fcell-08-00386 June 3, 2020 Time: 18:45 # 1

ORIGINAL RESEARCHpublished: 05 June 2020

doi: 10.3389/fcell.2020.00386

Edited by:Katarzyna Oktaba,

Unidad Irapuato (CINVESTAV),Mexico

Reviewed by:Michael Hausmann,

Heidelberg University, GermanyApiwat Mutirangura,

Chulalongkorn University, Thailand

*Correspondence:Natalia Nikolaevna VeikoSatelit32006@yandex.ru

Specialty section:This article was submitted to

Epigenomics and Epigenetics,a section of the journal

Frontiers in Cell and DevelopmentalBiology

Received: 26 February 2020Accepted: 29 April 2020

Published: 05 June 2020

Citation:Konkova MS, Ershova ES,

Savinova EA, Malinovskaya EM,Shmarina GV, Martynov AV, Veiko RV,

Zakharova NV, Umriukhin P,Kostyuk GP, Izhevskaya VL, Kutsev SI,

Veiko NN and Kostyuk SV (2020)1Q12 Loci Movement

in the Interphase Nucleus Underthe Action of ROS Is an Important

Component of the Mechanism ThatDetermines Copy Number Variation

of Satellite III (1q12) in Healthand Schizophrenia.

Front. Cell Dev. Biol. 8:386.doi: 10.3389/fcell.2020.00386

1Q12 Loci Movement in theInterphase Nucleus Under the Actionof ROS Is an Important Componentof the Mechanism That DeterminesCopy Number Variation of Satellite III(1q12) in Health and SchizophreniaMarina Sergeevna Konkova1, Elizaveta Sergeevna Ershova1,Ekaterina Alekseevna Savinova1, Elena Mikhailovna Malinovskaya1,Galina Vasilievna Shmarina1, Andrey Vladimirovich Martynov1,Roman Vladimirovich Veiko1, Nataly Vyacheslavovna Zakharova2, Pavel Umriukhin1,3,4,Georgy Petrovich Kostyuk2, Vera Leonidovna Izhevskaya1, Sergey Ivanovich Kutsev1,Natalia Nikolaevna Veiko1* and Svetlana Victorovna Kostyuk1

1 Federal State Budgetary Scientific Institution, Research Centre for Medical Genetics, Moscow, Russia, 2 N.A. AlekseevClinical Psychiatric Hospital No 1, Moscow Healthcare Department, Moscow, Russia, 3 I.M. Sechenov First Moscow StateMedical University of the Ministry of Health of the Russian Federation, Moscow, Russia, 4 P.K. Anokhin Institute of NormalPhysiology, Moscow, Russia

Introduction: Genome repeat cluster sizes can affect the chromatin spatialconfiguration and function. Low-dose ionizing radiation (IR) induces an adaptiveresponse (AR) in human cells. AR includes the change in chromatin spatial configurationthat is necessary to change the expression profile of the genome in response to stress.The 1q12 heterochromatin loci movement from the periphery to the center of the nucleusis a marker of the chromatin configuration change. We hypothesized that a large 1q12domain could affect chromatin movement, thereby inhibiting the AR.

Materials and Methods: 2D fluorescent in situ hybridization (FISH) method wasused for the satellite III fragment from the 1q12 region (f-SatIII) localization analysisin the interphase nuclei of healthy control (HC) lymphocytes, schizophrenia (SZ)patients, and in cultured mesenchymal stem cells (MSCs). The localization of thenucleolus was analyzed by the nucleolus Ag staining. The non-radioactive quantitativehybridization (NQH) technique was used for the f-SatIII fragment content in DNAanalysis. Satellite III fragments transcription was analyzed by reverse transcriptasequantitative PCR (RT-qPCR).

Results: Low-dose IR induces the small-area 1q12 domains movement from theperiphery to the central regions of the nucleus in HC lymphocytes and MSCs.Simultaneously, nucleolus moves from the nucleus center toward the nuclear envelope.The nucleolus in that period increases. The distance between the 1q12 domain and thenucleolus in irradiated cells is significantly reduced. The large-area 1q12 domains do notmove in response to stress. During prolonged cultivation, the irradiated cells with a large

Frontiers in Cell and Developmental Biology | www.frontiersin.org 1 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 2

Konkova et al. Large 1q12 Blocks Adaptive Response

f-SatIII amount die, and the population is enriched with the cells with low f-SatIII content.IR induces satellite III transcription in HC lymphocytes. Intact SZ patients’ lymphocyteshave the same signs of nuclei activation as irradiated HC cells.

Conclusion: When a cell population responds to stress, cells are selected according tothe size of the 1q12 domain (the f-SatIII content). The low content of the f-SatIII repeat inSZ patients may be a consequence of the chronic oxidative stress and of a large copiesnumber of the ribosomal repeats.

Keywords: CNVs, satellite III, rDNA, schizophrenia, 1q12

INTRODUCTION

Repetitive elements comprise two-thirds of the human genome(de Koning et al., 2011). It is known that CNVs could causeinherited diseases in the absence of coding-sequence alterations(Freeman et al., 2006; Redon et al., 2006; Henrichsen et al., 2009;Conrad et al., 2010; Brahmachary et al., 2014; Jackson et al.,2018; Monlong et al., 2018). Tandem repeats in human genomeare organized in a head-to-tail orientation and are characterizedby increased instability with a pronounced quantitativepolymorphism (Warburton et al., 2008; Brahmachary et al., 2014;Black and Giunta, 2018; Hannan, 2018; Lower et al., 2018). Therising roles of satellite tandem repeats in genome organizationand disease development were suggested (Iafrate et al., 2004;Sebat et al., 2004; Dumbovic et al., 2017). In our previousstudies, we described the CNVs of two tandem repeats in humanblood leukocytes: ribosomal repeat (Chestkov et al., 2018a;Malinovskaya et al., 2018) and satellite III fragment (f-SatIII),localized in the largest heterochromatin region 1q12 of the firstchromosome (Ershova et al., 2019a,c).

f-SatIII (1.77-kb fragment) from satellite III (Cooke andHindley, 1979) is an AT-rich repeat (with 64% AT pairs). Thehuman genome contains approximately∼20 pg f-SatIII/ng DNA.In natural human aging, we observed a significant disproportionin the content of f-SatIII in blood leukocytes of the differentindividuals. We also observed the f-SatIII content disproportionin DNA samples of people working with the sources of IR(Ershova et al., 2019c). The cells of the same strain and ofthe same body tissue differ significantly in the f-SatIII content(Ershova et al., 2019c,a).

Ribosomal repeat (rDNA) is localized on acrocentricchromosomes and consists of a transcribed region that includesthree rRNA genes (18S, 5.8S, and 28S) and a non-transcribedspacer. In the nucleus, rDNA forms the nucleolus: a specialstructure where rDNA transcription occurs and the initial stagesof ribosome biogenesis are realized. The rDNA-transcribedregion contains an unusually low number of AT pairs (28%).The human genome, on average, contains 400 copies of the

Abbreviations: AR, adaptive response; cfDNA, circulating cell-free DNA; CNVs,copy number variants; FISH, fluorescent in situ hybridization; f-SatIII, the satelliteIII fragment from the 1q12 region; HC, healthy control; HSFs, human skinfibroblasts; IR, low-dose ionizing radiation; LADs, lamina-associated domains;MAA, methanol:glacial acetic acid (3:1); MSCs, mesenchymal stem cells; mtDNA,mitochondrial DNA; NQH, non-radioactive quantitative hybridization; PHA,phytohemagglutinin; PI, propidium iodide; rDNA, ribosomal repeat; ROS, reactiveoxygen species; SZ, schizophrenia.

ribosomal repeat or∼5 pg of rDNA/ng of total DNA. In contrastto the f-SatIII repeat, in the older age group, there is a significantnarrowing of the rDNA CN range and the coefficient of variationdecreases (Malinovskaya et al., 2018).

Analysis of rDNA and f-SatIII repeat CNVs in the humanblood leukocytes earlier revealed an interesting effect in SZpatients. The SZ patients have significantly more rDNA copiesthan HC (Veiko et al., 2003; Chestkov et al., 2018a). In contrast,the f-SatIII repeat content (or 1q12 size) in the SZ patients’leukocytes is lower compared to the HC (Kosower et al., 1995;Ershova et al., 2019a). The mechanism regulating the f-SatIIIcontent in health and SZ remains unknown.

Schizophrenia is a mental illness found in ∼1% of thepopulation with 70–80% heritability (Cardno et al., 1999).SZ patients during an exacerbation of the disease experiencesevere social and emotional stress (Howes and Murray, 2014).Oxidative stress and declined antioxidant statuses in the brainand peripheral tissues of the SZ patients have been reported.Different mechanisms of oxidative stress in SZ have beenproposed (Barron et al., 2017; Maas et al., 2017; Patel et al., 2017).However, regardless of the cause, the result is important: in theSZ patients during an exacerbation of the disease, the level ofROS is increased.

Previously, we noticed that the response of SZ patients’leukocytes to endogenous oxidative stress in some parameters isvery similar to the response of healthy cells to the low-dose IR.

For example, the cells of the unmedicated SZ patient as wellas the cells exposed to IR increase the mtDNA amount (Chestkovet al., 2018b). The level of the lymphocyte DNA damage in SZpatients is comparable with the DNA damage of the nuclearworkers. In the lymphocytes of∼30% of SZ patients, we observedDNA damage response, which is a typical response of humancells to IR (Korzeneva et al., 2015; Ershova et al., 2017). We alsoobserved very similar changes in the composition of cfDNA inSZ patients and irradiated nuclear workers. In both cases, cfDNAaccumulated the easily oxidized GC-rich fragments (GC-DNA),characterized with a pronounced biological activity (Korzenevaet al., 2016; Ershova et al., 2019b, 2020). In vitro experimentshave shown that GC-DNA stimulates the expression of NOXfamily enzymes in human cells, in particular the NOX4, whichcatalyzes the hydrogen peroxide synthesis on the cell surfaceand in the mitochondria. GC-DNA stimulates the large amountsof proinflammatory cytokines synthesis in human lymphocytes(Speranskii et al., 2015). Thus, GC-DNAs accumulating incfDNA of irradiated people and SZ patients may be one of the

Frontiers in Cell and Developmental Biology | www.frontiersin.org 2 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 3

Konkova et al. Large 1q12 Blocks Adaptive Response

sterile inflammation causes, which is often observed both duringirradiation and in SZ.

We found that ∼40% of the irradiated people havesignificantly reduced f-SatIII content compared to non-irradiatedpeople of the same age. We also observed that the f-SatIIIcontent decreased in the cultured HSFs under oxidizing agentCr(VI) (Ershova et al., 2019c). All these facts suggest that thereis a common mechanism leading to the f-SatIII repeat contentdecrease in the healthy cells under oxidative stress induced byenvironmental factors and in the cells of SZ patients during thedisease exacerbation.

Moderate ROS levels are known to stimulate an AR in thehuman cells. AR increases the cells’ resistance to stress (Sokolovand Neumann, 2015; Sisakht et al., 2020). We have shown earlierthat an important component of the AR is the chromatin spatialconfiguration change. We used the 1q12 loci transposition ininterphase nuclei from the periphery to the center as a markerof chromatin configuration change. The change in the f-SatIII(1q12) position in the nucleus under the stresses was found in anumber of our studies (Spitkovskii et al., 2003; Veiko et al., 2006;Ermakov et al., 2009a,b, 2011, 2013). The cells that, for variousreasons, did not change the 1q12 localization in response to IRfrequently died during the cultivation (Spitkovskii et al., 2003;Ermakov et al., 2009b).

It can be expected that the 1q12 locus sizes (f-SatIII content)will be important for the realization of the chromatin spatialconfiguration necessary for AR. The cells with a very large 1q12loci, possibly, may not be able to chromatin rearrangement dueto steric obstacles. Such cells should die first in chronic stressconditions. In this case, the population should accumulate thecells with small 1q12 loci sizes, and a decrease in the f-SatIIIcontent should be found in an isolated DNA.

To test this hypothesis, we analyzed the response of humancultured lymphocytes and MSCs to low doses of IR. In addition,lymphocytes isolated from the blood of the SZ patients in acutepsychosis were analyzed. As a result, we have shown that theresponse to the stress and proliferative stimuli associated with the1q12 loci movement in the nucleus is not realized in the cells witha large 1q12 loci size.

MATERIALS AND METHODS

SZ Patients and Healthy VolunteersThe study included 50 drug-naive patients inhabiting Moscow(men aged, 25–47 years). Patients were hospitalized in connectionwith exacerbation of SZ in N.A. Alexeev Clinical PsychiatricHospital No

¯1. Patients were diagnosed with paranoid SZaccording to the Diagnostic and Statistical Manual of MentalDisorders, Fourth Edition (DSM-IV) criteria. The control groupof the volunteers consisted of 42 men of the same age.

The Patients Consent to the Various AnalysesPerformedThe investigation was carried out in accordance with the latestversion of the Declaration of Helsinki and was approved by theRegional Ethics Committees of RCMG, CPH1, and MHRC. All

participants signed an informed written consent to participateafter the procedures had been completely explained.

Isolating of DNA From the LeukocytesFive milliliters of blood was collected from the peripheralvein with a syringe flushed with heparin (0.1 ml/5 ml blood)under strict aseptic conditions. The leukocytes were isolatedfrom 5 ml of blood by the method of Boyum (1968). Toisolate DNA, we used the standard method described indetail earlier (Chestkov et al., 2018a). The DNA quantificationis performed fluorimetrically using the PicoGreen dsDNAquantification reagent by Molecular Probes (Invitrogen, CA,United States). The DNA concentration in the sample iscalculated according to a DNA standard curve. We use EnSpireequipment (Finland) at excitation and emission wavelengths of488 and 528 nm, respectively.

Non-radioactive QuantitativeHybridizationThe NQH method for f-SatIII and rDNA repeats determinationwas specified in details previously [Ershova et al., 2019c(Supplement), (2019c) (Supplement)]. We used this methodwithout modifications. Relative standard error for NQH wasonly 5 ± 2%. The main contribution to the overall error ofthe experiment is made by the step of isolating DNA from theleukocytes. The total standard error was 11± 7%.

The DNA Probef-SatIII probe was a 1.77-kb cloned EcoRI fragment of humansatellite DNA (Cooke and Hindley, 1979) labeled with bio-11-dUTP by nick translation. Dr. H. Cook (MRC, Edinburgh,United Kingdom) kindly supplied the human chromosome lql2-specific repetitive satellite DNA probe pUC1.77.

Cell CultureLymphocytes were isolated by centrifugation in the Ficoll-urography system (Paneco, Russia) from heparinized peripheralblood of men. Lymphocytes were transferred to a culture mediumcontaining Hanks’ solution, 1 mM HEPES (Fluka), and 10% fetalcalf serum (HyClone, United States).

Mesenchymal stem cells (MSC-2303) were obtained fromadipose tissue (Loseva et al., 2012). MSCs were cultured inF10 (Invitrogen) complemented with 20% fetal bovine serum(FBS), 2 mM glutamine, 10 mM HEPES, 100 U/ml penicillin,100 mg/ml streptomycin, 10−6 M dexamethasone, and 2.5 ng/mlbasic fibroblast growth factor (FGF) (Sigma–Aldrich).

Irradiation of the Cells and IncubationWith Hydrogen PeroxideThe cells were irradiated at 20◦C on the pulsed roentgen radiationunit ARINA-2 (Spectroflash, Russia). The amplitude of voltage onthe X-tube was 160 kV, peak energy in the radiation spectrum was60 keV, and dose rate amounted to 0.16 Gy/min. After irradiation,the cells were incubated for 3 h at 37◦C. H2O2 (30% solution) wasadded to the culture medium of lymphocytes at a concentrationof 10 µM for 3 h at 37◦C.

Frontiers in Cell and Developmental Biology | www.frontiersin.org 3 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 4

Konkova et al. Large 1q12 Blocks Adaptive Response

Preparation of Cellular SamplesThe lymphocytes were washed with phosphate-buffered saline(PBS), subjected to hypotonicity (0.075 M KCl solution) and thenwere fixed with MAA on glass slides. The MSCs in slide flaskswere washed with PBS. The slides were removed and placed for10 min into a cold fixation solution MAA. Having repeated theprocedure three times, the slides were dried and subjected to2D FISH. A part of the preparation after 10 days was stainedwith silver nitrate.

The description of the fixing method selection is providedin the Supplementary Material. Three reasons to choose MAA(2D FISH) were the following: (1) the same cellular response(1q12 loci transposition) to IR observed in 2D and 3D FISHexperiments; (2) higher FISH 1q12 detection efficiency for MAA-fixed lymphocytes; and (3) inapplicability of the Ag-stainingmethod for cells fixed with 3.7% formaldehyde. Previously, otherauthors have shown that changes in 2D FISH chromosomestopology correlate with 3D FISH topology (Croft et al., 1999;Skalníková et al., 2000).

Fluorescent in situ HybridizationBefore the hybridization, the slides were treated with RNAse A(100 µg/ml). For the hybridization, the protocol and solutionsfrom Abbott Laboratories (Abbott Laboratories, Abbott Park,IL, United States) were used. Hybridization was carried out inthe thermostat ThermoBrite (StatSpin, United States) at 42◦.Lymphocyte nuclei were stained with PI.

f-SatIII FISH probe was a 1.77-kb-cloned EcoRI fragmentof human satellite DNA (Cooke and Hindley, 1979). Labelingof plasmid pUC1.77 was performed by nick translation usingCGH Nick Translation Kit (Abbott Molecular) under themanufacturer’s protocol with slight modification. Solutions ofplasmid DNA (3 µg/µl) were labeled with SpectrumGreen. In thereaction mix, 50% of the deoxythymidine triphosphate (dTTP)was substituted with the labeled deoxyuridine triphosphate(dUTP). About 20% of the fluorescent-labeled nucleotidewas incorporated into the DNA, while unincorporatednucleotides were removed by ethanol precipitation. Thefragment size was in 300–3000-bp range as determined byelectrophoresis in 1% agarose.

Activity of the NucleolusFixed cells were stained with silver nitrate (Howelland Black, 1980). In each experiment, 150 cells werescanned on photopanels.

Image AnalysisCell images were obtained using the AxioScope A1 microscope(Carl Zeiss) with 40 × and 100 × 1.3 lens. To analyze nucleusimages after 2D FISH and Ag staining of the NORs, we usedtwo programs: (1) the commercial Carl Zeiss program (Zen 2.6.Blue edition + modules Image Processing and Image Analysis);(2) “A computer program for determining the localizationand relative position of chromosome sites in the interphasenuclei of eukaryotic cells (Ellipse)”; the program is registeredin the Russian Federation register (No. 2019661442). The

Zen 2.6 application translates real signals (spots) and nucleusmultiple color images into a schematic image where the nucleus,signals, and background are stained in three different colors[Figure 1A(2)]. The Ellipse program was described earlier(Ermakov et al., 2011). For each schematic image, it defines thefollowing parameters: the nucleus center coordinates; FISH or Agsignal (spots) density distribution on the X- and/or Y-axis; theparameters associated with the spots density distribution analysisacross sectors; the distance from the cell center to the spot center(Ri); the angle between the radii R1(FISH) and R2(FISH); theradius of the nucleus R; the distance between the centers of spots(d); spots area (Si); and the nucleus area (Sn). An example ofthe lymphocyte nucleus analysis (a circle in the cross section) isshown in Figures 1A(3,4).

An example of the MSC nucleus analysis is shown inFigure 5A. The shape of the MSCs nuclei may be approximated toa geometric figure—ellipsoid in the cross-section of which lies anellipse. The program “Ellipse” makes it possible to determine theabsolute coordinates of point signals on the plain and values ofthe greater and smaller axes of the ellipse (a and b). By the affineconversions (rotation of the axes, transposition of the origin ofcoordinates, and normalization of coordinates of the signal to theaxes of the ellipse), the data are transferred to the scheme shownin Figure 5A. Alterations in the position of hybridization signalswere tested along two parameters: the normalized radius vectorof the labels (r) and distance between signals (d). The parametera/b≥ 1 reflects an alteration in the shape of the nucleus, while itsdecrease suggests that it assumes a more spherical shape.

The findings are represented as histograms of the frequencydistribution of the hybridization signal of 1q12 (or Ag-NORs)by the normalized radius vector (r = Ri/R) or by the normalizedSFISH (SAgNOR) of the cell nucleus. For each distribution, we usedthe data obtained from 100–500 cells.

3D–2D ModelingThe lymphocytes immobilized on the glass are similar in shapeto a flattened sphere, so we used a model that includes amathematical sphere description. It allows placing the pointsthat mimic the labeled chromosome regions in a desired waywithin the sphere and orthogonally project their position on theplane. In each projection act, the sphere is randomly orientedand flattened along the Z-axis (the sphere radius on the Z-axismay change). On the projection, the distances of each point fromthe sphere projection center and the angles (distances) betweenthe points relative to the center were determined. The obtainedparameter distributions measured in experiments were comparedwith the parameters set in the sphere space (Figure 1B, dottedcurve). The 3D image was transformed into a 2D image by meansof an internal algorithm (RCMG, Moscow, Russia).

Quantification of RNA SATIII LevelsTotal RNA was isolated from cells using the RNeasy MiniKit (Qiagen, Germany). After the treatment with DNAseI, RNA samples were reverse transcribed by the ReverseTranscriptase Kit (Sileks, Russia). The expression profiles wereobtained using quantitative reverse transcriptase polymerasechain reaction (qRT-PCR) with SYBRgreen PCR MasterMix

Frontiers in Cell and Developmental Biology | www.frontiersin.org 4 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 5

Konkova et al. Large 1q12 Blocks Adaptive Response

FIGURE 1 | ROS induces the movement of 1q12 loci from the membrane into the nucleus. (A) (1) Fiber-FISH chromatin 1q12 analysis with the f-Sat III probePUC1.77. Repeat clusters of f-SatIII (green) alternate with other repeats (red, PI) of a given region of the chromosome 1. (2) The example of the FISH result obtainedfor the control cells. 1q12 loci are represented in the nucleus (red, PI) by two fluorescent signals (green). Gallery of the cells was formed from multiple photos. Bars,5 µm. (3) Example of the nucleus image analysis. Image processing includes determining the center of gravity of the FISH signal, the radius vectors of the signals (r1and r2), the distance and angle between the signals (d and α), the area of the FISH signals (S1 and S2), and radius R and area S of the nucleus. The radius vector ris normalized to the value of the radius of the nucleus R and varies from 0 (center of the nucleus) to 1 (surface of the nucleus). (4) The total arrangement of FISHsignals on the plane in the control sample (green) and the irradiated sample (violet). In the control nuclei, signals with r > 0.75 are more common. In irradiated nuclei(10 cGy, 3 h), signals with r < 0.75 are more common. (B) (1) Cumulative histograms of the frequency distribution of the FISH signals by the radius vector r (0: centerof the nucleus) for intact, irradiated (3 and 10 cGy), H2O2-treated, and PHA-stimulated G0 human lymphocytes. Dotted line, 3D–2D simulation under the assumptionthat FISH signals are located on the surface of a flattened sphere modeling the cell nucleus located on the slide. Note: distributions of the r values for irradiated HC(3 and 10 cGy) differ significantly from non-irradiated HC: D = 0.51, α < 10−34 (Kolmogorov–Smirnov); p < 10−50 (U-test). (2,3) The distance and angle between thetwo FISH signals for intact and irradiated (10 cGy) human lymphocytes. (C) (1) Cumulative histograms of the frequency distribution of the FISH signals by the radiusvector r for HC (N = 10) and SZ groups (N = 15). (2) The values of the medians of the radius r for the HC group, for irradiated or H2O2-treated HC cells, and for theSZ cells. Note: Before the FISH nuclei were treated with RNase A.

Frontiers in Cell and Developmental Biology | www.frontiersin.org 5 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 6

Konkova et al. Large 1q12 Blocks Adaptive Response

(Applied Biosystems). The housekeeping gene TBP was evaluatedas reference gene. The RNA levels were analyzed in severalindependent experiments using the StepOne Plus (AppliedBiosystems); the technical error (%CV) was ∼2%. All PCRproducts were run in the polyacrylamide gel (PAGE) to confirmtheir size. The following primers (Metz et al., 2004; Enukashvilyet al., 2007) were used (Sintol, Russia):

HS3-1 (F: 5′AGTCCATTCAATGATTCCATTCCAGT-3′;R: 5′GAATAAAATTGATTGAAATCATCATCC-3′)HS3-9 (F: 5′AATCAACCCGAGTGCAATC-GAATGGAATCG3′; R: 5′TCCATTCCATTCCTGTACTCGG 3′).

Statistical AnalysisAll the findings reported here were reproduced at least twotimes as independent biological replicates. The significance ofthe observed differences was analyzed using the non-parametricMann–Whitney U-test (p) and Kolmogorov–Smirnov statistics(D and α). Data were analyzed with StatPlus2007 professionalsoftware1 and Statistica [TIBCO Software Inc. (2018), version132]. All p-values were two-sided and considered statisticallysignificant at p < 0.01.

RESULTS

Localization of 1q12 Loci in HumanLymphocyte Interphase NucleiThe f-SatIII repeat analyzed by the 2D FISH method is part ofthe largest heterochromatin block (1q12) in the human nucleus(Figure 1A). The blocks of f-SatIII tandem repeats are dispersedin the 1q12 region, alternating with other genome repeats, whichare clearly visible using spray-FISH method [Figure 1A(1)]. Inthe lymphocyte nucleus, the f-SatIII repeat is localized in tworegions corresponding to the location of two first chromosomehomologs. These regions are detected by the FISH method as twofluorescent signals [FISH signals, Figure 1A(2)]. In lymphocytes,the position of the FISH signal in the projection plane (circle)depends on how the nucleus is located on the slide duringthe sample preparation. Image processing includes determiningthe gravity center of the signal, the signal radius vector (r1and r2) value, the distance and angle between the signals (dand α), the signal area, and the radius and the nucleus area[Figure 1A(3)]. The radius vector r is normalized to the valueof the nucleus radius and changes from 0 (nucleus center)to 1 (nucleus surface). Figure 1A(4) summarizes the data ofthe HC lymphocyte nuclei hybridization signal (green dots)analysis. Most signals are located in the area corresponding tor values > 0.75. Computer modeling translation of 3D imagesinto 2D shows that the signal distribution in the projectionshown in Figure 1A(4) corresponds to the location of thesesignals near the surface of the sphere simulating the lymphocytenucleus. Thus, in the healthy people lymphocyte nuclei, the 1q12

1http://www.analystsoft.com/2http://tibco.com

loci detected by the f-SatIII DNA probe are located near thenuclear envelope.

ROS Induce the 1q12 Loci Movement From Peripheryto the Center of the NucleusFigure 1B(1) shows the f-SatIII localization in the HClymphocyte nucleus; the data are presented in the form of acumulative distribution of the normalized radius vector r (greencurve). In control lymphocytes, the r distribution is similar to thedistribution obtained by modeling (black dotted curve). In themodel, it was assumed that the signals are located exclusively onthe surface of the flattened sphere that simulates the lymphocytenucleus. Low-dose IR or hydrogen peroxide (10 µM, 3 h)significantly changes the 1q12 loci position in the nucleus[Figures 1A(4),B(1)]. In response to stress, 1q12 loci move fromthe perimembrane region (r > 0.75) deep into the nucleus andconverge with each other [Figures 1B(2,3)]. A similar 1q12 locimovement is also observed when a proliferative stimulus PHA isapplied to the lymphocytes [Figure 1B(1)].

Lymphocytes isolated from the SZ patients’ blood differfrom that of the control by 1q12 loci localization insidethe nucleus [Figure 1C(1), red]. Figure 1C(2) shows the rmedian values determined for control irradiated and non-irradiated lymphocytes and SZ patients’ lymphocytes. Thepatients’ lymphocytes occupy an intermediate position betweenthe control non-irradiated and irradiated lymphocytes. Forsome patients, the 1q12 localization coincided with the locuslocalization in the lymphocytes irradiated with 3 and 10 cGydoses. It can be assumed that in the patients’ organisms in acutedisease stage, the lymphocytes are exposed to oxidative stress,comparable in intensity to the low-dose IR effects.

The 1q12 Loci Movement in Response to StressDepends on the Locus SizeThe signal area (SFISH) in the control cells varies significantly(from 2 to 8% of the nucleus projection area on the plane). Thatvariability may be associated with different f-SatIII content incells of the same sample, as well as with different chromatincompaction degrees. In the irradiated HC lymphocytes and inthe SZ patients’ lymphocytes, the signal areas increase slightly inabout a half of the cells [Figure 2A(2)]. The signal form indicateschromatin decondensation in activated cells [Figure 2A(1)]. Atthe same time, the average f-SatIII repeat content determined bythe NQH method does not change in the cell population for 3 hafter IR exposure (p > 0.05).

Furthermore, we analyzed the dependence of the SFISH signalarea on the radius vector r value (Figure 2B). In the controlcells, we found no differences in the signal area in cells withr > 0.75 and r < 0.75. However, in activated lymphocytes,there are significant differences in signal areas, characterized bydifferent r values. Signals with r < 0.75 occupy a much smallerarea than signals with r > 0.75. Differences in the signal areas ofthe two groups are maximal for irradiated cells. The SZ patients’lymphocytes also differ significantly from the control by thatfactor (Figure 2C). Thus, irradiation and PHA stimulation ofhealthy donors’ lymphocytes induces the 1q12 loci movement,which occupies a relatively small volume, deep into the nucleus.

Frontiers in Cell and Developmental Biology | www.frontiersin.org 6 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 7

Konkova et al. Large 1q12 Blocks Adaptive Response

FIGURE 2 | ROS affect the size of f-SatIII repeat in the cells. (A) The area of FISH signals in the nuclei of activated lymphocytes (SZ or IR) is increased. (1) The photoof the control nucleus and the nucleus of the activated SZ cell. (2) Cumulative histograms of the frequency distribution of the FISH signals by the total square SFISH

for intact, irradiated (3 and 10 cGy), and PHA-stimulated G0 human lymphocytes and SZ lymphocytes. The signal area increases in about half of the nuclei of theactivated cells. (B) Cumulative histograms of the frequency distribution of the FISH signals by the square SFISH for intact, irradiated (10 cGy), PHA-stimulated HClymphocytes, and SZ lymphocytes. Each sample of FISH-signals was divided into two fractions: signals with r > 0.75 and r < 0.75. The data of comparison of twofractions by the Kolmogorov–Smirnov and Mans–Whitney methods are presented. In the control cells, the two fractions do not differ in the size of the signal areas. Inthe samples of activated lymphocytes, there is a disproportionation of the cells in terms of f-SatIII repeat areas, depending on r values. (C) The values of the ratiomedian SFISH (r > 0.75)/median SFISH (r < 0.75) for the HC cells, for irradiated HC cells, and for the SZ cells. (D) Prolonged cultivation of irradiated lymphocytesreduces the number of cells with a high f-SatIII repeat content. (1) Photos of the cell nuclei after 2 h and 7 days after irradiation with a dose of 50 cGy. (2) Change inthe repeat content in the DNA of irradiated and unirradiated HC lymphocytes during cultivation determined by method NQH. Note: Before the FISH nuclei weretreated with RNase A.

Frontiers in Cell and Developmental Biology | www.frontiersin.org 7 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 8

Konkova et al. Large 1q12 Blocks Adaptive Response

Loci of large size remain close to the membrane of the nucleus.Lymphocytes of SZ patients subjected to oxidative stress in vivoare also characterized by a disproportion of the signal areadepending on the signal location.

High f-SatIII Content Lymphocytes Are LessResistant to ROSWe analyzed the f-SatIII content change in the irradiated (50 cGy)lymphocytes DNA during longer cultivation (7 days) afterirradiation (Figure 2D). During cultivation, some cells die andhave signs of apoptosis and necrosis [Figure 2D(1), apoptosis].The average f-SatIII repeat content in the isolated DNA ofirradiated lymphocytes, determined by the NQH method, isreduced by almost two times compared to the cultivation start[Figure 2D(2)]. At the same time, the population mainly containsthe cells with only small 1q12 loci sizes [Figure 2D(1), 7 days].Thus, in response to oxidative stress, the population cells areselected by the f-SatIII repeat content. Low repeat containing cellshave an advantage. Since this repeat is distributed throughoutthe 1q12 site, it may be assumed that, predominantly, cellswith large 1q12 loci occupying a large nucleus volume die inresponse to the stress.

Satellite III Transcription in Lymphocytes in Responseto ROSComparing the FISH-signal areas during hybridization oflymphocyte nuclei treated and untreated with RNase A, we foundthat the f-SatIII DNA-probe hybridizes not only with DNA butalso with RNA (HS3-1). Figure 3A(2) shows a comparison ofsignal areas for the same lymphocyte population. In control cells,we found no differences in the signal area in the RNase A treatedand untreated nuclei. However, in RNase-treated stimulated cells(irradiated control lymphocytes and SZ patients’ lymphocytes),we found a significant total SFISH reduction. This indicates theRNA HS3-1 contribution in the nuclear DNA with the f-SatIIIprobe hybridization. The maximum SFISH increase in RNaseA-untreated nuclei was found in irradiated lymphocytes (50 cGy)after 72 h of cultivation [Figure 3A(1)].

Reverse transcriptase quantitative PCR (RT-qPCR) wasapplied to test an assumption about studied fragmenttranscription under irradiation stress [Figure 3B(1)]. Theamount of RNA HS3-1 significantly changed after 72 h ofirradiated lymphocytes cultivation. A small dose (10 cGy) and alarge dose (1 Gy) reduced the HS3-1 RNA amount; the effect wasmaximal for a 1-Gy dose. A 50-cGy dose increased HS3-1 RNAby several times.

In the same cells, we also studied a satellite III fragmenttranscription that is localized on chromosome 9 and is often usedto analyze the satellite DNA transcription under stress causedby various factors (Valgardsdottir et al., 2008). In contrast to thef-SatIII fragment from the 1q12 region, the satellite fragment ofchromosome 9 is maximally transcribed even under the low IRdose [Figure 3C(1)]. An increase in the dose (50 cGy and 1 Gy)decreases the level of HS3-9 RNA. The RNA HS3-9 amount inthe cells is several times higher than the HS3-1 transcript. Thus,the satellite III transcription profile in lymphocytes dependson the location of the satellite on chromosomes and on the

stress intensity. Low-dose IR exposures activate transcription ofsatellite III on chromosome 9.

Satellite III Transcription in SZ Patients’ White BloodCellsWe compared the HS3-1 and HS3-9 RNA levels in the whiteblood cells of SZ patients and HCs [Figures 3B(2),C(2,3),D].The HS3-9 RNA amount in human white blood cells was anorder of magnitude higher than the amount of HS3-1 RNA.The patients’ white blood cells contained more RNA HS3-1and RNA HS3-9 than the control white blood cells. We founda negative relationship between RNA HS3-1 and RNA HS3-9 levels (Figure 3D). It confirms the assumption that HS3-9transcription is predominant under weak stresses. Figure 3C(3)shows data on the HS3-9 RNA amount in the white bloodcells of 50 SZ patients and 42 healthy people. In the controlgroup, satellite III transcription was observed only in 40% ofthe samples. In the group of patients, the satellite transcriptionwas much higher.

Thus, stress in the SZ patient’s organism in acute diseasestage is accompanied by an increase in satellite III sequencestranscription in blood leukocytes.

Ribosomal DNA Localization in HumanLymphocytesRibosomal repeats in the eukaryotic cell form a specialstructure—the nucleolus. Various methods may be applied toanalyze the rDNA in the lymphocyte nucleus localization: FISH,nucleolus proteins analysis with antibodies, etc. We chose thesimplest method using silver nitrate staining of argentophilicnucleolus proteins. This method requires the same nucleuspreparation as the 2D FISH method used for f-SatIII fragmentanalysis. To analyze the image, we used the same algorithmas for the f-SatIII repeat (Figure 4A). The signal radius vectorvalues (dark brown silver spot) and the spot area (SAgNOR)were determined.

Figure 4A(2) compares the radius vector value distributionsof FISH signals and AgNOR signals in the nuclei of controllymphocytes, irradiated control lymphocytes, and SZ patientlymphocytes. In contrast to f-SatIII, rDNA in the nucleolusof HC are localized in the central nucleus regions—within asphere with a normalized radius of 0.4–0.5 inside the nucleus(simulation data). In irradiated cells (10 cGy, 3 h), the nucleolusmoves from the center of the nucleus (a sphere with aradius of 0.5–0.6), approximately to the same regions of thenucleus where 1q12 loci are localized, which shifted from thenuclear envelope to the center of the nucleus in response toIR. A similar movement of the 1q12 loci and nucleolus wasobserved in the SZ patients’ lymphocyte nuclei [Figure 4A(2),red curves]. Generalized data for several cell samples are shownin Figure 4B(1). The median values of the Ag-signal radius inactivated lymphocytes are significantly higher than in controllymphocytes. The rDNA movement in the nucleolus in activatedlymphocytes (irradiated control cells and cells of SZ patients) isaccompanied by a significant increase in the total nucleoli area[Figures 4A(3),B(2,3)].

Frontiers in Cell and Developmental Biology | www.frontiersin.org 8 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 9

Konkova et al. Large 1q12 Blocks Adaptive Response

FIGURE 3 | Transcription of satellite III in human cells. (A) Processing the nuclei with RNase A reduces the FISH-signal area. (1) Examples of the nuclei of SZ patientsand nuclei of irradiated HC cells treated and untreated with RNase A before the FISH. (2) Cumulative histograms of the frequency distribution of the FISH signals bythe square SFISH for treated and untreated with RNase A intact HC, irradiated HC (50 cGy, 48 h), and SZ lymphocytes. (B) Transcription of f-SatIII DNA (HS3-1).(1) Irradiated lymphocytes (72 h after exposure). (2) White blood cells of SZ and HC groups. (C) Transcription of satellite III located on chromosome 9 (HS3-9).(1) Irradiated lymphocytes (72 h after exposure). (2,3) White blood cells of SZ and HC groups. (D) Dependence of the amount of RNA HS3-1 on the amount of RNAHS3-9 for two groups.

Thus, in activated lymphocytes, there is an increase in thenucleolus area and its displacement to approximately the samenucleus area where the 1q12 loci are localized.

Localization of f-SatIII and rDNA in theHuman MSCTo confirm the universality of the human cell response tooxidative stress, we analyzed the effect of IR on the cultured

adipose tissue MSCs. Subconfluent MSC culture was used forthe analysis. The algorithm for analyzing cells with nuclei usingthe model with a rotation ellipsoid (projection on a plane is anellipse) was described earlier on the example of endothelial cells(Ermakov et al., 2011). Figure 5A provides examples of cells afterthe FISH procedure. Nucleoli were determined by Ag staining[Figure 5B(1)]. To analyze the 1q12 loci position and AgNORs,the values of the radius vector r normalized to the axes of theellipse were determined.

Frontiers in Cell and Developmental Biology | www.frontiersin.org 9 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 10

Konkova et al. Large 1q12 Blocks Adaptive Response

FIGURE 4 | ROS change the location and size of the nucleolus in lymphocyte. (A) (1) The example of Ag staining of the nucleolus (AgNOR). Gallery of the nuclei wasformed from multiple photos. (2) Cumulative histograms of the frequency distribution of the Ag signals by the radius vector r (0: center of the nucleus) for intact,irradiated (10 cGy), and SZ lymphocytes. For comparison, the graph shows the data for the FISH signals of the same samples. (3) Cumulative histograms of thefrequency distribution of the Ag signals by the total square SAgNOR for intact HC, irradiated HC (10 cGy), and SZ lymphocytes. The result is confirmed on five HC andfive SZ samples. (B) (1) The values of the medians of the radius r (AgNOR) for the HC cells, for irradiated HC cells and for the SZ cells. (2) The values of the mediansof the area S (AgNOR) for the groups. (3) The median of the AgNOR copy number for the groups.

Figure 5A(1) shows the histograms reflecting the loci 1q12localization and AgNORs in subconfluent non-irradiated andirradiated (10 cGy) cells. We found the same response as inthe lymphocytes. In irradiated cells, 1q12 loci move from theperiphery to the center of the nucleus in the region where thenucleoli are predominantly localized. This reduces the distanceand the angle between 1q12 homologs [Figures 5A(2,3)].

Analysis of the FISH-signal areas revealed the same pattern asin the case of lymphocytes: in the central nuclei regions (r< 0.75),the 1q12 loci localized with a smaller area [Figure 5A(4)]. Lociwith a large area do not change their location in the nucleusin response to stress. The differences observed for control cellsappear to be due to the fact that a small portion of the cellsare in the G1 phase of the cycle and respond to proliferative

stimuli by moving 1q12 from the membrane to the center ofthe nucleus. In response to the IR, there is also an increase inthe total AgNOR area, which indicates an increase in the rDNAvolume in the nucleus.

Mesenchymal stem cells turned out to be a convenient objectwhere it is possible to simultaneously analyze the nucleus and1q12 locus. Using the PI dye (forms complexes with GC-richDNA sequences) after FISH allows contrasting the nucleolus inthe nucleus (Figure 5A, photo). We determined the distancebetween the FISH signal (green) center and the surface of thenucleoli (red) in non-irradiated and irradiated cells (Figure 5C).The distance between the signals is significantly reduced inthe irradiated cells, which indicates that the 1q12 and rDNAloci are converging.

Frontiers in Cell and Developmental Biology | www.frontiersin.org 10 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 11

Konkova et al. Large 1q12 Blocks Adaptive Response

FIGURE 5 | The effect of IR on the localization of 1q12 and nucleolus in MSCs. (A) Foto: The example of the FISH result obtained for the MSCs. 1q12 loci arerepresented in the nucleus (red, PI) by two fluorescent signals (green). Gallery of the cells was formed from multiple photos. The nucleoli contrast in the nucleus.Bars, 5 µm. Colorless drawing: Schematic representation of the MSC nucleus after carrying out affine transformations, where r1 and r2 are normalized radiusvectors of the FISH signals. (1) Cumulative histograms of the frequency distribution of the FISH and Ag signals by the radius vector r (0: center of the nucleus) forintact and irradiated (3 and 10 cGy) cells. (2,3) The distance and angle between the two FISH signals for intact and irradiated (10 cGy) cells. (4) Cumulativehistograms of the frequency distribution of the FISH signals by the square SFISH for intact and irradiated (10 cGy) MSCs. Each sample of FISH signals was dividedinto two fractions: signals with r > 0.75 and r < 0.75. (B) (1) The example of the Ag staining obtained for the MSCs. Gallery of the cells was formed from multiplephotos. (2) Cumulative histograms of the frequency distribution of the Ag signals by the total square SAgNOR for intact and irradiated (10 cGy) MSCs. (C) The totaldistance between the center of the FISH signal and the surface of the nucleolus in the intact and irradiated (10 cGy) MSCs. (D) The effect of MSC irradiation on thecontent of f-SatIII, rDNA, and cell number. Doses are shown in the figure. Irradiated cells were cultured for 72 h.

Thus, in irradiated MSCs, 1q12 loci with a small area movefrom the membrane to the center of the nuclei. In this case, thenucleoli increase in size and approach the 1q12 loci.

Change in the MSC f-SatIII ContentUnder IRThe f-SatIII repeat content in cell DNA determined by the NQHmethod depends on the proportion of cells with high and lowrepeat content in a population. When low doses of IR are applied

(10 cGy, 72 h of cultivation), the repeat content increases inthe population, which reflects an increase in the number of cellswith an increased f-SatIII content (Figure 5D). Under the largeradiation doses (1 Gy), the repeat content reduces, while somecells die. It is logical to assume that the cells with a large f-SatIIIrepeat number die. In that case, the ribosomal repeat contentin the cells does not change. A similar response we observed ina cultured skin fibroblasts population exposed to the differentgenotoxic agent Cr(VI) concentrations (Ershova et al., 2019c).

Frontiers in Cell and Developmental Biology | www.frontiersin.org 11 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 12

Konkova et al. Large 1q12 Blocks Adaptive Response

DISCUSSION

Oxidative Stress Induces the Movementof Two Large Tandem Genome Repeatsin the Cultured Human Cells NucleiIn this study, we investigated how the mutual localization of twolarge genome tandem repeats in human cell nuclei changes underIR. The satellite domain at chromosome 1q12, detected with theprobe for f-SatIII, contains the largest heterochromatin site inthe genome, comprising a megabase stretch of satellite II and IIIDNA repeats. The amount of f-SatIII in DNA appears to reflectthe size of this large genome region. The higher is the contentof f-SatIII in DNA, the greater is the volume that this part ofthe genome occupies in the nucleus. We found that the f-SatIIIcontent in the human leukocyte genome varies from 6 to 44 pg/ngof DNA (Ershova et al., 2019c,a), i.e., the size of the 1q12 site mayvary several times. It should be mentioned that the cells of oneperson or one cultured strain also differ in the f-SatIII content.We have shown that HSFs contain cell subpopulations that differin f-SatIII repeat content by more than three times (Ershova et al.,2019c). The heterogenic cellular f-SatIII content (by 1q12 locisize) is even more pronounced in polyploid cancer cells (Ermakovet al., 2009b; Schwarz-Finsterle et al., 2013 and SupplementaryMaterial) and in cells of various brain regions of the SZ patient(Ershova et al., 2019a). Obviously, such a significant change inthe content of a large genome fragment affects the higher ordergenomic architecture.

In response to stress, these large chromatin fragments movefrom the surface into the nucleus (Figures 1, 5). The satellitedomain (1q12) translocation is the cells’ universal response tovarious types of stress. We observed this process in humanlymphocytes (Ermakov et al., 2009a, 2013; Figure 1), endothelialcells (HUVECs) (Ermakov et al., 2011), MSCs (Figure 5),and cancer cells (Ermakov et al., 2009b; SupplementaryMaterial). Our data on the transposition and convergenceof heterochromatin 1q12 loci of homologous chromosomesin response to IR confirm the data of other authors. It hasbeen shown that IR induces instant human-cell homologouschromosomes heterochromatin pairing (Dolling et al., 1997;Abdel-Halim et al., 2004).

The main condition for 1q12 loci movement in response toenvironmental factors is the presence of ROS in the intercellularenvironment or on the cell surface (Ermakov et al., 2009a,2013). The nature of the ROS source is not significant. Itmay be low-dose IR or hydrogen peroxide [Figure 1B(1)],NOX family enzymes inductors—fragments of cell-free DNA(Ermakov et al., 2013; Ershova et al., 2020) and endogenousstress caused by SZ disease (Figures 1B,C). ROS inhibition withantioxidants blocks the 1q12 movement in the interphase nucleus(Ermakov et al., 2009a).

However, the forces and molecular mechanisms that shapethe radial configuration of the 1q12 loci under the ROS actionremain largely elusive. Many authors believe that anchoring ofchromosomes to the nuclear lamina via LADs at the nuclearperiphery is a key regulator of the radial configuration ofchromatin. Genome fragments similar to the analyzed 1q12 loci

belong to LADs. LADs are gene poor, heterochromatic, andtranscriptionally silent. They are typically AT-rich sequences,possess heterochromatin marks like H3K9me3 and H3K9me2,and overlap with the late replicating regions of DNA duringS phase (Guelen et al., 2008; Collas et al., 2019; Sivakumaret al., 2019). Dynamic interactions of chromatin with thenuclear lamina-associated protein complexes provide ways ofradially repositioning chromatin in the nucleus (Reddy et al.,2008; Solovei et al., 2013; Gordon et al., 2015; Kind et al.,2015). Knockout of the proteins of the nuclear lamina ledto condensation of heterochromatin in the nuclear interior(Solovei et al., 2013). Knockdown of the lamina protein emerinresulted in chromosome repositioning inside the nucleus andreduction in H3K9me3 levels and distribution (Le et al., 2016;Ranade et al., 2019). Earlier, we demonstrated an increase in theactivity of caspase-3 after irradiation of lymphocytes at a doseof 10 cGy. Caspase-3 activity inhibition abolishes the observedtranslocations of the 1q12 loci in the irradiated human cells(Ermakov et al., 2009a). One cannot exclude that the proteaseactivity of caspase-3 is necessary for the observed structuralrearrangement of chromatin on exposure to IR. Caspase-3may participate in freeing 1q12 loci from the connection withthe nuclear lamina.

Histone modifications might also play a role in shapingchromatin configuration. The treatment of the cells with a histonedeacetylase inhibitor resulted in the relocation of the chromatinloci from the nuclear periphery toward the center (Strasák et al.,2009). In addition, it was recently proposed that transcriptionalactivity of the genome represents the main force that changesthe radial chromatin configuration in the nucleus (Cook andMarenduzzo, 2018). Some authors believe that the mechanismsof chromatin configuration change involve a phase separationprocess, which has been shown to be implicated in the formationof heterochromatin and in driving the transition of euchromatinto heterochromatin (Larson et al., 2017; Strom et al., 2017).

Domain 1q12 transposition is an important component ofthe adaptive cellular response to oxidative stress induced by IR.The absence of 1q12 displacement is associated with AR blockand increased cell death under stronger exposure. Previously,we observed 1q12 displacement block in lymphocytes of breastcancer patients with a BRCA1 gene mutation (Spitkovskii et al.,2003) and in 1q12 polyploid primary stem cancer cells of thebreast tumor (Ermakov et al., 2009b). The primary cancer cellpopulation at the beginning of cultivation contained 70% ofcells with a polyploid 1q12 loci set (data are given in theSupplementary Material). In polyploid set cells, 1q12 did notmove in response to irradiation. The loci were “bound” to thenucleus membrane. During long-term cultivation, these cells diedfirst, and the population was enriched with cells with a normal1q12 diploid set, which is in response to irradiation-transposed1q12 loci from the periphery to the nucleus center.

In a study of a high radiation dose (10 Gy) effect on thetriploid by 1q fragment content cells of the Hela cancer line,the authors found an increase in the content of 1q fragment inthe nuclei on the fifth day (Schwarz-Finsterle et al., 2013). Withlonger cultivation, the survival advantage was found in cells withreduced 1q fragments content. One of the reasons for increased

Frontiers in Cell and Developmental Biology | www.frontiersin.org 12 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 13

Konkova et al. Large 1q12 Blocks Adaptive Response

survival may be the ability of these cells to proliferate and respondadaptively, in contrast to cells with a high 1q content.

Previously, we considered domain 1q12 translocation inresponse to low-dose IR only as a marker that reflects achange in the nucleus architecture for genome expression profilemodulation in response to the damage. In this paper, for the firsttime, we analyzed the possible active role of the 1q12 domain sizein the process of nucleus architecture changes in stress response.We studied two types of the cells: spherical lymphocyte nuclei,which may be placed randomly on the slide, and ellipsoid MSCnuclei, which occupy a fixed position on the carrier. In bothcases, we found a similar effect: in response to ROS, only 1q12domains of relatively small size moved to the nucleus center fromthe nuclear envelope (Figures 2, 5).

Ribosomal repeat is also represented in the human genomeby a large number of copies. In our sample, the rDNA contentranged from 3 to 11 pg/ng DNA (Chestkov et al., 2018a;Malinovskaya et al., 2018). In the absence of stress in theinterphase nucleus, rDNA copies are located compactly in thenucleolus in the central nucleus regions. In response to stress, thearea occupied by rDNA may increase several times. We observedan increase in the NOR area in response to stress for humanlymphocytes (Ermakov et al., 2009a, 2013) and endothelial cells(Ermakov et al., 2011).

In irradiated cells, two large domains (nucleolus and 1q12heterochromatin) seemingly move toward each other andare localized in the spherical ring area with a radius ofabout 0.5–0.6 of the nucleus radius. Some other researchers’data show the rDNA and 1q12 loci interaction in theinterphase nuclei. It was shown that 1q12 regions contributeto the perinucleolar chromatin. During the cell cycle, theheterochromatic band 1q12 is dynamically rearranged withregard to the nucleoli. A relationship between the associationof the chromosome 1 pericentromeric region with nucleoli andthe nuclear transcriptional activity was suggested (Léger et al.,1994). These facts are confirmed by the other authors, who haveshown the emergence of numerous new contacts of rDNA with1q12 region, under cellular stress (Tchurikov et al., 2019). Thenucleolus and 1q12 domain convergence also occurs due to asignificant increase in the nucleolus area and the nucleolus’snumber (Figure 4). Presumably, the large-volume 1q12 domainwill not be able to move from the membrane to the desirednucleus sector, and the chromatin transformations necessary tochange the genome expression profile in response to stress arenot implemented. If the nucleolus is very large (e.g., the genomecontains many rDNA copies) and occupies a large nucleusvolume, then the requirement for the 1q12 domain size increases.Only small-sized 1q12 loci will be able to localize in the “right”nucleus sector. Thus, it can be assumed that, in the cell, there is abalance between the sizes of rDNA clusters and the sizes of 1q12heterochromatin region. Disruption of this balance may lead toabnormal cell functioning.

Figure 6A summarizes the facts obtained in the study.Consider a population of cells that are heterogeneous in termsof f-SatIII DNA content. Cells with a low repeat number (small1q12 domain size) are able to proliferate and develop an adaptivestress response. Both processes require 1q12 movement in the

nucleus and bringing it closer to the nucleolus that increaseswith stress response or a proliferative stimulus. The AR increasesthe cells’ resistance to stress (Sokolov and Neumann, 2015;Sisakht et al., 2020). Thus, cells with a low f-SatIII content havea large proliferative potential and genotoxic stress resistance(Ershova et al., 2019c).

The transition of satellite III heterochromatin to euchromatinand the activation of the satellite transcription occurs in somecells (Figure 3). This process leads to the f-SatIII content increasein the cell’s DNA (Bersani et al., 2015), and these cells replenishthe cells fraction with a large f-SatIII repeat size. Cells with a highf-SatIII content accumulate in the population during natural andreplicative aging (Ershova et al., 2019c) and under low IR doses(Figure 5D). Such cells are not able to proliferate and die undermore intense exposure being not capable to an AR.

White Blood Cells of SZ Patients Show aResponse Comparable to the Low-DoseIR Effect on Healthy CellsSchizophrenia is considered as a systemic disorder (Kirkpatrick,2009). The available biomaterial studies, e.g., of blood leukocytes,helps to understand the possible disease mechanisms (Chan et al.,2011; Lai et al., 2016; Sabherwal et al., 2016; Perkovic et al.,2017). Oxidative stress and declined antioxidant statuses in thebrain and peripheral tissues of the SZ patients have been reported(Barron et al., 2017; Maas et al., 2017; Patel et al., 2017).

Analysis of rDNA and f-SatIII CNVs in the blood leukocytesearlier revealed an interesting effect in SZ patients. The patientshave significantly more rDNA copies than HC (Veiko et al., 2003;Chestkov et al., 2018a). In contrast, the f-SatIII repeat content inthe SZ patients’ leukocytes is significantly lower compared to theHC (Kosower et al., 1995; Ershova et al., 2019a). The results of thepresent study may explain these facts (Figure 6B).

The lymphocytes isolated from the blood of SZ patientshave activation signs typical also for control lymphocytesirradiated with low-dose IR (Figures 1–4). Small-sized 1q12domains translocated to the central nucleus area; the nucleolioccupied a large area and approached the 1q12 region. SZpatients’ lymphocytes activation has been repeatedly describedin a number of papers (Hirata-Hibi et al., 1982; Kloukina-Pantazidou et al., 2010; Uranova et al., 2017). Some authorshave described the nucleolus increase (Uranova et al., 2017). Itmay be assumed that in the patients’ organism oxidative stresschronically stimulates an AR for reparative, antioxidative, andantiapoptotic systems activation. The source of oxidative stress inSZ is not yet reliably determined, but its intensity is comparableto the effect of low-dose IR. Earlier, in a third of SZ patients, wedescribed an AR that allows survival of cells with damaged DNA.We also found a significant increase in cell death in patients,indicated by abnormally high amounts of cfDNA and increasedendonuclease blood plasma activity (Ershova et al., 2017, 2019b).

Perhaps, in the patients’ organism, the process of bloodcells selection by the f-SatIII repeat content is significantlyaccelerated in comparison with the control. A similar process wasobserved during long-term irradiated healthy donor lymphocytescultivation (Figure 2D). An additional factor of cells selection

Frontiers in Cell and Developmental Biology | www.frontiersin.org 13 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 14

Konkova et al. Large 1q12 Blocks Adaptive Response

FIGURE 6 | (A) Scheme showing a change in the content of f-SatIII in a cell population under stress. A detailed description is given in the text. (B) Illustration off-SatIII and rDNA tandem repeats sizes in HC and SZ groups.

with only a low f-SatIII amount is the large size of thenucleolus that contains more rDNA than the control cellsnucleolus. It is assumed that rDNA in the nucleus stabilizesheterochromatin regions (Paredes and Maggert, 2009). A largerDNA amount shifts the heterochromatin–euchromatin balancetoward heterochromatin. It has also been shown that a changein the rDNA clusters size leads to a significant change in theexpression profile of many genes located at a significant distancefrom the rDNA (Paredes et al., 2011).

Thus, the low f-SatIII content in white blood cells DNA of SZpatients may be explained by three reasons:

(1) Large rDNA cluster sizes stabilize 1q12 heterochromatin,reducing the satellite transcription intensity thatcontributes to f-SatIII content increase.

(2) Chronic oxidative stress induces an AR only in cells with alow f-SatIII content.

(3) Cells with a high f-SatIII content, in which the AR isblocked, are less resistant to damage effects and die.

Processes leading to f-SatIII content (1q12 region size)changes in blood cells also occur in the SZ patients’ brain cells.We have shown that the f-SatIII repeat content varies significantlyin eight different brain structures of the SZ patient (Ershovaet al., 2019a). Regions with a high f-SatIII repeat content atthe same time contained lower amounts of telomeric repeat.The accumulation of brain cells with a high f-SatIII content,apparently, may change the normal functional activity of variousbrain structures cells.

Further research is needed to explain the combination ofhigh rDNA and low f-SatIII in the genomes of SZ patients. Inparticular, it would be important to get answers to the followingquestions:

1. Are very large rDNA CN in the human genome capable ofblocking the heterochromatin–euchromatin transition inthe 1q12 region that we detect with the f-SatIII probe? Itis interesting to compare the RNA SATIII synthesis duringresponse of cells with different combinations of f-SatIII and

Frontiers in Cell and Developmental Biology | www.frontiersin.org 14 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 15

Konkova et al. Large 1q12 Blocks Adaptive Response

rDNA CN to replicative aging and genotoxic stress. Itis also important to compare RNA SATIII transcriptionlevels in the genomes of SZ patients and controlpersons with different combinations of f-SatIII and rDNACN indices.

2. How is the variation in the two repeats content in differenthuman brain cells associated with pathology? What is thedifference of repeats content in the brain cells betweenmentally healthy and SZ suffering people?

3. What other diseases may be associated with a particularf-SatIII and rDNA CN combination? Most likely, it may besome multifactorial diseases. Perhaps, some diseases maymanifest (or not manifest) itself only in case of a specificcombination of the two repeats content.

4. Does the rDNA content in the human cell genome correlatewith the content of other genome satellite repeats that areable to be transcribed?

CONCLUSION

When a cell population responds to stress, cells are selectedaccording to the size of the 1q12 domain (according tothe content of the f-SatIII repeat). The low content ofthe f-SatIII repeat in SZ patients may be a consequenceof the chronic oxidative stress and of a large copies number ofthe ribosomal repeats.

DATA AVAILABILITY STATEMENT

All datasets generated for this study are included in thearticle/Supplementary Material.

ETHICS STATEMENT

The investigation was carried out in accordance with the latestversion of the Declaration of Helsinki and was approved by theRegional Ethics Committees of RCMG, CPH1, and MHRC. Allparticipants signed an informed written consent to participateafter the procedures had been completely explained.

AUTHOR CONTRIBUTIONS

SVK, SIK, and NV designed the study. NZ and GK examined andselected patients for the study, performed analysis using a scalePANSS, and provided the human blood samples. EE, MK, ES,EM, GS, AM, and VI performed the experiments. RV performedthe statistical analysis and created a computer database for SZand HC groups and programs “Imager 7.0.” and “Ellipse.” SVK,PU, and NV wrote the initial draft and translated the manuscriptto English. All the authors participated in critical revision andapproved the manuscript before submission.

FUNDING

The Russian Science Foundation (Grant No. 18-15-00437)supported this research.

SUPPLEMENTARY MATERIAL

The Supplementary Material for this article can be found onlineat: https://www.frontiersin.org/articles/10.3389/fcell.2020.00386/full#supplementary-material

REFERENCESAbdel-Halim, H. I., Imam, S. A., Badr, F. M., Natarajan, A. T., Mullenders,

L. H., and Boei, J. J. (2004). Ionizing radiation-induced instant pairing ofheterochromatin of homologous chromosomes in human cells. Cytogenet.Genome Res. 104, 193–199. doi: 10.1159/000077488

Barron, H., Hafizi, S., Andreazza, A. C., and Mizrahi, R. (2017).Neuroinflammation and oxidative stress in psychosis and psychosis risk.Int. J. Mol. Sci. 18:E651. doi: 10.3390/ijms18030651

Bersani, F., Lee, E., Kharchenko, P. V., Xu, A. W., Liu, M., Xega, K., et al.(2015). Pericentromeric satellite repeat expansions through RNA-derived DNAintermediates in cancer. Proc. Natl. Acad. Sci. U.S.A. 112, 15148–15153. doi:10.1073/pnas.1518008112

Black, E. M., and Giunta, S. (2018). Repetitive fragile sites: centromere satelliteDNA as a source of genome instability in human diseases. Genes 9:E615. doi:10.3390/genes9120615

Boyum, A. (1968). Separation of leukocytes from blood and bone marrow. Scand.J. Clin. Lab. Investig. 21, 90–109.

Brahmachary, M., Guilmatre, A., Quilez, J., Hasson, D., Borel, C., Warburton, P.,et al. (2014). Digital genotyping of macrosatellites and multicopy genes revealsnovel biological functions associated with copy number variation of largetandem repeats. PLoS Genet. 10:e1004418. doi: 10.1371/journal.pgen.1004418

Cardno, A. G., Marshall, E. J., Coid, B., Macdonald, A. M., Ribchester, T. R., Davies,N. J., et al. (1999). Heritability estimates for psychotic disorders: the Maudsleytwin psychosis series. Arch. Gen. Psychiatry 56, 162–168. doi: 10.1001/archpsyc.56.2.162

Chan, M. K., Guest, P. C., Levin, Y., Umrania, Y., Schwarz, E., Bahn, S., et al.(2011). Converging evidence of blood-based biomarkers for schizophrenia: anupdate. Int. Rev. Neurobiol. 101, 95–144. doi: 10.1016/B978-0-12-387718-5.00005-5

Chestkov, I. V., Jestkova, E. M., Ershova, E. S., Golimbet, V. E., Lezheiko, T. V.,Kolesina, N. Y., et al. (2018a). Abundance of ribosomal RNA gene copies in thegenomes of schizophrenia patients. Schizophr. Res. 197, 305–314. doi: 10.1016/j.schres.2018.01.001

Chestkov, I. V., Jestkova, E. M., Ershova, E. S., Golimbet, V. G., Lezheiko, T. V.,Yu, N., et al. (2018b). ROS-induced DNA damage associates with abundanceof mitochondrial DNA in white blood cells of the untreated schizophrenicpatients. Oxid. Med. Cell. Longev. 2018:8587475. doi: 10.1155/2018/8587475

Collas, P., Liyakat Ali, T. M., Brunet, A., and Germier, T. (2019). Finding friendsin the crowd: three-dimensional cliques of topological genomic domains. Front.Genet. 10:602. doi: 10.3389/fgene.2019.00602

Conrad, D. F., Pinto, D., Redon, R., Feuk, L., Gokcumen, O., Zhang, Y., et al. (2010).Origins and functional impact of copy number variation in the human genome.Nature 464, 704–712. doi: 10.1038/nature08516

Cook, P. R., and Marenduzzo, D. (2018). Transcription-driven genomeorganization: a model for chromosome structure and the regulation of geneexpression tested through simulations. Nucleic Acids Res. 46, 9895–9906. doi:10.1093/nar/gky763

Cooke, H. J., and Hindley, J. (1979). Cloning of human satellite III DNA: differentcomponents are on different chromosomes. Nucleic Acids Res. 6, 3177–3197.doi: 10.1093/nar/6.10.3177

Frontiers in Cell and Developmental Biology | www.frontiersin.org 15 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 16

Konkova et al. Large 1q12 Blocks Adaptive Response

Croft, J. A., Bridger, J. M., Boyle, S., Perry, P., Teague, P., and Bickmore, W. A.(1999). Differences in the localization and morphology of chromosomes in thehuman nucleus. J. Cell Biol. 145, 1119–1131. doi: 10.1083/jcb.145.6.1119

de Koning, A. P., Gu, W., Castoe, T. A., Batzer, M. A., and Pollock, D. D. (2011).Repetitive elements may comprise over two-thirds of the human genome. PLoSGenet. 7:e1002384. doi: 10.1371/journal.pgen.1002384

Dolling, J. A., Boreham, D. R., Brown, D. L., Raaphorst, G. P., and Mitchel, R. E.(1997). Rearrangement of human cell homologous chromosome domains inresponse to ionizing radiation. Int. J. Radiat. Biol. 72, 303–311. doi: 10.1080/095530097143293

Dumbovic, G., Forcales, S. V., and Perucho, M. (2017). Emerging roles ofmacrosatellite repeats in genome organization and disease development.Epigenetics 12, 515–526. doi: 10.1080/15592294.2017.1318235

Enukashvily, N. I., Donev, R., Waisertreiger, I. S., and Podgornaya, O. I. (2007).Human chromosome 1 satellite 3 DNA is decondensed, demethylated andtranscribed in senescent cells and in A431 epithelial carcinoma cells. Cytogenet.Genome. Res 118, 42–54. doi: 10.1159/000106440

Ermakov, A. V., Konkova, M. S., Kostyuk, S. V., Egolina, N. A., Efremova, L. V., andVeiko, N. N. (2009a). Oxidative stress as a significant factor for developmentof an adaptive response in irradiated and nonirradiated human lymphocytesafter inducing the bystander effect by low-dose X-radiation. Mutat. Res. 669,155–161. doi: 10.1016/j.mrfmmm.2009.06.005

Ermakov, A. V., Kon’kova, M. S., Kostiuk, S. V., Ershova, E. S., Smirnova, T. D.,Kameneva, L. V., et al. (2009b). [The response of human cancer stem cells onlow-dose X-ray exposure]. Radiats. Biol. Radioecol. 49, 528–537.

Ermakov, A. V., Konkova, M. S., Kostyuk, S. V., Izevskaya, V. L., Baranova, A., andVeiko, N. N. (2013). Oxidized extracellular DNA as a stress signal in humancells. Oxid. Med. Cell Longev. 2013:649747. doi: 10.1155/2013/649747

Ermakov, A. V., Konkova, M. S., Kostyuk, S. V., Smirnova, T. D., Malinovskaya,E. M., Efremova, L. V., et al. (2011). An extracellular DNA mediated bystandereffect produced from low dose irradiated endothelial cells. Mutat. Res. 712,1–10. doi: 10.1016/j.mrfmmm.2011.03.002

Ershova, E. S., Jestkova, E. M., Chestkov, I. V., Porokhovnik, L. N., Izevskaya, V. L.,Kutsev, S. I., et al. (2017). Quantification of cell-free DNA in blood plasma andDNA damage degree in lymphocytes to evaluate dysregulation of apoptosis inschizophrenia patients. J. Psychiatr. Res. 87, 15–22. doi: 10.1016/j.jpsychires.2016.12.006

Ershova, E. S., Konkova, M. S., Malinovskaya, E. M., Kutsev, S. I., Veiko, N. N.,Kostyuk, S. V., et al. (2020). Noncanonical functions of the human ribosomalrepeat. Russian J. Genet. 56, 30–40. doi: 10.1134/S1022795420010044

Ershova, E. S., Agafonova, O. N., Zakharova, N. V., Bravve, L. V., Jestkova, E. M.,Golimbet, V. E., et al. (2019a). Copy number variation of satellite III (1q12)in patients with schizophrenia. Front. Genet. 10:1132. doi: 10.3389/fgene.2019.01132

Ershova, E. S., Jestkova, E. M., Martynov, A. V., Shmarina, G. V., Umriukhin, P. E.,Bravve, L. V., et al. (2019b). Accumulation of circulating cell-free CpG-enrichedribosomal DNA fragments on the background of high endonuclease activityof blood plasma in schizophrenic patients. Int. J. Genomics 2019:8390585. doi:10.1155/2019/8390585

Ershova, E. S., Malinovskaya, E. M., Konkova, M. S., Veiko, R. V., Umriukhin,P. E., Martynov, A. V., et al. (2019c). Copy number variation of humansatellite III (1q12) with aging. Front. Genet. 10:704. doi: 10.3389/fgene.2019.00704

Freeman, J. L., Perry, G. H., Feuk, L., Redon, R., McCarroll, S. A., Altshuler, D. M.,et al. (2006). Copy number variation: new insights in genome diversity. GenomeRes. 16, 949–961. doi: 10.1101/gr.3677206

Gordon, M. R., Pope, B. D., Sima, J., and Gilbert, D. M. (2015). Many paths leadchromatin to the nuclear periphery. Bioessays 37, 862–866. doi: 10.1002/bies.201500034

Guelen, L., Pagie, L., Brasset, E., Meuleman, W., Faza, M. B., Talhout, W., et al.(2008). Domain organization of human chromosomes revealed by mapping ofnuclear lamina interactions. Nature 453, 948–951. doi: 10.1038/nature06947

Hannan, A. J. (2018). Tandem repeats mediating genetic plasticity in health anddisease. Nat. Rev. Genet. 19, 286–298. doi: 10.1038/nrg.2017.115

Henrichsen, C. N., Chaignat, E., and Reymond, A. (2009). Copy number variants,diseases and gene expression. Hum. Mol. Genet. 18, R1–R8. doi: 10.1093/hmg/ddp011

Hirata-Hibi, M., Higashi, S., Tachibana, T., and Watanabe, N. (1982). Stimulatedlymphocytes in schizophrenia. Arch. Gen. Psychiatry 39, 82–87. doi: 10.1001/archpsyc.1982.04290010058011

Howell, W. M., and Black, D. A. (1980). Controlled silver-staining of nucleolusorganizer regions with a protective colloidal developer: a 1-step method.Experientia 36, 1014–1015. doi: 10.1007/bf01953855

Howes, O. D., and Murray, R. M. (2014). Schizophrenia: an integrated sociodevelopmental-cognitive model. Lancet 383, 1677–1687.

Iafrate, A. J., Feuk, L., Rivera, M. N., Listewnik, M. L., Donahoe, P. K., Qi, Y., et al.(2004). Detection of large-scale variation in the human genome. Nat. Genet. 36,949–951. doi: 10.1038/ng1416

Jackson, M., Marks, L., May, G. H. W., and Wilson, J. B. (2018). The genetic basisof disease. Essays Biochem. 62, 643–723. doi: 10.1042/EBC20170053

Kind, J., Pagie, L., de Vries, S. S., Nahidiazar, L., Dey, S. S., Bienko, M., et al. (2015).Genome-wide maps of nuclear lamina interactions in single human cells. Cell163, 134–147. doi: 10.1016/j.cell.2015.08.040

Kirkpatrick, B. (2009). Schizophrenia as a systemic disease. Schizophr. Bull. 35,381–382. doi: 10.1093/schbul/sbn183

Kloukina-Pantazidou, I., Havaki, S., Chrysanthou-Piterou, M., Kontaxakis, V. P.,Papadimitriou, G. N., and Issidorides, M. R. (2010). Chromatin alterationsin leukocytes of first-episode schizophrenic patients. Ultrastruct. Pathol. 34,106–116. doi: 10.3109/01913121003644781

Korzeneva, I. B., Kostuyk, S. V., Ershova, E. S., Osipov, A. N., Zhuravleva, V. F.,Pankratova, G. V., et al. (2015). Human circulating plasma DNA significantlydecreases while lymphocyte DNA damage increases under chronic occupationalexposure to low-dose gamma-neutron and tritium β-radiation. Mutat. Res. 779,1–15. doi: 10.1016/j.mrfmmm.2015.05.004

Korzeneva, I. B., Kostuyk, S. V., Ershova, E. S., Skorodumova, E. N., Zhuravleva,V. F., Pankratova, G. V., et al. (2016). Human circulating ribosomal DNAcontent significantly increases while circulating satellite III (1q12) contentdecreases under chronic occupational exposure to low-dose gamma-neutronand tritium beta-radiation. Mutat. Res. 791–792, 49–60. doi: 10.1016/j.mrfmmm.2016.09.001

Kosower, N. S., Gerad, L., Goldstein, M., Parasol, N., Zipser, Y., Ragolsky, M., et al.(1995). Constitutive heterochromatin of chromosome 1 and Duffy blood groupalleles in schizophrenia. Am. J. Med. Genet. 60, 133–138. doi: 10.1002/ajmg.1320600209

Lai, C. Y., Scarr, E., Udawela, M., Everall, I., Chen, W. J., and Dean, B.(2016). Biomarkers in schizophrenia: a focus on blood based diagnostics andtheranostics. World J. Psychiatry 6, 102–117. doi: 10.5498/wjp.v6.i1.102

Larson, A. G., Elnatan, D., Keenen, M. M., Trnka, M. J., Johnston, J. B., Burlingame,A. L., et al. (2017). Liquid droplet formation by HP1α suggests a role for phaseseparation in heterochromatin. Nature 547, 236–240. doi: 10.1038/nature22822

Le, H. Q., Ghatak, S., Yeung, C. Y., Tellkamp, F., Günschmann, C., Dieterich,C., et al. (2016). Mechanical regulation of transcription controls Polycomb-mediated gene silencing during lineage commitment. Nat. Cell Biol. 18, 864–875. doi: 10.1038/ncb3387

Léger, I., Guillaud, M., Krief, B., and Brugal, G. (1994). Interactive computer-assisted analysis of chromosome 1 colocalization with nucleoli. Cytometry 16,313–323.

Loseva, P., Kostyuk, S., Malinovskaya, E., Clement, N., Dechesne, C. A., Dani, C.,et al. (2012). Extracellular DNA oxidation stimulates activation of NRF2 andreduces the production of ROS in human mesenchymal stem cells. Expert Opin.Biol. Ther. 12(Suppl. 1), S85–S97. doi: 10.1517/14712598.2012.688948

Lower, S. S., McGurk, M. P., Clark, A. G., and Barbash, D. A. (2018). SatelliteDNA evolution: old ideas, new approaches. Curr. Opin. Genet. Dev. 49, 70–78.doi: 10.1016/j.gde.2018.03.003

Maas, D. A., Vallès, A., and Martens, G. J. M. (2017). Oxidative stress, prefrontalcortex hypomyelination and cognitive symptoms in schizophrenia. Transl.Psychiatry 7:e1171. doi: 10.1038/tp.2017.138

Malinovskaya, E. M., Ershova, E. S., Golimbet, V. E., Porokhovnik, L. N.,Lyapunova, N. A., Kutsev, S. I., et al. (2018). Copy number of human ribosomalgenes with aging: unchanged mean, but narrowed range and decreased variancein elderly group. Front. Genet. 9:306. doi: 10.3389/fgene.2018.00306

Metz, A., Soret, J., Vourc’h, C., Tazi, J., and Jolly, C. (2004). A key role forstressinduced satellite III transcripts in the relocalization of splicing factors intonuclear stress granules. J. Cell Sci. 117, 4551–4558. doi: 10.1242/jcs.01329

Frontiers in Cell and Developmental Biology | www.frontiersin.org 16 June 2020 | Volume 8 | Article 386

fcell-08-00386 June 3, 2020 Time: 18:45 # 17

Konkova et al. Large 1q12 Blocks Adaptive Response

Monlong, J., Cossette, P., Meloche, C., Rouleau, G., Girard, S. L., and Bourque,G. (2018). Human copy number variants are enriched in regions of lowmappability. Nucleic Acids Res. 46, 7236–7249. doi: 10.1093/nar/gky538

Paredes, S., Branco, A. T., Hartl, D. L., Maggert, K. A., and Lemos, B. (2011).Ribosomal DNA deletions modulate genome-wide gene expression: “rDNA-sensitive” genes and natural variation. PLoS Genet. 7:e1001376. doi: 10.1371/journal.pgen.1001376

Paredes, S., and Maggert, K. A. (2009). Ribosomal DNA contributes to globalchromatin regulation. Proc. Natl. Acad. Sci. U.S.A. 106, 17829–17834. doi: 10.1073/pnas.0906811106

Patel, S., Sharma, D., Kalia, K., and Tiwari, V. (2017). Crosstalk betweenendoplasmic reticulum stress and oxidative stress in schizophrenia: the dawnof new therapeutic approaches. Neurosci. Biobehav. Rev. 83, 589–603. doi: 10.1016/j.neubiorev.2017.08.025

Perkovic, M. N., Erjavec, G. N., Strac, D. S., Uzun, S., Kozumplik, O., and Pivac,N. (2017). Theranostic biomarkers for schizophrenia. Int. J. Mol. Sci. 18:E733.doi: 10.3390/ijms18040733

Ranade, D., Pradhan, R., Jayakrishnan, M., Hegde, S., and Sengupta, K. (2019).Lamin A/C and Emerin depletion impacts chromatin organization anddynamics in the interphase nucleus. BMC Mol. Cell. Biol. 20:11. doi: 10.1186/s12860-019-0192-5

Reddy, K. L., Zullo, J. M., Bertolino, E., and Singh, H. (2008). Transcriptionalrepression mediated by repositioning of genes to the nuclear lamina. Nature452, 243–247. doi: 10.1038/nature06727

Redon, R., Ishikawa, S., Fitch, K. R., Feuk, L., Perry, G. H., Andrews, T. D., et al.(2006). Global variation in copy number in the human genome. Nature 444,444–454. doi: 10.1038/nature05329

Sabherwal, S., English, J. A., Föcking, M., Cagney, G., and Cotter, D. R. (2016).Blood biomarker discovery in drug-free schizophrenia: the contributionofproteomics and multiplex immunoassays. Expert Rev. Proteomics 13, 1141–1155. doi: 10.1080/14789450.2016.1252262

Schwarz-Finsterle, J., Scherthan, H., Huna, A., González, P., Mueller, P., Schmitt,E., et al. (2013). Volume increase and spatial shifts of chromosome territories innuclei of radiation-induced polyploidizing tumour cells. Mutat. Res. 756, 56–65.doi: 10.1016/j.mrgentox.2013.05.004

Sebat, J., Lakshmi, B., Troge, J., Alexander, J., Young, J., Lundin, P., et al. (2004).Large-scale copy number polymorphism in the human genome. Science 305,525–528. doi: 10.1126/science.1098918

Sisakht, M., Darabian, M., Mahmoodzadeh, A., Bazi, A., Shafiee, S. M., Mokarram,P., et al. (2020). The role of radiation induced oxidative stress as a regulator ofradio-adaptive responses. Int. J. Radiat. Biol. 7, 1–16. doi: 10.1080/09553002.2020.1721597

Sivakumar, A., de Las Heras, J. I., and Schirmer, E. C. (2019). Spatial genomeorganization: from development to disease. Front. Cell Dev. Biol. 7:18. doi:10.3389/fcell.2019.00018

Skalníková, M., Kozubek, S., Lukásová, E., Bártová, E., Jirsová, P., Cafourková, A.,et al. (2000). Spatial arrangement of genes, centromeres and chromosomes inhuman blood cell nuclei and its changes during the cell cycle, differentiation andafter irradiation. Chromosome Res. 8, 487–499. doi: 10.1023/a:1009267605580

Sokolov, M., and Neumann, R. (2015). Global gene expression alterations as acrucial constituent of human cell response to low doses of ionizing radiationexposure. Int. J. Mol. Sci. 17:E55. doi: 10.3390/ijms17010055

Solovei, I., Wang, A. S., Thanisch, K., Schmidt, C. S., Krebs, S., Zwerger,M., et al. (2013). LBR and lamin A/C sequentially tether peripheralheterochromatin and inversely regulate differentiation. Cell 152, 584–598. doi:10.1016/j.cell.2013.01.009

Speranskii, A. I, Kostyuk, S. V., and Kalashnikova, E. A. (2015). Erichment ofextracellular DNA from the cultivation medium of human peripheral bloodmononuclears with Genomic CpG rich fragments results in increased cellproduction of IL-6 and TNFα via activation of the NF-κB signaling pathway.Biochem. Moscow Suppl. Ser. B 9, 174–184. doi: 10.1134/S1990750815020122

Spitkovskii, D. M., Veiko, N. N., Ermakov, A. V., Kuz’mina, I. V., Makarenkov,A. S., Salimov, A. G., et al. (2003). [Structural and functional changing inducedby exposure to adaptive doses of X-rays in the human lymphocytes bothnormal and defective by reparation of DNA double strands breaks].Radiat. Biol.Radioecol. 43, 136–143.

Strasák, L., Bártová, E., Harnicarová, A., Galiová, G., Krejcí, J., and Kozubek, S.(2009). H3K9 acetylation and radial chromatin positioning. J. Cell. Physiol. 220,91–101. doi: 10.1002/jcp.21734

Strom, A. R., Emelyanov, A. V., Mir, M., Fyodorov, D. V., Darzacq, X., and Karpen,G. H. (2017). Phase separation drives heterochromatin domain formation.Nature 547, 241–245. doi: 10.1038/nature22989

Tchurikov, N. A., Fedoseeva, D. M., Klushevskaya, E. S., Slovohotov, I. Y.,Chechetkin, V. R., Kravatsky, Y. V., et al. (2019). rDNA clusters makecontact with genes that are involved in differentiation and cancer andchange contacts after heat shock treatment. Cells 11:1393. doi: 10.3390/cells8111393

Uranova, N. A., Bonartsev, P. D., Androsova, L. V., Rakhmanova, V. I., and Kaleda,V. G. (2017). Impaired monocyte activation in schizophrenia: ultrastructuralabnormalities and increased IL-1β production. Eur. Arch. Psychiatry Clin.Neurosci. 267, 417–426. doi: 10.1007/s00406-017-0782-1

Valgardsdottir, R., Chiodi, I., Giordano, M., Rossi, A., Bazzini, S., Ghigna, C.,et al. (2008). Transcription of Satellite III non-coding RNAs is a general stressresponse in human cells. Nucleic Acids Res. 36, 423–434. doi: 10.1093/nar/gkm1056

Veiko, N. N., Egolina, N. A., Radzivil, G. G., Nurbaev, S. D., Kosyakova,N. V., Shubaeva, N. O., et al. (2003). Quantitative analysis of repetitivesequences in human genomic DNA and detection of an elevated ribosomalrepeat copy number in patients with schizophrenia (the results of molecularand cytogenetic analysis). Mol. Biol. 37, 349–357. doi: 10.1023/A:1024274924381

Veiko, N. N., Kalashnikova, E. A., Kokarovtseva, S. N., Kostyuk, S. V.,Ermakov, A. V., Ivanova, S. M., et al. (2006). Stimulatory effect of fragmentsfrom transcribed region of ribosomal repeat on human peripheral bloodlymphocytes. Bull. Exp. Biol. Med. 142, 428–432. doi: 10.1007/s10517-006-0384-9

Warburton, P. E., Hasson, D., Guillem, F., Lescale, C., Jin, X., and Abrusan, G.(2008). Analysis of the largest tandemly repeated DNA families in the humangenome. BMC Genomics 9:533. doi: 10.1186/1471-2164-9-533

Conflict of Interest: The authors declare that the research was conducted in theabsence of any commercial or financial relationships that could be construed as apotential conflict of interest.

Copyright © 2020 Konkova, Ershova, Savinova,Malinovskaya, Shmarina,Martynov,Veiko, Zakharova, Umriukhin, Kostyuk, Izhevskaya, Kutsev, Veiko and Kostyuk.This is an open-access article distributed under the terms of the Creative CommonsAttribution License (CC BY). The use, distribution or reproduction in other forumsis permitted, provided the original author(s) and the copyright owner(s) are creditedand that the original publication in this journal is cited, in accordance with acceptedacademic practice. No use, distribution or reproduction is permitted which does notcomply with these terms.

Frontiers in Cell and Developmental Biology | www.frontiersin.org 17 June 2020 | Volume 8 | Article 386