Upload
hoangdung
View
216
Download
1
Embed Size (px)
Citation preview
1
Submitted to Applied and Environmental Microbiology 1
2
Unique plasmids generated via pUC replicon mutagenesis in an error-prone thermophile 3
derived from Geobacillus kaustophilus HTA426 4
5
Jyumpei Kobayashi,1,2 Misaki Tanabiki,1 Shohei Doi,1 Akihiko Kondo,3 Takashi Ohshiro,1 6
and Hirokazu Suzuki1,2,# 7
8 1Department of Chemistry and Biotechnology, Graduate School of Engineering, Tottori 9
University, Tottori 680-8552, Japan 10 2Functional Genomics of Extremophiles, Faculty of Agriculture, Graduate School, Kyushu 11
University, Fukuoka 812-8581, Japan 12 3Department of Chemical Science and Engineering, Graduate School of Engineering, Kobe 13
University, Kobe, Hyogo 657-8501, Japan 14
15
Present address: Jyumpei Kobayashi, Organization of Advanced Science and Technology, Kobe 16
University, Hyogo 657-8501, Japan 17
18
19
20
Running title: pUC replicon mutagenesis in G. kaustophilus 21
22 #Correspondence to: Hirokazu Suzuki; Department of Chemistry and Biotechnology, Graduate 23
School of Engineering, Tottori University, Tottori 680-8552, Japan 24
E-mail: [email protected]; Tel.: +81 857 31 5907; Fax: +81 857 31 5907 25
AEM Accepted Manuscript Posted Online 28 August 2015Appl. Environ. Microbiol. doi:10.1128/AEM.01574-15Copyright © 2015, American Society for Microbiology. All Rights Reserved.
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
2
Abstract 26
The plasmid pGKE75-catA138T, which comprises pUC18 and the catA138T gene encoding 27
thermostable chloramphenicol acetyltransferase (CATA138T), serves as an Escherichia 28
coli–Geobacillus kaustophilus shuttle plasmid that confers moderate chloramphenicol resistance 29
on G. kaustophilus HTA426. The present study examined the thermoadaptation-directed 30
mutagenesis of pGKE75-catA138T in an error-prone thermophile, generating the mutant plasmid 31
pGKE75αβ-catA138T responsible for substantial chloramphenicol resistance at 65°C. 32
pGKE75αβ-catA138T contained no mutation in the catA138T gene but had two mutations in the pUC 33
replicon, even though the replicon has no apparent role in G. kaustophilus. Biochemical 34
characterization suggested that the efficient chloramphenicol resistance conferred by 35
pGKE75αβ-catA138T is attributable to increases in intracellular CATA138T and acetyl-coenzyme A 36
following a decrease in incomplete forms of pGKE75αβ-catA138T. The decrease in incomplete 37
plasmids may be due to optimization of plasmid replication by RNA species transcribed from the 38
mutant pUC replicon, which were actually produced in G. kaustophilus. It is noteworthy that G. 39
kaustophilus was transformed with pGKE75αβ-catA138T using chloramphenicol selection at 60°C. 40
In addition, a pUC18 derivative with the two mutations propagated in E. coli with high copy 41
number independent of culture temperature and high plasmid stability. Since these properties 42
have not been observed in known plasmids, the outcomes extend the genetic toolboxes for G. 43
kaustophilus and E. coli. 44
45
Keywords: Geobacillus kaustophilus, chloramphenicol resistance, pUC replicon, 46
thermoadaptation-directed evolution, error-prone thermophile 47
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
3
Introduction 48
ColE1-type plasmids, such as pBR322 and pUC, replicate in Escherichia coli autonomously with 49
substantial copy numbers and are extensively utilized in microbial genetic engineering. As 50
shown by pBR322 (Fig. 1), the replicon of ColE1-type plasmids generally contains genes for a 51
precursor of RNA primer (RNA II), a replication regulatory RNA (RNA I), and a replication 52
regulatory protein (Rom). The precursor RNA II is transcribed from 555 bp upstream of the 53
replication origin and adopts a stem-loop structure that forms a persistent hybrid at the origin. 54
This structure is subsequently cleaved by RNase H to serve as a primer for plasmid replication 55
(1). RNA I consists of 108 nucleotides transcribed from 445 bp upstream of the origin to near the 56
initiation site for RNA II synthesis (2–4). Because RNA I synthesis proceeds in the direction 57
opposite to that of RNA II synthesis, RNA I can hybridize to RNA II and trigger conformational 58
changes in RNA II. This event, which prevents RNA II from hybridization at the replication 59
origin, inhibits plasmid replication and decreases plasmid copy number. Plasmid replication is 60
also negatively regulated by the Rom protein (2, 5–8), which facilitates the initial interaction 61
between RNA I and RNA II. Thus, the copy number of ColE1-type plasmids is under the 62
tripartite control of RNA I, RNA II, and Rom protein. 63
Genetic alterations in or near the replicon are known to affect the copy number of 64
ColE1-type plasmids (9–12). Although the pUC plasmids are pBR322 derivatives, their replicons 65
lack rom gene and have a point mutation in the RNA II gene (Fig. 1). Consequently, pUC 66
plasmids are present in higher copy numbers than pBR322 (9). Both of the alterations are 67
essential for pUC plasmids to achieve high copy numbers; pBR322 derivatives that have either 68
the rom deletion or the point mutation show copy numbers comparable to that of pBR322 (9). It 69
is known that the copy numbers of pUC plasmids change depending on the culture temperature 70
of the host E. coli cells. This appears to arise from a temperature-dependent secondary structure 71
within RNA II (9). 72
Geobacillus kaustophilus HTA426 is an aerobic, Gram-positive, Bacillus-related 73
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
4
thermophile that had been isolated from the deep-sea sediments of the Mariana Trench (13, 14). 74
We have studied this strain as a model for Geobacillus spp., because basal genetic tools (15–18) 75
and a whole genome sequence (19) are available for this strain. In a previous study (20), we 76
constructed G. kaustophilus MK480 from the HTA426 strain by inactivating DNA repair genes 77
and demonstrated that MK480, an error-prone thermophile that exhibits frequent mutations in 78
vivo, can generate mutant genes encoding more thermostable variants than the parent enzymes 79
during periods of cell growth at high temperatures. This approach, thermoadaptation-directed 80
evolution, was further employed on the plasmid pGKE75 carrying the cat gene (pGKE75-cat; 81
Fig. 2A) (21). The cat gene encodes the chloramphenicol acetyltransferase from Staphylococcus 82
aureus (CAT), which confers chloramphenicol (Cm) resistance on host bacteria (22). pGKE75 is 83
an E. coli–G. kaustophilus shuttle plasmid that includes the pUC18 plasmid (Fig. 2B). The 84
thermoadaptation-directed evolution was performed by successive propagation of pGKE75-cat 85
in MK480 cells under growth inhibition by Cm pressure, resulting in the generation of a mutant 86
plasmid, pGKE75-catA138T, which encodes a CAT variant (CATA138T) having enhanced 87
thermostability due to an A138T amino acid replacement (21). 88
Antibiotic resistance genes are commonly used as selectable markers during complex 89
genetic modifications of microbes. However, a single kanamycin resistance gene has been the 90
only antibiotic resistance marker used in G. kaustophilus HTA426 (15–18, 20). Although cat and 91
catA138T genes may serve as selectable markers, neither pGKE75-cat nor pGKE75-catA138T 92
conferred Cm resistance on G. kaustophilus at temperatures higher than 65°C (21). Therefore, 93
this study was designed to generate catA138T mutants that function at higher temperatures via the 94
further thermoadaptation-directed evolution of pGKE75-catA138T. Here we report a new plasmid 95
that confers Cm resistance at 65°C, which was generated via unexpected mutations in the pUC 96
replicon of pGKE75-catA138T. 97
98
Materials and methods 99
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
5
Bacterial strains and media 100
G. kaustophilus strains MK242 and MK480 were previously constructed (20). Strain MK480 101
was used as an error-prone thermophile for thermoadaptation-directed evolution, and MK242 102
was used for genetic characterization because of its genetic stability. These strains were 103
essentially grown at 60°C in Luria–Bertani (LB) medium, but G. kaustophilus [pGKE75 104
derivative], where square brackets denote the plasmid-carrier state, was grown in LB medium 105
supplemented with 5 mg l−1 of kanamycin (LK5). E. coli DH5α (Takara Bio, Otsu, Japan) was 106
used for DNA manipulation. E. coli DH5α [pUC18 or pGKE75-cat derivative] and E. coli DH5α 107
[pUB307] were grown at 37°C in LB medium supplemented with ampicillin (50 mg l−1) and 108
kanamycin (25 mg l−1), respectively. 109
110
Plasmids and primers 111
Table 1 lists plasmids used, and Fig. 2 shows their structures. Primers are summarized in Table 2. 112
pGKE75-cat and pGKE75-catA138T were previously constructed (21). pUC18αβ was constructed 113
from pUC18 (Takara Bio) by site-directed mutagenesis as follows. The pUC18 replicon was 114
amplified using primers colEF1 and colER2. PCR was performed using PrimeSTAR HS DNA 115
polymerase (Takara Bio) in accordance with the manufacturer’s protocol. Using the two strands 116
of the resulting fragment (458 bp) as mutagenesis primers, pUC18 was replicated in vitro in a 117
mixture (25 µl) that contained the fragment (0.2 µg), pUC18 (0.1 µg), dNTPs (0.4 mM each), 118
1×buffer, and PrimeSTAR HS DNA polymerase (1.2 units). The reaction was performed by 17 119
cycles of 98°C for 10 s, 55°C for 10 s, and 72°C for 8.5 min. The template pUC18 was digested 120
with DpnI. Subsequently, the resulting DNA was propagated in E. coli to obtain pUC18αβ. This 121
approach was also used to construct the plasmids pUC18α, pUC18β, pUC18γ, pGKE75α-catA138T, 122
and pGKE75β-catA138T. pUC18α, pUC18β, and pUC18γ were generated from pUC18 using 123
mutagenesis primers colEF1 and colER1, colEF2 and colER2, and colEF3 and colER3, 124
respectively. pGKE75α-catA138T and pGKE75β-catA138T were generated from pGKE75-catA138T 125
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
6
using primers colEF1 and colER1, and colEF2 and colER2, respectively. 126
127
Plasmid introduction into G. kaustophilus 128
pGKE75-cat derivatives were introduced into G. kaustophilus using conjugative DNA transfer 129
from E. coli DH5α (16). G. kaustophilus was used as the DNA recipient. E. coli [pGKE75-cat 130
derivative] and E. coli [pUB307] were used as the DNA donor and conjugation helper, 131
respectively. These strains were cultured until the optical density at 600 nm (OD600) reached 0.3. 132
Cultures were then mixed and spotted on LB plates, followed by incubation at 37°C to achieve 133
conjugation. In this process, E. coli [pGKE75-cat derivative] transfers the plasmid to G. 134
kaustophilus with the mediation of E. coli [pUB307]. Subsequently, cell mixture was recovered 135
from LB plates and incubated at 60°C on LK5 plates to isolate G. kaustophilus transformants. 136
137
Thermoadaptation-directed evolution of pGKE75-catA138T 138
LK5 plates containing Cm (10 mg l−1) were used as solid media throughout this section. G. 139
kaustophilus MK480 [pGKE75-catA138T] was cultured on solid media at 60°C for 24 h. The 140
resulting cells were collected and incubated for 1 h at 30°C in the presence of 20 mM hydrogen 141
peroxide to induce mutations (cell survival rate, 1%). The surviving cells (104 cells) were 142
regrown on solid media at 60°C. This process was repeated three more times. Subsequently, cells 143
were cultivated on solid media at 60°C followed by cell collection. This process was 144
successively performed at 65°C and 70°C. Plasmid mixtures were then extracted from the 145
resultant cells and reintroduced into G. kaustophilus MK242. Transformants were incubated on 146
solid media at 65°C to obtain clones obviously resistant to Cm. pGKE75-catA138T derivatives 147
were isolated from these clones and subjected to DNA sequence analysis. 148
149
Cm resistance assay 150
G. kaustophilus MK242 [pGKE75-cat derivative] was precultured in liquid LK5. Equal volume 151
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
7
aliquots of culture were incubated at various temperatures for 24 h on LK5 plates with or without 152
Cm (5 mg l−1). The resulting colonies were counted to calculate the Cm resistance efficiency, 153
which is the ratio of Cm-resistant colonies (grown on LK5 with Cm) to the total number of 154
colonies (grown on LK5 without Cm). The efficiency was determined from four independent 155
experiments and is presented as the mean ± standard deviation (SD). 156
157
CAT activity assay 158
G. kaustophilus MK242 [pGKE75-cat derivative] was cultured at 65°C for 18 h on LK5 plates. 159
Cells were collected and suspended in buffer (50 mM potassium phosphate, pH 7.0). The 160
suspension was homogenized by sonication and then centrifuged to remove cell debris. The 161
supernatant (cell extract) was used for further analysis. The protein concentration in cell extracts 162
was analyzed using the Bradford method. CAT activity was assayed at 60°C according to an 163
established method (21). One unit was defined as the amount of enzyme that produces 1 µmol of 164
coenzyme A (CoA) per min. 165
166
Acetyl-CoA assay 167
The concentration of acetyl-CoA in cell extracts (see above) was determined using the PicoProbe 168
Acetyl-CoA Fluorometric Assay Kit (BioVision Inc., CA, USA). Data were normalized by the 169
protein concentration of cell extracts. 170
171
Assay of plasmid copy number 172
G. kaustophilus MK242 [pGKE75-cat derivative] was cultured on LK5 plates at 65°C for 18 h. E. 173
coli DH5α [pUC18 derivative] was cultured in liquid LB at 20–42°C until OD600 reached 1.0. 174
Total DNA was extracted from cells using the method of Wu and Welker (23). Plasmid copy 175
numbers of pGKE75-cat and pUC18 derivatives in total DNA were analyzed using the 176
quantitative competitive-PCR (QC-PCR) (24). The plasmid concentration was determined using 177
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
8
primers blaF and blaR, which amplify a portion of the bla gene (positions in the open reading 178
frame, 99–612; 514 bp). Artificial short fragments that consisted of positions 99–251 and 179
459–612 of the bla gene were used as competitor DNA. The chromosome concentration was 180
determined using primers to amplify a portion of the rpoA gene. Primers GKrpoAF and 181
GKrpoAR were used to amplify G. kaustophilus rpoA (positions 101–620; 520 bp). E. coli rpoA 182
(positions 87–613; 527 bp) was amplified using ECrpoAF and ECrpoA. Competitor DNA 183
consisted of positions 101–240 and 440–620 of G. kaustophilus rpoA and positions 87–249 and 184
445–613 of E. coli rpoA. QC-PCR was performed using Quick Taq HS DyeMix (Toyobo, Osaka, 185
Japan) in the presence of competitor DNA (1.0 pM–54 nM) by 30 cycles of 94°C for 30 s, 55°C 186
for 30 s, and 68°C for 1 min. The products were separated by agarose gel electrophoresis and 187
visualized using ethidium bromide. DNA bands were quantified using the ImageJ program 188
(http://rsb.info.nih.gov/ij). These data were used to calculate the ratio of bla to rpoA copies in 189
total DNA, which was defined as the plasmid copy number. Data are presented as the mean ± SD 190
(n = 3–4). 191
192
Transcriptional analysis of the mutant pUC replicon 193
G. kaustophilus MK242 [pGKE75αβ-catA138T] was cultured on LK5 plates at 65°C for 18 h. Total 194
RNA was prepared from resulting cells using an RNeasy Mini Kit with RNAprotect Bacteria 195
Reagent (Qiagen, Venlo, Netherlands). The RNA obtained from this procedure was treated with 196
gDNA Eraser (Takara Bio) to eliminate genomic DNA and then used for two-step reverse 197
transcription-PCR (RT-PCR) to detect transcripts from the mutant pUC replicon. Reverse 198
transcription was performed using the PrimeScript RT reagent Kit (Takara Bio) with primer 199
repF1 or repR2. PCR was performed using Quick Taq HS DyeMix by 30 cycles of 94°C for 30 s, 200
55°C for 30 s, and 68°C for 1 min. Primers repF1 and repR1 were used to detect transcripts from 201
between −559 and +1), and repF1 and repR2 were used for those between −559 and +205. 202
203
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
9
Plasmid stability assay of pUC18 derivatives 204
E. coli [pUC18 derivative] was precultured in liquid LB supplemented with ampicillin. An 205
aliquot of culture (103 cells) were then cultured at 20–42°C in liquid LB without antibiotics until 206
the culture reached stationary phase. This culture was successively repeated for two more times. 207
The resulting cells were grown at 37°C on LB plates and then 100 colonies were screened for 208
ampicillin resistance to calculate the plasmid retention rate. Data are presented as the mean ± SD 209
(n = 3). 210
211
Plasmid transformation of G. kaustophilus using Cm selection 212
pGKE75-cat derivatives were introduced into G. kaustophilus by conjugative DNA transfer (see 213
above). E. coli donor and conjugation helper were cultured in 10 ml of LB medium; G. 214
kaustophilus MK242 was cultured in 100 ml. These cultures were mixed and incubated on LB 215
plates at 37°C for 18 h, followed by incubation at 60°C for 1 h. The resulting cells were collected 216
in LB medium, and equal volume aliquots (G. kaustophilus cells, 107–108) were incubated at 217
60°C for 24 h on LB plates supplemented with Cm (10 mg l−1) and LK5 plates. Colonies were 218
counted to calculate the selection efficiency, which is the ratio of the number of colonies grown 219
using Cm selection (grown on LB plates with Cm) to the number of colonies grown using 220
kanamycin selection (grown on LK5 plates). Data are presented as the mean ± SD (n = 5). 221
222
Results 223
Generation of pGKE75αβ-catA138T 224
We first examined thermoadaptation-directed evolution of pGKE75-catA138T by simple successive 225
cultures of G. kaustophilus MK480 [pGKE75-catA138T] under Cm selection pressure. While the 226
strain could intrinsically grow at 65°C with tiny colonies only when spread at high cell density, 227
this approach provided no colonies that were more Cm resistant than the parent cells (population 228
rate, <0.01%). The result led us to treat cells with hydrogen peroxide between successive cultures 229
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
10
for more frequent mutations. This approach produced many colonies that showed substantial Cm 230
resistance at 70°C following 7 successive cultures (population rate, approximately 1%). 231
pGKE75-catA138T was extracted from these colonies in a mixture and reintroduced into G. 232
kaustophilus MK242 to eliminate false positives (21, 25, 26). Using this process, we identified 233
four clones that showed obvious Cm resistance at 65°C in dozens of clones. The 234
pGKE75-catA138T derivatives were isolated from these clones, and their sequences in the 235
Pgk704-catA138T region were determined. Since none of the four sequences contained mutations, we 236
further analyzed the entire sequence of the plasmid that conferred most efficient Cm resistance 237
on G. kaustophilus. The mutant plasmid, designated as pGKE75αβ-catA138T, contained two 238
mutations in the pUC replicon: a C·G→A·T transversion and a C·G→T·A transition (Fig. 2). 239
The C·G→T·A transition was presumably due to a spontaneous mutation in MK480 because this 240
type of mutation is intrinsically frequent in G. kaustophilus (20). Meanwhile, the C·G→A·T 241
transversion was attributable to hydrogen peroxide because it facilitates generation of the 242
aberrant base 7,8-dihydro-8-oxoguanine (27), which causes C·G→A·T transversions (28, 29). 243
244
Cm resistance conferred by pGKE75-cat derivatives 245
G. kaustophilus MK242 [pGKE75-cat] showed efficient Cm resistance at 50°C and MK242 246
[pGKE75-catA138T] showed at 55°C; however, MK242 [pGKE75αβ-catA138T] showed substantial 247
Cm resistance at 60–65°C (Table 3). The pGKE75-catA138T derivatives with either of the two 248
mutations, pGKE75α-catA138T and pGKE75β-catA138T, conferred moderate Cm resistance at 65°C 249
(Fig. 3A). The observation suggests that both mutations in the mutant pUC replicon participate in 250
the process by which pGKE75αβ-catA138T confers efficient Cm resistance. 251
252
CAT activity in G. kaustophilus 253
To examine the reasons for efficient Cm resistance conferred by pGKE75αβ-catA138T, we analyzed 254
the intracellular CAT activity in G. kaustophilus MK242 [pGKE75-cat derivative] (Fig. 3B). 255
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
11
MK242 [pGKE75αβ-catA138T] had higher CAT activity than MK242 [pGKE75-cat or 256
pGKE75-catA138T]. pGKE75α-catA138T and pGKE75β-catA138T caused activity between that of 257
pGKE75αβ-catA138T and those of pGKE75-cat and pGKE75-catA138T. Because the specific 258
activities of the CAT and CATA138T proteins were comparable (21), it is likely that these data 259
reflect the intracellular concentration of active CAT protein. Thus, there was a correlation 260
between Cm resistance efficiency and CAT concentration in MK242 [pGKE75-cat derivative]. 261
262
Plasmid copy numbers of pGKE75-cat derivatives in G. kaustophilus 263
Plasmid copy numbers often affect gene expression from plasmids. In general, a higher number 264
of copies leads to increased gene expression (30). Consequently, we analyzed the copy numbers 265
of pGKE75-cat derivatives in G. kaustophilus MK242 using QC-PCR (Fig. 3C). The copy 266
number of pGKE75αβ-catA138T was 17 ± 2 copies per chromosome, which was lower than those of 267
pGKE75-cat and pGKE75-catA138T, contrary to our expectation. pGKE75α-catA138T and 268
pGKE75β-catA138T showed copy numbers between that of pGKE75αβ-catA138T and those of 269
pGKE75-cat and pGKE75-catA138T. Thus, there was a negative correlation between the Cm 270
resistance efficiencies conferred by pGKE75-cat derivatives and their copy numbers in G. 271
kaustophilus. 272
273
Acetyl-CoA concentration in G. kaustophilus 274
Because CAT inactivates Cm using acetyl-CoA as substrate, we analyzed the acetyl-CoA 275
concentration in G. kaustophilus MK242 [pGKE75-cat derivative] (Fig. 3D). MK242 276
[pGKE75αβ-catA138T] had more abundant acetyl-CoA than MK242 [pGKE75-cat or 277
pGKE75-catA138T]. MK242 [pGKE75α-catA138T or pGKE75β-catA138T] showed acetyl-CoA 278
concentrations higher than those of MK242 [pGKE75-cat or pGKE75-catA138T] but less than that 279
of MK242 [pGKE75αβ-catA138T]. These data indicate a positive correlation between Cm 280
resistance efficiencies and acetyl-CoA concentrations in MK242 [pGKE75-cat derivative]. 281
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
12
282
Transcription from the mutant pUC replicon 283
RNA transcribed from the mutant pUC replicon in G. kaustophilus MK242 [pGKE75αβ-catA138T] 284
was analyzed using RT-PCR (Fig. S1). The analysis detected a transcript from −559 to +1 in the 285
mutant pUC replicon (RNA−559/+1) and its complementary transcript (RNA+1/−559). RT-PCR also 286
detected a longer transcript from −559 to +205 (RNA−559/+205), which could contain the two 287
mutations, although not its complement. The observation suggests that the mutant pUC replicon 288
is actually transcribed in G. kaustophilus, even though it arises from incidental promoter 289
sequences. 290
291
G. kaustophilus transformation using Cm selection 292
To examine whether G. kaustophilus can be transformed with pGKE75αβ-catA138T using Cm 293
selection, the plasmid was introduced into G. kaustophilus MK242 by conjugative DNA transfer. 294
A cell mixture containing donor, recipient, and conjugation helper was incubated at 37°C for 295
conjugation and subsequently preincubated at 60°C. An aliquot of cells was then incubated at 296
60°C on LB plates supplemented with Cm, providing 53 transformants (conjugation efficiency, 297
10−5–10−6 recipient−1). An equal aliquot provided 122 transformants on LK5 plates. Five repeated 298
analyses indicated that transformants obtained using Cm selection accounted for 36 ± 13% of 299
those obtained using kanamycin selection. Preincubation was essential for transformant growth 300
probably because of sufficient production of CATA138T prior to Cm exposure. Almost 301
transformants (>95%) obtained using Cm selection were resistant to kanamycin, confirming that 302
the number of false positives was negligible. pGKE75-cat and pGKE75-catA138T provided few 303
transformants using Cm selection. Thus, pGKE75αβ-catA138T is a unique plasmid for G. 304
kaustophilus; its introduction can be selected using Cm resistance at 60°C. 305
306
Plasmid copy numbers of pUC18 derivatives in E. coli 307
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
13
The plasmid pUC18αβ, which contains the mutant pUC replicon of pGKE75αβ-catA138T, was 308
constructed from pUC18 and analyzed for plasmid copy numbers (Fig. 4). QC-PCR analysis 309
indicated that pUC18 propagates with 310 ± 12 copies at 37°C. The copy number increased with 310
increasing culture temperature in agreement with previous observations (9). However, pUC18αβ 311
exhibited a substantial but temperature-independent copy number (120–210 copies at 25–42°C). 312
pUC18α and pUC18β showed temperature-dependent and independent profiles, respectively, but 313
both had lower copy numbers than pUC18αβ. Because a pBR322 derivative lacking rom gene is 314
also known to exhibit temperature-independent copy number, we analyzed the copy number of 315
pUC18γ, which had the replicon of pBR322 lacking the rom gene. Although pUC18γ exhibited a 316
temperature-independent profile, like pUC18αβ, its copy number was much lower at all 317
temperatures examined. Thus, pUC18αβ had a unique copy number profile different from known 318
pUC plasmids. 319
320
Plasmid stability of pUC18 derivatives in E. coli 321
The plasmid stability of pUC18 derivatives was assessed on the basis of plasmid retention rates 322
following 3 successive cultures of E. coli [pUC18 derivative]. pUC18 and pUC18α were notably 323
unstable at 42°C and 20–30°C, respectively (Table 4). However, pUC18αβ, pUC18β, pUC18γ 324
showed excellent stability at 20–42°C. pUC18αβ, pUC18β, and pUC18γ were completely retained 325
even following 7 successive cultures at 37°C, whereas pUC18 and pUC18α were retained at the 326
rate of 79 ± 7% and 55 ± 8%, respectively. 327
328
Discussion 329
A new plasmid responsible for Cm resistance at high temperatures, pGKE75αβ-catA138T, was 330
generated from pGKE75-catA138T through a directed evolution process. The mutations in 331
pGKE75αβ-catA138T were found in the pUC replicon and caused efficient Cm resistance at high 332
temperatures, although the pUC replicon has no role, in theory, in G. kaustophilus. An immediate 333
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
14
reason for this is that the mutation increased the intracellular concentration of active CATA138T 334
protein. An increased concentration of intracellular acetyl-CoA could also contribute to the Cm 335
resistance because acetyl-CoA is the substrate for CAT reaction. This idea is supported by the 336
fact that some E. coli strains exhibit Cm sensitivity despite sufficient cat expression because of a 337
low intracellular concentration of acetyl-CoA (31, 32). The increased concentrations of CATA138T 338
and acetyl-CoA can be attributed to the decreased copy number of pGKE75αβ-catA138T. It is 339
known that plasmid maintenance places a metabolic burden on bacteria and/or inhibits cell 340
growth (30, 33–35), presumably because of the considerable bioenergy required for replication. 341
In addition, acetyl-CoA is often used during the synthesis of metabolites that store redundant 342
bioenergy in bacteria, such as polyhydroxybutyrate (36) and fatty acids. Therefore, it is possible 343
that the decrease in plasmid copy number leads to redundant bioenergy and facilitates the 344
biosynthesis of both CATA138T and acetyl-CoA. It is unlikely that the decreased copy number 345
resulted in much slower CATA138T production, thereby increasing soluble and active CATA138T, 346
because CATA138T seemed to be more abundantly produced from pGKE75αβ than pGKE75 as 347
soluble forms while being equally produced as insoluble forms, when analyzed by Western 348
blotting (Fig. S2). 349
We note that the actual copy numbers of the intact pGKE75-cat derivatives could be much 350
lower than the values determined in this study. We previously determined the copy number of 351
pUCG18T, which is a parent plasmid of pGKE75-cat (16, 21), and another plasmid pSTE33T 352
using the Wu and Welker method (23). This method, using agarose gel electrophoresis, clearly 353
detected the pSTE33T band in agarose gel and determined its copy number as 16 copies. 354
Meanwhile, the copy number of pSTE33T was determined as 7 ± 3 (n = 4) using QC-PCR, 355
confirming that QC-PCR can determine plasmid copy number as well as the Wu and Welker 356
method. However, the Wu and Welker method could not detect pUCG18T, indicating a lower 357
abundance of the plasmid (17), although QC-PCR determined the copy number as 13 ± 9 (n = 4). 358
QC-PCR also determined that there were >17 copies of each pGKE75-cat derivative, whereas 359
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
15
none of pGKE75-cat derivatives were detected by agarose gel electrophoresis. These 360
observations imply the presence of incomplete forms of pUCG18T and pGKE75-cat derivatives, 361
suggesting that the decrease in pGKE75αβ-catA138T copies, which was indicated by QC-PCR 362
analysis, may reflect the decrease in incomplete forms. Taken together, efficient Cm resistance 363
conferred by pGKE75αβ-catA138T can be explained by an increase in intracellular concentrations 364
of CATA138T and acetyl-CoA following a decrease in the number of incomplete plasmids. 365
We speculate that the incomplete forms are single-stranded DNA rather than 366
randomly-truncated DNA, because these were undetectable by agarose gel electrophoresis and 367
PCR analysis exclusively detected intact cat gene, but not partial fragments, in G. kaustophilus 368
MK242 [pGKE75-cat derivative]. It is unclear why the mutations in pUC replicon suppress 369
production of single-stranded plasmids. However, the pBST1 replicon in pGKE75-cat 370
derivatives shows sequence similarity to the replicon of a plasmid from B. megaterium, pBM300, 371
which is thought to replicate via a theta-type mechanism, as do ColE1-type plasmids (37–39). In 372
theta-type mechanisms, plasmids replicate continuously on leading strand but discontinuously on 373
lagging strand. Therefore, single-stranded DNA may accumulate when the plasmid is replicated 374
efficiently on leading strand but not on lagging strand. This hypothesis allows us to speculate 375
that RNA species from the mutant pUC replicon, which were actually produced in G. 376
kaustophilus [pGKE75αβ-catA138T], may form thermostable secondary structures and hybridize 377
with leading strand at the pUC replication origin, as do in E. coli, under high-temperature 378
conditions and that this event may inhibit DNA elongation on leading strand to reduce 379
incomplete plasmids. 380
A kanamycin resistance gene is currently in use as an efficient selectable marker for 381
Geobacillus spp. at temperatures above 65°C (17, 38, 40, 41). Although cat can be used as a 382
selectable marker (23, 42), neither cat nor catA138T conferred Cm resistance on G. kaustophilus at 383
temperatures above 65°C (21). Therefore, it is noteworthy that pGKE75αβ-catA138T conferred Cm 384
resistance at 65°C. Moreover, G. kaustophilus was efficiently transformed with 385
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
16
pGKE75αβ-catA138T using Cm selection at 60°C. The selection was performed by incubation for 386
only 1 day without producing false positives. These observations suggest this new plasmid is 387
useful for genetic modifications of G. kaustophilus and maybe other Geobacillus spp. 388
In addition to pGKE75αβ-catA138T, this study provided a unique plasmid for E. coli, pUC18αβ, 389
which shows high plasmid stability and temperature-independent high copy number. pUC18αβ 390
has two mutations, compared with pUC18. Based on the properties of pUC18α and pUC18β, 391
which have either of the two mutations, both mutations obviously participate in the process that 392
results in high plasmid stability and high copy number of pUC18αβ. Mutant RNA species from 393
the mutant pUC replicon are probably responsible for the unique profile of pUC18αβ. One 394
mutation in the RNA II sequence can affect secondary structures within RNA II, thereby 395
affecting plasmid replication. Although the other mutation is outside the RNA II sequence, the 396
mutation can affect the secondary structure of extended RNAs that are partially transcribed 397
beyond the origin during plasmid replication (1). The temperature-independent plasmid copy 398
number of pUC18αβ may arise from thermostable secondary structures of mutant RNA species, in 399
contrast to temperature-sensitive RNAs from pUC18. 400
In summary, this study generated two plasmids: pGKE75αβ-catA138T and pUC18αβ. Because 401
of their unique properties, these plasmids extend the genetic toolboxes for G. kaustophilus and E. 402
coli. The results also suggest that thermoadaptation-directed evolution using an error-prone 403
thermophile, G. kaustophilus MK480, can generate not only mutant genes encoding thermostable 404
enzyme variants, but also plasmids with unique properties via unexpected mutations. 405
406
Acknowledgments 407
We wish to thank Dr. Jun Ishii of Kobe University for advice on Western blotting. This work was 408
supported by the following organizations: Programme for Promotion of Basic and Applied 409
Researches for Innovations in Bio-oriented Industry, Japan; the Science and Technology 410
Research Promotion Program for Agriculture, Forestry, Fisheries and Food Industry, Japan; JSPS 411
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
17
KAKENHI (Grant Number 25450105); and the Institute for Fermentation, Osaka, Japan. 412
413
References 414
1. Itoh T, Tomizawa J. 1980. Formation of an RNA primer for initiation of replication of 415
ColE1 DNA by ribonuclease H. Proc Natl Acad Sci USA 77:2450–2454. 416
2. Tomizawa J. 1986. Control of ColE1 plasmid replication: binding of RNA I to RNA II 417
and inhibition of primer formation. Cell 47:89–97. 418
3. Masukata H, Tomizawa J. 1986. Control of primer formation for ColE1 plasmid 419
replication: conformational change of the primer transcript. Cell 44:125–136. 420
4. Tomizawa J, Itoh T, Selzer G, Som T. 1981. Inhibition of ColE1 RNA primer formation 421
by a plasmid-specified small RNA. Proc Natl Acad Sci USA 78:1421–1425. 422
5. Eguchi Y, Tomizawa J. 1990. Complex formed by complementary RNA stem-loops and 423
its stabilization by a protein: function of ColE1 Rom protein. Cell 60:199–209. 424
6. Tomizawa J. 1990. Control of ColE1 plasmid replication. Interaction of Rom protein 425
with an unstable complex formed by RNA I and RNA II. J Mol Biol 212:695–708. 426
7. Cesareni G, Cornelissen M, Lacatena RM, Castagnoli L. 1984. Control of pMB1 427
replication: inhibition of primer formation by Rop requires RNA1. EMBO J 428
3:1365–1369. 429
8. Tomizawa J, Som T. 1984. Control of ColE1 plasmid replication: enhancement of 430
binding of RNA I to the primer transcript by the Rom protein. Cell 38:871–878. 431
9. Lin-Chao S, Chen W, Wong T. 1992. High copy number of the pUC plasmid results 432
from a Rom/Rop-suppressible point mutation in RNA II. Mol Microbiol 6:3385–3393. 433
10. Wong EM, Muesing MA, Polisky B. 1982. Temperature-sensitive copy number mutants 434
of ColE1 are located in an untranslated region of the plasmid genome. Proc Natl Acad Sci 435
USA 79:3570–3574. 436
11. Lupski JR, Projan SJ, Ozaki LS, Godson GN. 1986. A temperature-dependent pBR322 437
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
18
copy number mutant resulting from a Tn5 position effect. Proc Natl Acad Sci USA 438
83:7381–7385. 439
12. Gelfand DH, Shepard HM, O'Farrell PH, Polisky B. 1978. Isolation and 440
characterization of a ColE1-derived plasmid copy-number mutant. Proc Natl Acad Sci 441
USA 75:5869–5873. 442
13. Takami H, Inoue A, Fuji F, Horikoshi K. 1997. Microbial flora in the deepest sea mud 443
of the Mariana Trench. FEMS Microbiol Lett 152:279–285. 444
14. Takami H, Nishi S, Lu J, Shinamura S, Takaki Y. 2004. Genomic characterization of 445
thermophilic Geobacillus species isolated from the deepest sea mud of the Mariana 446
Trench. Extremophiles 8:351–356. 447
15. Suzuki H, Murakami A, Yoshida K. 2012. Counterselection system for Geobacillus 448
kaustophilus HTA426 through disruption of pyrF and pyrR. Appl Environ Microbiol 449
78:7376–7383. 450
16. Suzuki H, Wada K, Furukawa M, Doi K, Ohshima T. 2013. A ternary conjugation 451
system for the construction of DNA libraries for Geobacillus kaustophilus HTA426. 452
Biosci Biotechnol Biochem 77:2316–2318. 453
17. Suzuki H, Yoshida K. Genetic transformation of Geobacillus kaustophilus HTA426 by 454
conjugative transfer of host-mimicking plasmids. J Microbiol Biotechnol 22:1279–1287. 455
18. Suzuki H, Yoshida K, Ohshima T. 2013. Polysaccharide-degrading thermophiles 456
generated by heterologous gene expression in Geobacillus kaustophilus HTA426. Appl 457
Environ Microbiol 79:5151–5158. 458
19. Takami H, Takaki Y, Chee G-J, Nishi S, Shimamura S, Suzuki H, Matsui S, 459
Uchiyama I. 2004. Thermoadaptation trait revealed by the genome sequence of 460
thermophilic Geobacillus kaustophilus. Nucleic Acids Res 32:6292–6303. 461
20. Suzuki H, Kobayashi J, Wada K, Furukawa M, Doi K. 2015. 462
Thermoadaptation-directed enzyme evolution in an error-prone thermophile derived from 463
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
19
Geobacillus kaustophilus HTA426. Appl Environ Microbiol 81:149–158. 464
21. Kobayashi J, Furukawa M, Ohshiro T, Suzuki H. 2015. Thermoadaptation-directed 465
evolution of chloramphenicol acetyltransferase in an error-prone thermophile using 466
improved procedures. Appl Microbiol Biotechnol 99:5563–5572. 467
22. Shaw WV, Brodsky RF. 1968. Characterization of chloramphenicol acetyltransferase 468
from chloramphenicol-resistant Staphylococcus aureus. J Bacteriol 95:28–36. 469
23. Wu L, Welker NE. 1989. Protoplast transformation of Bacillus stearothermophilus 470
NUB36 by plasmid DNA. J Gen Microbiol 135:1315–1324. 471
24. Shimizu E, Kato H, Nakagawa Y, Kodama T, Futo S, Minegishi Y, Watanabe T, 472
Akiyama H, Teshima R, Furui S, Hino A, Kitta K. 2008. Development of a screening 473
method for genetically modified soybean by plasmid-based quantitative competitive 474
polymerase chain reaction. J Agric Food Chem 56:5521–5527. 475
25. Mankin AS, Garrett RA. 1991. Chloramphenicol resistance mutations in the single 23S 476
rRNA gene of the archaeon Halobacterium halobium. J Bacteriol 173:3559–3563. 477
26. McMurry LM, George AM, Levy SB. 1994. Active efflux of chloramphenicol in 478
susceptible Escherichia coli strains and in multiple-antibiotic-resistant (Mar) mutants. 479
Antimicrob Agents Chemother 38:542–546. 480
27. Dwyer DJ, Kohanski MA, Collins JJ. 2009. Role of reactive oxygen species in 481
antibiotic action and resistance. Curr Opin Microbiol 12:482–489. 482
28. Shibutani S, Takeshita M, Grollman AP. 1991. Insertion of specific bases during DNA 483
synthesis past the oxidation-damaged base 8-oxodG. Nature 349:431–434. 484
29. Tajiri T, Maki H, Sekiguchi M. 1995. Functional cooperation of MutT, MutM and 485
MutY proteins in preventing mutations caused by spontaneous oxidation of guanine 486
nucleotide in Escherichia coli. Mutat Res 336:257–267. 487
30. Seo J, Balley JE. 1985. Effects of recombinant plasmid content on growth properties and 488
cloned gene product formation in Escherichia coli. Biotechnol Bioeng 27:1668–1674. 489
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
20
31. Potrykus J, Wegrzyn G. 2001. Chloramphenicol-sensitive Escherichia coli strain 490
expressing the chloramphenicol acetyltransferase (cat) gene. Antimicrob Agents 491
Chemother 45:3610–3612. 492
32. Potrykus J, Wegrzyn G. 2003. The acrAB locus is involved in modulating intracellular 493
acetyl coenzyme A levels in a strain of Escherichia coli CM2555 expressing the 494
chloramphenicol acetyltransferase (cat) gene. Arch Microbiol 180:362–366. 495
33. Ow DS, Nissom PM, Philip R, Oh SK, Yap MG. 2006. Global transcriptional analysis 496
of metabolic burden due to plasmid maintenance in Escherichia coli DH5α during batch 497
fermentation. Enzyme Microb Technol 39:391–398. 498
34. Helling RB, Kinney T, Adams J. 1981. The maintenance of plasmid-containing 499
organisms in populations of Escherichia coli. J Gen Microbiol 123:129–141. 500
35. Jones KL, Kim S, Keasling JD. 2000. Low-copy plasmids can perform as well as or 501
better than high-copy plasmids for metabolic engineering of bacteria. Metab Eng 502
2:328–338. 503
36. Anderson AJ, Dawes EA. 1990. Occurrence, metabolism, metabolic role, and industrial 504
uses of bacterial polyhydroxyalkanoates. Microbiol Rev 54:450–472. 505
37. Kunnimalaiyaan M, Vary PS. 2005. Molecular characterization of plasmid pBM300 506
from Bacillus megaterium QM B1551. Appl Environ Microbiol 71:3068–3076. 507
38. Taylor MP, Esteban CD, Leak DJ. 2008. Development of a versatile shuttle vector for 508
gene expression in Geobacillus spp. Plasmid 60:45–52. 509
39. Stevenson DM, Kunnimalaiyaan M, Müller K, Vary PS. 1998. Characterization of a 510
theta plasmid replicon with homology to all four large plasmids of Bacillus megaterium 511
QM B1551. Plasmid 40:175–189. 512
40. Liao H, McKenzie T, Hageman R. 1986. Isolation of a thermostable enzyme variant by 513
cloning and selection in a thermophile. Proc Natl Acad Sci USA 83:576–580. 514
41. Narumi I, Nakayama N, Nakamoto S, Kimura T, Yanagisawa T, Kihara H. 1993. 515
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
21
Construction of a new shuttle vector pSTE33 and its stabilities in Bacillus 516
stearothermophilus, Bacillus subtilis, and Escherichia coli. Biotechnol Lett 15:815–820. 517
42. Imanaka T, Fujii M, Aramori I, Aiba S. 1982. Transformation of Bacillus 518
stearothermophilus with plasmid DNA and characterization of shuttle vector plasmids 519
between Bacillus stearothermophilus and Bacillus subtilis. J Bacteriol 149:824–830. 520
43. Bennett PM, Grinsted J, Richmond MH. 1977. Transposition of TnA does not generate 521
deletions. Mol Gen Genet 154:205–211. 522
44. Figurski DH, Helinski DR. 1979. Replication of an origin-containing derivative of 523
plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci 524
USA 76:1648–1652. 525
526
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
22
Figure legends 527
528
Fig. 1 pBR322 and pUC replicons 529
The replication origin is indicated at position +1. RNA I and RNA II are indicated with their 530
transcription directions. Compared with the pBR322 replicon, pUC replicon lacks a rom (also 531
known as rop) gene and has a point mutation (C·G→T·A transition) at position −444. 532
533
Fig. 2 The structure of pGKE75-cat (A), pUC18 (B), and pUC replicons of their derivatives (C) 534
The replication origin is indicated at position +1. Mutation sites are indicated by hollow circles. 535
pGKE75-cat and pGKE75-catA138T shared the usual pUC replicon with pUC18. 536
pGKE75αβ-catA138T and pUC18αβ carry both a G·C→T·A transversion at +175 and a G·C→A·T 537
transition at −252. pGKE75α-catA138T and pUC18α carry a G·C→T·A transversion at +175. 538
pGKE75β-catA138T and pUC18β carry a G·C→A·T transition at −252. pUC18γ carries a 539
T·A→C·G transition at −444 and thus has a pBR322 replicon lacking the rom gene. 540
Abbreviations: Pgk704, a promoter functional in G. kaustophilus (18); bla, ampicillin resistance 541
gene functional in E. coli; TK101, kanamycin resistance gene functional at high temperatures 542
(40); pUC, pUC replicon functional in E. coli; pBST1, pBST1 replicon functional in Geobacillus 543
spp. (38); and oriT, conjugative transfer origin from pRK2013 (44). 544
545
Fig. 3 Effects of pGKE75-cat derivatives on G. kaustophilus 546
G. kaustophilus MK242 [pGKE75-cat derivative] was grown at 65°C on LK5 plates and 547
analyzed for Cm resistance efficiency (A), intracellular CAT activity (B), plasmid copy number 548
(C), and acetyl-CoA concentration (D). (A) Cells were incubated at 65°C on LK5 plates with and 549
without Cm to determine Cm resistance efficiency. Data are presented as the mean ± SD (n = 4). 550
(B) Cell extract was prepared and analyzed for CAT specific activity. Data are presented as the 551
mean ± SD (n = 5). (C) Total DNA was extracted from cells and used to analyze plasmid copy 552
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
23
number, which was determined using the ratio of bla (in pGKE75-cat derivatives) to rpoA (in G. 553
kaustophilus chromosome). Data are presented as the mean ± SD (n = 3). (D) Cell extract was 554
prepared and analyzed for acetyl-CoA concentration. Data are normalized by protein 555
concentration and presented as the mean ± SD (n = 4). 556
557
Fig. 4 Plasmid copy number of pUC18 (upper, solid), pUC18αβ (upper, hollow), pUC18α (lower, 558
solid), pUC18β (lower, hollow), and pUC18γ (lower, gray) in E. coli 559
E. coli [pUC18 derivative] was cultured at the indicated temperature. Total DNA was extracted 560
from cells and used to analyze plasmid copy number, which is the ratio of bla (in pUC18 561
derivatives) to rpoA (in E. coli chromosome). Data are presented as the mean ± SD (n = 3). 562 563 564
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
1
Table 1 Plasmids used in this study 1
pUC and pBST1 denote replicons functional in E. coli and Geobacillus spp., respectively. TK101 is a kanamycin resistance gene 2
functional in G. kaustophilus (40). bla, cat, kan, and tet denote ampicillin, chloramphenicol, kanamycin, and tetracycline resistance 3
genes for E. coli, respectively. oriT denotes the conjugative transfer origin from pRK2013 (44). pUB307 encodes tra genes 4
responsible for conjugative DNA transfer. 5
6
Plasmid Relevant description Reference
pGKE75-cat E. coli–Geobacillus shuttle plasmid; pUC, pBST1, TK101, bla, cat, oriT Fig. 2; (21)
pGKE75-catA138T pGKE75-cat derivative carrying catA138T instead of cat Fig. 2; (21)
pGKE75αβ-catA138T pGKE75-catA138T derivative carrying two mutations in pUC replicon Fig. 2
pGKE75α-catA138T pGKE75-catA138T derivative carrying one mutation in pUC replicon Fig. 2
pGKE75β-catA138T pGKE75-catA138T derivative carrying one mutation in pUC replicon Fig. 2
pUC18 E. coli plasmid; pUC replicon, bla, lacZα Fig. 2
pUC18αβ pUC18 derivative carrying two mutations in pUC replicon Fig. 2
pUC18α pUC18 derivative carrying one mutation in pUC replicon Fig. 2
pUC18β pUC18 derivative carrying one mutation in pUC rreplicon Fig. 2
pUC18γ pUC18 derivative carrying pBR322 replicon without rom Fig. 2
pUB307 Derivative of IncP-1 plasmid RP1, tra, oriT, kan, tet (43)
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
1
Table 2 Primers used in this study 1 2
3
Primer Sequence (5′–3′)
blaF TGCTGAAGATCAGTTGGGTG
blaR TTGTTGCCGGGAAGCTAGAG
catF1 GGACGACGATGACAAAATGCAATTTAATAAAATTG
catF2 GCGCATGCTGGACTACAAGGACGACGATGAC
catR GCCGGATCCTTATAAAAGCCAGTCATTAG
colEF1 CGCTCCAAGCTGGGTTGTGTGCACGAACCC
colER1 GGGTTCGTGCACACAACCCAGCTTGGAGCG
colEF2 GTATTGGGCGCTCTTCAGCTTCCTCGCTCACTG
colER2 CAGTGAGCGAGGAAGCTGAAGAGCGCCCAATAC
colEF3 CGGCTACACTAGAAGGACAGTATTTGGTAT
colER3 ATACCAAATACTGTCCTTCTAGTGTAGCCG
ECrpoAF GCCTTTAGAGCGTGGCTTTG
ECrpoAR TTTCGATGACCAGCTTGTCC
GKrpoAF CAACCTTAGGGAACTCCTTG
GKrpoAR TTCGGCCCAATGCTTCCATC
repF1 GCTTGCAAACAAAAAAACCACCGCTACCAG
repR1 GTTTTTCCATAGGCTCCGCCCCCCTGACGAG
repR2 GAGAGGCGGTTTGCGTATTGGGCGCTCTTC
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
1
Table 3 Cm resistance efficiency (%) conferred by pGKE75-cat derivatives 1
G. kaustophilus MK242 [pGKE75-cat derivative] was precultured in liquid LK5 and incubated 2
at the indicated temperature on LK5 plates with and without Cm (5 mg l−1). Cm resistance 3
efficiency was defined as the ratio of Cm resistant colonies to the total number of colonies. Data 4
are presented as the mean ± SD (n = 4). 5
Plasmids Culture temperature
50°C 55°C 60°C 65°C 70°C
pGKE75-cat 66 ± 25 37 ± 8 27 ± 3 <1 <1
pGKE75-catA138T 56 ± 18 77 ± 4 46 ± 6 <1 <1
pGKE75αβ-catA138T 21 ± 4 20 ± 6 71 ± 6 88 ± 12 2 ± 1
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from
1
Table 4 Plasmid retention rates (%) of pUC18 derivatives following successive cultures 1
E. coli [pUC18 derivative] was successively cultured in liquid LB for three times. The resulting 2
cells were screened for ampicillin resistance to calculate the plasmid retention rate. Data are 3
presented as the mean ± SD (n = 3). 4
5
Plasmids Culture temperature
20°C 25°C 30°C 37°C 42°C
pUC18 98 ± 0 97 ± 3 98 ± 2 96 ± 5 3 ± 5
pUC18αβ >99 >99 >99 >99 >99
pUC18α <1 <1 <1 94 ± 4 92 ± 11
pUC18β >99 97 ± 5 97 ± 5 >99 >99
pUC18γ >99 >99 >99 >99 >99
on February 15, 2018 by guest
http://aem.asm
.org/D
ownloaded from