, three kelpgulls, and 45 Adelie penguins wereperformed. In all birds the conjunctivawas hyperemic. Ectoparasites were notseen. The stomach was empty, except forpenguins, which contained a normalamount of krill. Typical lesions of aviancholera were observed; large quantities ofviscous mucus in the pharynx and hemor-rhagic serosal surfaces of the coelomiccavity organs and peritoneal lining wereobserved. Predominant lesions observedin kelp gulls, skuas, and Adelie penguinsare shown in Table 3.

Lesions observed in kelp gulls werecompatible with chronic avian cholera. Inthese birds the outstanding gross lesionwas exudate and edema in the air spaces ofhead with hemorrhages and congestion inskeletal muscles surrounding the skull. Inone carcass no lesions of avian cholerawere observed.

In skuas the principal lesions werecompatible with subacute avian cholera.

Fibrinous exudate involving the livercapsule, mesentery, air sacs, and pericar-dium with petechial hemorrhage andheterophilic infiltration in areas of acutefocal necrosis was observed. In addition,these birds had respiratory tract edema,congestion, and perivascular hemorrhagewith heterophils, macrophages, and lym-phocytes.

In Adelie penguins the lesions werecompatible with acute avian cholera. Theprincipal lesions were hepatomegaly withmultiple small necrotic areas and spleno-megaly with petechiae and ecchymoses. Thelivers had multiple foci of coagulativenecrosis and heterophilic infiltration. Hy-peremia in the meninges was the onlyabnormality observed in the nervous system.

Isolation results

Pasteurella multocida was isolated fromthe lung of two skuas during the 2000outbreak and from 53 birds during the2001 outbreak. The number of isolates foreach species is shown in Table 3. The twoP. multocida isolates from kelp gulls wererecovered from the mouth. Isolates fromsouth polar skuas and brown skuas wereprimarily from lung. For Adelie penguins,P. multocida 27 isolates were recoveredfrom liver and one from lung.

TABLE 3. Lesions observed and number of P. multocida isolates from south polar skuas, brown skuas, kelpgulls, and Adelie penguins dying of avian cholera in Hope Bay during a 2001 outbreak.

Lesions and P. multocida isolatedSouth polar skuas

(n510)Brown skuas

(n513)Kelp gulls

(n53)

Adeliepenguins(n545)

General hemorrhages 10 13 0 45Fibrin deposit over coelomic serous membranes 8 12 0 0Pulmonary congestion 9 11 0 0Pulmonary edema 9 11 0 0Pulmonary fibrin 8 11 0 0Fibrinonecrotic pericarditis 7 10 0 0Myocarditis 7 10 0 0Digestive tract with passive hyperemia 10 13 0 45Hepatomegaly and splenomegaly 9 11 0 6Hepatomegaly and splenomegaly with necrotic areas 0 0 0 44Edema and hemorrhages in the head 0 0 2 0Hyperemia in the meninges 0 6 0 29P. multocida strains 10 13 2 28



All isolates were gram-negative rods andproduced indole, reduced nitrate, andwere oxidase and catalase positive. Hemo-lysis production, MacConkey growth, andurease activity were negative. The isolatesfermented glucose, mannitol, arabinose,sorbitol, dulcitol, mannose, and sucrosebut not lactose, trehalose, maltose, galac-tose, and xylose. These isolates weresensitive to ampicillin, ceftiofur, cephalo-thin, enrofloxacin, florfenicol, gentamicin,streptomycin, tetracycline, and tiamulin.All 55 isolates were characterized as P.multocida gallicida, capsular type A, andsomatic serotype 1.

Samples from 90 healthy birds werenegative for P. multocida. Pasteurellamultocida gallicida serotype A 1 wasrecovered from one of three water sam-ples. The temperature, pH, and salinity ofthis pond were 5 C, 7, and 8.73 g/l,respectively. The pond was being usedby nonbreeding skuas and kelp gulls.

During the 2000 outbreak, Rhodotorulaminuta was isolated from cloaca and lungsamples of three skuas. Cryptococcusalbidus were recovered from cloaca sam-ples of two skuas, and Campylobacter laribiotype I from the intestinal content oftwo skuas and one kelp gull. During the2001 outbreak, T. microsporus from thetrachea of one skua and three kelp gullswas isolated. An E. coli characterized asenteropathogenic E. coli was recoveredfrom the pharynx of two skuas. All samplesfrom both outbreaks were negative forSalmonella spp., C. psittaci, and Myco-plasma spp.

Molecular subtyping of Pasteurellamultocida isolates

Sixty-two isolates (56 from Hope Bay,one from a southern giant petrel, and fiveadditional isolates) were included in thisstudy. Using ERIC-PCR, five differentpatterns were detected, with 10–13 sepa-rated bands between 0.2 and 1.2 kb. The56 isolates of P. multocida gallicida typeA:1 recovered during the two aviancholera outbreaks in Hope Bay and the

strain isolated from a southern giant petrelfrom the South Shetland Islands wereidentical using ERIC-PCR, and the pat-tern had 10 bands. The other P. multocidastudied yielded four different patterns.Pasteurella multocida multocida type A:1(NADC X-73) and P. multocida gallicidatype A:14 (NADC P-2225) shared thesame pattern. This pattern was closelyrelated to the pattern from the Antarcticstrains with 94.9% similarity and one banddifference. Three different patterns wereobtained with the P. multocida gallicidatype A:1 strain from Australia and P.multocida septica type A:1 and P. multo-cida gallicida type A:1 strains from Ar-gentina; patterns for these had 81.6%,80.0%, and 73.9% similarity to Antarcticstrains, respectively (Fig. 2).

Using ApaI PFGE, isolates yielded sixpatterns with 9–14 defined and well-separated bands between 40 and 400 kb.The strains recovered from Antarctica,including the isolate from a southern giantpetrel, were indistinguishable by ApaIPFGE, showing a pattern with 11 bands.The other P. multocida strains weregenetically diverse showing five polymor-phic ApaI PFGE patterns, different fromthe Antarctic pattern. The NADC X-73and NADC P-2225 strains showed pat-terns with a two-band difference and91.6% similarity. These strains were ge-netically related to Antarctic strains andhad 82.5% similarity and a four-banddifference. By ApaI PFGE, the P. multo-cida gallicida type A:1 strain from Aus-tralia and the P. m. septica type A:1 and P.multocida gallicida type A:1 strains fromArgentina were only 46.9% similarto Antarctic strains (Fig. 2). The resultsobtained by ApaI were confirmed by SmaIPFGE.

DISCUSSION

The possibility of disease introductioninto Antarctic wildlife has been recognizedsince the start of the Antarctic Treaty in1962 (Kerry et al., 1999), and precautions



to prevent the introduction of microorgan-isms into the region south of 60uS latitudeare prescribed by the Protocol on Envi-ronmental Protection to the AntarcticTreaty of 1998. However, this issue hasreceived limited attention, and very little isknown about endemic or nonindigenousdiseases in Antarctic bird populations(Kerry et al., 1999).

There have been two documentedevents of bacterial diseases that resultedin mortality in Antarctic birds. The firstoccurrence of avian cholera was in brownskuas reported on Livingston Island in theAntarctic Peninsula region; P. multocidaA:1 was isolated (Parmelee et al., 1979).The second event, in February 2000,occurred in the South Shetland Islands;P. multocida A:1 was isolated from a deadsouthern giant petrel (Leotta et al., 2003).

In the past two decades, three bird

mortality events were reported in HopeBay. In 1981 and 1990, 12 skuas and 38brown skuas were found dead, respective-ly (Montalti et al., 1996). The thirdmortality event occurred in February1997, including 16 brown skuas and sevensouth polar skuas (Leotta et al., 2002).Unfortunately, the cause for this mortalitywas not determined.

During the P. multocida outbreaks inthe 1999–2000 and 2000–01 breedingseasons in Hope Bay, avian cholera wasdiagnosed as the primary cause of mortal-ity among birds. In wild birds this diseaseis predominantly described as acute (Wo-beser, 1997). However, in Hope Bayapparent differences in susceptibility wereobserved between affected species. Thechronic form of avian cholera was ob-served in kelp gulls, the subacute form inskuas, and the acute form in Adelie

FIGURE 2. Dendrograms of P. multocida strains and sources, year of isolation, and phenotypiccharacteristics: (A) ERIC-PCR dendrogram; (B) ApaI-PFGE dendrogram.



penguins. Most of the mortality wasassociated with skuas, mainly the southpolar skua; Adelie penguins were leastaffected. However, the potential impact ofavian cholera on the Adelie penguinpopulation could not be established be-cause these birds started their migration inthe first days of February.

The isolation of P. multocida gallicidatype A:1 from carcasses reinforced theclinical diagnosis. In addition, all theAntarctic strains showed near-identicalphenotypic and genotypic characteristicsand were indistinguishable by ERIC-PCRand by ApaI and SmaI PFGE, confirmingthese outbreaks. According to Tenover’sdefinition (Tenover et al., 1995), bothoutbreaks were due to a unique clone. Itis interesting that all isolates of P. multo-cida gallicida recovered from wild birds ofHope Bay and the isolate from a southerngiant petrel found dead in February 2000in the South Shetland Islands have anindistinguishable molecular pattern; it isprobable they share a common origin. Thesouthern giant petrel might have acquiredthe infection eating dead or dying animalsin Hope Bay and then died in the SouthShetland Islands, as these birds are able tofly more than 400 km per day (Marchantand Higgins, 1993). Unfortunately, it wasnot possible to compare the isolates fromHope Bay with the former isolates fromLivingston Island (Parmelee et al., 1979).

The unique molecular patterns ob-tained by ApaI and SmaI PFGE andERIC-PCR with P. multocida gallicidaA:1 strains from Antarctica were differentfrom the patterns obtained with the five P.multocida gallicida A:1 strains of differentorigin, in spite of belonging to the samesubspecies and serotype. However, it maybe informative to compare the Hope Bayisolates with P. multocida strains isolatedfrom other outbreaks involving wild birdsand to utilize newer and more advancedmolecular epidemiological techniques,such as multilocus sequence typing ormultilocus variable-number tandem re-peat analysis. The fact that all isolates

were indistinguishable irrespective of birdspecies and the year of isolation couldindicate a remarkable genetic stability andpersistence of this strain. A similar situa-tion was described in Denmark, where P.multocida strains recovered from wildbirds in 1996 and 2003 were indistinguish-able based on the same molecular tech-niques use in this study (Pedersen et al.,2003).

In contrast to other avian cholera out-breaks in wildfowl populations (Botzler,1991), it is difficult to ascertain thepossible origin of avian cholera in HopeBay because of geographic isolation andthe absence of domestic animals or in-vertebrate vectors. In addition, P. multo-cida has never been reported from Ant-arctic marine mammals. The extremeclimatic conditions do not enhance envi-ronmental survival of P. multocida, andthe failure to isolate P. multocida fromhealthy birds does not provide evidencefor the presence of carriers.

Kelp gulls appeared to be more resistantto the disease. During the 1999–2000breeding season, kelp gulls had lesionscompatible with subacute avian cholera; inthe 2000–01 breeding season lesions werecompatible with chronic avian cholera. Onepossible hypothesis to explain both out-breaks is that nonbreeder kelp gulls carriedP. multocida gallicida to Hope Bay. It ispossible that the kelp gulls acquired theinfection during the 1999–2000 breedingseason and maintained the infection eitherin individual birds or in the populationthrough bird-to-bird transmission accord-ing to Wobeser’s hypothesis (1992). Onehundred and seven nonbreeder kelp gullsarrived 15 days before the onset of the2001 outbreak, and they may have servedas carriers (Rosen and Bischoff, 1950;Korschgen et al., 1978; Titche, 1979).

Once P. multocida was introduced toHope Bay, we believe that contaminatedwater provided the primary means forspread to skuas and penguins. Althoughsome water bodies in Hope Bay can beconsidered typical lakes, since they do not



freeze to the bottom and are generally freeof ice in summer, some shallow waterbodies have permanent ice cover all year(Izaguirre et al., 1998). During the 2001outbreak, P. multocida gallicida also wasrecovered from the water of a pond thatboth nonbreeding skuas and Adelie pen-guins drink from. This pond had theoptimal physical and chemical conditionsas well as pH, temperature, and salinity forP. multocida survival (Bredy and Botzler,1989). In addition, only birds around theseponds were affected.

Other microoorganisms including R.minuta, C. albidus, T. microsporus, C. laribiotype I, and EPEC were isolated fromsome birds with avian cholera. As thesemicroorganisms do not cause lesionssimilar to those of avian cholera, and theyhave never been reported as pathogens forwild birds, we consider that these birdscould be asymptomatic carriers of theseorganisms in the Antarctic ecosystem.

We believe that avian cholera is notendemic in Antarctic and that P. multocidais introduced by migratory birds. Allenvironmental isolates were restricted toone pool where the birds were settled, andto date the existence of an environmentalreservoir has not been demonstrated.Currently it is not possible to takemeasures to resolve outbreaks by aviancholera in Antarctica because of interna-tional legislation (Antarctic Treaty). How-ever, it is possible to prevent the in-troduction of microorganisms potentiallyaffecting Antarctic birds populations asa consequence of human presence inAntarctica. To achieve this, we must knowwhat diseases are present and understandtheir epidemiology in Antarctic wildlife.

ACKNOWLEDGMENTS

The authors wish to thank the InstitutoAntartico Argentino and Departamento deBiologıa de la Direccion Nacional del Antar-tico for providing support for field work inAntarctica. We are grateful to M. PerezCometto and I. Izaguirre for their assistanceand collaboration in Hope Bay, and to M. J.Wolcott for the serotyping of P. multocida

strains at the USGS–National Wildlife HealthCenter, Madison, Wisconsin, USA. We ac-knowledge the professional assistance of G.Giacoboni, G. Praca, and R. Cerda and areespecially grateful to G. Chillemi, M. Saggese,N. R. Coria, and D. Montalti, as well as to L.Isturiz for grammatical revisions.

LITERATURE CITED

AMONSIN, A., J. F. X. WELLEHAN, L. L. LI, J. LABER,AND V. KAPUR. 2002. DNA fingerprinting ofPasteurella multocida recovered from aviansources. Journal of Clinical Microbiology 40:3025–3031.

BOTZLER, R. G. 1991. Epizootiology of avian cholerain wildfowl. Journal of Wildlife Diseases 27:367–395.

BREDY, J. P., AND R. G. BOTZLER. 1989. The effects ofsix environmental variables on Pasteurella mul-tocida populations in water. Journal of WildlifeDiseases 25: 232–239.

CORIA, N. R., AND D. MONTALTI. 1993. Flying birds atEsperanza Bay, Antarctica. Polish Polar Re-search 14: 433–439.

DE HOOG, G. S., E. GOTTLICH, G. PLATAS, O.GENILLOUD, G. LEOTTA, AND J. V. BRUMMELEN.2005. Evolution, taxonomy and ecology of thegenus Thelebolus in Antarctica. Studies inMycology 51: 33–76.

DE LISLE, G. W., W. L. STANISLAWEK, AND P. J.MOORS. 1990. Pasteurella multocida infections inRockhopper penguins (Eudyptes chrysocome)from Campbell Island, New Zealand. Journal ofWildlife Diseases 26: 283–285.

FEGAN, N., P. J. BLACKALL, AND J. L. PAHOFF. 1995.Phenotypic characterization of Pasteurella mul-tocida isolates from Australian poultry. Veteri-nary Microbiology 47: 281–286.

FELL, J. W., AND A. STATZELL-TALLMAN. 1998a.Cryptococcus Vuillemin. In The yeasts: Ataxonomic study, 4th Edition, C. P. Kurtzmanand J. W. Fell (eds.). Elsevier Science B.V.,Amsterdam, The Netherlands, pp. 742–767.

———, AND ———. 1998b. Rhodotorula F. C.Harrison. In The yeasts: A taxonomic study,4th Edition, C. P. Kurtzman and J. W. Fell(eds.). Elsevier Science B.V., Amsterdam, TheNetherlands, pp. 800–827.

GIACOBONI, G., K. ITOH, E. TAKAHASHI, AND T.MITSUOKA. 1993. Comparison of fecal Campylo-bacter in calves and cattle of different ages andareas in Japan. Journal of Veterinary Science 55:555–559.

GUNAWARDANA, G. A., K. M. TOWNSEND, AND A. J.FROST. 2000. Molecular characterisation of avianPasteurella multocida isolates from Australia andVietnam by REP-PCR and PFGE. VeterinaryMicrobiology 72: 97–109.

HEDDLESTON, K. L., J. E. GALLAGHER, AND P. A.



REBERS. 1972. Fowl cholera: Gel diffusion pre-cipitin test for serotyping Pasteurella multocidafrom avian species. Avian Diseases 16: 925–936.

IZAGUIRRE, I., A. VINOCUR, G. MATALONI, AND M.POSE. 1998. Phytoplankton communities in re-lation to trophic status in lakes from Hope Bay(Antarctic Peninsula). Hydrobiologia 369/370:73–87.

KASCHULA, V. R., AND D. E. TRUTER. 1951. Fowlcholera in sea gulls on Dassen Island. Journal ofthe South African Veterinary Medical Associa-tion 22: 191–192.

KERRY, K., M. RIDDLE, AND J. CLARKE. 1999. Diseasesof Antarctic wildlife. A report for SCAR andCOMNAP. Australian Antarctic Division, Chan-nel Highway, Kingston, Australia.

KONEMAN, E. W., S. D. ALLEN, W. M. JANDA, P. C.SCHRECKENBERG, AND W. C. WINN, JR. 1999.Enterobateriaceae. In Diagnostico microbiolo-gico, 5th Edition, E. W. Koneman (ed.). Springer,Editorial Medica Panamericana, Buenos Aires,pp. 388–461.

KORSCHGEN, C. E., H. C. GIBBS, AND H. L. MENDALL.1978. Avian cholera in eiderducks in Maine.Journal of Wildlife Diseases 14: 254–258.

LEOTTA, G. A., J. PARE, L. SIGLER, D. MONTALTI, G. B.VIGO, M. PETRUCCELLI, AND E. H. REINOSO. 2002.Thelebolus microsporus mycelial mats in thetrachea of wild brown skua (Catharacta antarc-tica lonnbergi) and south polar skua (C. mac-cormicki) carcasses. Journal of Wildlife Diseases38: 443–447.

———, M. RIVAS, I. CHINEN, G. B. VIGO, F. A.MOREDO, N. CORIA, AND M. J. WOLCOTT. 2003.Avian cholera in a southern giant petrel (Macro-nectes giganteus) from Antarctica. Journal ofWildlife Diseases 39: 732–735.

LIOR, H. 1984. New, extended biotyping scheme forCampylobacter jejuni, Campylobacter coli andCampylobacter laridis. Journal of Clinical Mi-crobiology 20: 636–640.

MARCHANT, S. and P. J. HIGGINS (eds.). 1993.Handbook of Australian, New Zealand andAntarctic Birds, Vol. 1. Oxford University Press,Melbourne, Australia, pp. 356–369.

MONTALTI, D., N. R. CORIA, AND A. CURTOSI. 1996.Unusual deaths of subantarctic skuas Catharactaantarctica at Hope Bay, Antarctica. MarineOrnithology 24: 39–40.

MOORE,M.K.,L.CICNJAK-CHUBBS, AND R.J.GATES.1994.A new selective enrichment procedure for isolat-ing Pasteurella multocida from avian and environ-mental samples. Avian Diseases 38: 317–324.

MYRCHA, A., A. TATUR, AND R. DEL VALLE. 1987.Numbers of Adelie penguin breeding at HopeBay and Seymour Island rookeries (West Antarc-tica) in 1985. Polish Polar Research 8: 411–422.

NAKAMINE, M., M. OHSHIRO, Y. AMEKU, K. OHSHIRO,T. KERUMA, T. SAWADA, AND T. EZAKI. 1992. Thefirst outbreak of fowl cholera in Muscovy ducks

(Cairina moschata) in Japan. Journal of Veter-inary Medical Science 54: 1225–1227.

NATIONAL COMMITTEE FOR CLINICAL LABORATORY

STANDARDS. 2002. Performance standard forantimicrobial disk and dilution susceptibilitytests for bacteria isolated from animals. Ap-proved standard 2nd Edition, M 31-A2. NCCLS,Wayne, Pennsylvania.

NATIONAL COMMITTEE FOR CLINICAL LABORATORY

STANDARDS. 2003. Methods for dilution antimi-crobial susceptibility tests for bacteria that growaerobically. Approved standard 6th Edition, col23 M 7-A6. NCCLS, Wayne, Pennsylvania.

NORM/NORM-VET. 2002. Consumption of antimi-crobial agents and occurrence of antimicrobialresistance in Norway. Tromsø/Oslo 2003.

PARMELEE, D. F., S. J. MAXON, AND N. P. BERNSTEIN.1979. Fowl cholera outbreak among BrownSkuas at Palmer Station. Antarctic Journal ofthe United States 14: 168–169.

PEDERSEN, K., H. H. DIETZ, J. C. JORGENSEN, T. K.CHRISTENSEN, T. BREGNBALLE, AND T. H. ANDER-

SEN. 2003. Pasteurella multocida from outbreaksof avian cholera in wild and captive birds inDenmark. Journal of Wildlife Diseases 39:808–816.

ROSEN, M. N., AND A. I. BISCHOFF. 1950. Theepidemiology of fowl cholera as it occurs in thewild. Transactions of the North AmericanWildlife Conference 15: 147–154.

SAMUEL, M. D., D. R. GOLDBERG, D. J. SHADDUCK, J.I. PRICE, AND E. G. COOCH. 1997. Pasteurellamultocida serotype 1 isolated from a lesser snowgoose: evidence of a carrier state. Journal ofWildlife Diseases 33: 332–335.

———, D. J. SHADDUCK, D. R. GOLDBERG, AND W. P.JOHNSON. 2005. Avian cholera in waterfowl: Therole of lesser snow and Ross’s geese as diseasecarriers in the playa lakes region. Journal ofWildlife Diseases 41: 48–57.

SIMENSEN, E., AND L. D. OLSON. 1980. Aerosoltransmission of Pasteurella multocida in turkeys.Avian Diseases 24: 1007–1010.

TENOVER, F. C., R. D. ARBEIT, R. V. GOERING, P. A.MICKELSEN, B. E. MURRAY, D. H. PERSING, AND

B. SWAMINATHAN. 1995. Interpreting chromo-somal DNA restriction patterns produced bypulsed-field gel electrophoresis: Criteria forbacterial strain typing. Journal Clinical Microbi-ology 33: 2233–2239.

TITCHE, A. 1979. Avian cholera in California. WildlifeManagement Branch Administrative Report 79-2. California Department of Fish and Game,Sacramento, California, 49 pp.

TOWNSEND, K. M., J. D. BOYCE, J. Y. CHUNG, A. J.FROST, AND B. ADLER. 2001. Genetic organiza-tion of Pasteurella multocida cap loci anddevelopment of a multiplex capsular PCR typingsystem. Journal of Clinical Microbiology 39:924–929.



VAUGHT, R. W., H. C. MCDOUGLE, AND H. H.BURGESS. 1967. Fowl cholera in waterfowl atSquaw Creek National Wildlife Refuge, Mis-souri. Journal of Wildlife Management 31:248–253.

WOBESER, G. 1992. Avian cholera and waterfowlbiology. Journal of Wildlife Diseases 28:674–682.

———. 1997. Diseases of waterfowl, 2nd Edition.Plenum Press, New York, New York, 324 pp.

———, D. B. HUNTER, B. WRIGHT, D. J. NIEMAN, AND

R. ISBISTER. 1979. Avian cholera in waterfowl inSaskatchewan, spring 1977. Journal of WildlifeDiseases 15: 19–24.

Received for publication 10 January 2005.



Documents

2 8 7 % 5 ( $ . 6 2 ) $ 9 ,$ 1 & + 2 / ( 5 $ ,1 - BioOne · OUTBREAKS OF AVIAN CHOLERA IN HOPE BAY, ANTARCTICA G. A. Leotta,1,2,4 I. Chinen,2 G. B. Vigo,1 M. Pecoraro,3 and M. Rivas2