1 Strain/vectors/PrimersDescriptionReference M. smegmatis mc 2 Wild type strain M.tuberculosis H37Ra(A non virlulent laboratorystrain of M.tuberculosis) E.coli DH10B(mrr-hsd RMS-mcrBC) mcrA recA1 Laboratory stock pARN104A derivative of pUC18 Tare et.al.,2012 pJam2Expression vector for mycobacteria Triccas et al., 1998 P rrnPCL1 sense5TCACCTATGGATATCTATGGATGACCGAACC TGGTCTTGACTCCATTGCCGGATTTGTATTAG ACTGGCAGGGTCGCCCCGAAGCGGGCGG 3 Tare et.al.,2012 P rrnPCL1 antisense5CCGCCCGCTTCGGGGCGACCCTGCCAGTCTA ATACAAATCCGGCAATGGAGTCAAGACCAGG TTCGGTCATCCATAGATATCCATAGGTGA3 P rrnPCL1 sense5TCACCTATGGATATCTATGGATGACCGAACC TGGTCTTGACTCCATTGCCGGATTTGTATTAG ACCGGCAGGGTCGCCCCGAAGCGGGCGG3 P rrnPCL1 antisense5CCGCCCGCTTCGGGGCGACCCTGCCGGTCTA ATACAAATCCGGCAATGGAGTCAAGACCAGG TTCGGTCATCCATAGATATCCATAGGTGA3 Wt SigA ntd Rev5GTTCGCGCCTACCTCAAACAGATCG3 Wt SigA ctd For5CGATCTGTTTCGAGTAGGCGCGAAC3 This work L232M ntd Rev5GTTCGCGCCTACATGAAACAGATCG3 L232M ctd For5CGATCTGTTTCATGTAGGCGCGAAC3 SigFL For5GCCTCTAGAGTAACGACCGAAGGGGTGTATG TGGCAG3 SigFL Rev5CAGAGTCTTCAAAGTCCAGGTAGTCGCGC3 Table S1 Strains, plasmids and oligonucleotides 2 Group A rrn(Sigma) M. tuberculosisTL M. smegmatisTL B. subtilisTL L. monocytogenesTL S. aureusTL S. pneumoniaeTL Group B E. coliCM S. enteriticaCM S. TyphimuriumCM V. choleraeCM Table S2 Representative bacteria in two groups based on residues in rrn discriminator and the sigma 1.2 region 3 Supplementary Fig. S1 A Supplementary Fig. S1(A) Sequence of promoters from genus mycobacteria responsive to growth phase dependent control and having conserved thymine ( upper case and underlined) at three nucleotide downstream (3ds) to -10 element. -35,-10 elements and start site are in upper case. The sequences of the promoters not responsive to the growth phase dependent control are also shown. (B) The effect of mutation of the base two nucleotides downstream to -10 element (2ntds) on the iNTPs mediated regulation of P rrnPCL1. The amount of transcripts formed in presence of iNTPs are normalized to that obtained in absence of the molecules. AU represents fold change on Y axis. Promoters responsive to growth phase dependent regulation Promoters spacer discriminator+1 3ds M.tb P gyrB1 TCGGCCctggcgcccgatcacgg-TACAGTggTgtgc-G M.tb P rrnpcL1 TTGACTccattgccggat-tt-g--TATTAGacTggca-G M.tb P rrnAP1 TCGGTGccgagattcgaacg--g--TATGCTgtTaggc-G M.tb P rpsL TTGACCtgccagactggcggcgggTATTGTggTtgctcG M.sm P rrnBP1 TTGACTcccagtttccaaggacg--TAACTTatTccag-G M.sm P rrnAP1 TCGGAGccgagagagagccgag--TAAGCTcgT--ag-G Promoters non-responsive to growth phase dependent regulation M.tb P metU TTGGCGagcttcgtgcgtgttcggTAGCCTggCattt-A M.smeg P gyr TCGGTGctgtcgctatctcgcgg-TAGACTggAcgac-G M.tb P groEL2 TGCACTcggcatagagtgct----AAGAATaaCgttgG P rrnPCL1 B 4 1- T3ntds : L232SigA-RNAP 2- C3ntds : L232SigA-RNAP 3- T3ntds : L232MSigA-RNAP 4- C3ntds : L232MSigA-RNAP K m M K m M Supplementary Fig. S2 Determination of K iNTP. (A) K iNTP values of P rrnPCL1 and its mutant in discriminator. (K GTP ) (B) K iNTP values of P gyrB1 and its mutant in discriminator (K GTP, ATP ) are shown. T3ntds, C3ntds promoters were transcribed with wild type (L232SigA) and mutant RNAP (L232M SigA) in separate reactions as described in the panel right to the graph. The K m values (K GTP for P rrnPCl1, K GTP,ATP for P gyrB1 ) were plotted on the Y axis of the graphs. The concentrations of the iNTPs used in the reactions were 20, 50, 100, 200, 400, 800 and 1000M. A B 1- T3ntds: L232SigA-RNAP 2- C3ntds: L232SigA-RNAP 3- T3ntds: L232MSigA-RNAP 4- C3ntds:L232MSigA-RNAP Supplementary Fig. S2 P gyrB1 P rrnPCL1 5 Supplementary Fig. S3. (A) Alignment of aminoacids in the stretch of 1.2 region of principle sigma factors from different bacteria. Sequences are taken from NCBI (National Centre for Biotechnology Information) and aligned using ClustalW. The residues homologous to M102 in 1.2 region of Sig70 of E. coli is highlighted. E. coli- Escherichia coli, S. typhi-Salmonella typhi, P. aeruginosa-Pseudomonas aeruginosa, R. sphareoides -Rhodobacter sphareoides, C. crescentus- Caulobacter crescentus, L. monocyto- Lactobacillus monocyotgenes, B. subtilli-Bacillus subtillis; S. aureus- Staphylococcus aureus, S. pnemoni- Streptococcus pnuemoniae; N. brasilie Nocardia brasiliensis, S. coelicol- Streptococcus coelicolor, M. smegmatis- Mycobacterium smegmatis; M. leprae- Mycobacterium leprae, M. tubercul- Mycobacterium tuberculosis, S. aureofac- Staphylococcus aureofaciens., L. lactis Lactobacillus lactis, C. acetobut- Clostridium acetobutylicum. (B) The sequence of P metU -35, -10 elements and start site is in upper case. Base at three nucleotide downstream (3ds) is marked bold and underlined. (C )In vitro transcription at iNTP insensitive promoter, P metU to check the efficiency of RNAPs containing L232 and L232M SigA. Supplementary Fig. S3. L232M RNAP L232 RNAP dis +1 M.tb P metU gcgatTTGGCGagcttcgtgcgtgttcggTAGCCTggcatttAccg 3ds B C A PromoterSigAk off C3ntdsL C3ntdsL232M3.5 C3T4ntdsL C3T4ntdsL232M2.5 Supplementary Fig. S4 Contribution of nucleotide at 4ntds in stability of open complex. (A). Templates used in the assay. The nucleotides at 3ntds and 4 ntds in different templates used are shown. Stability of open complexes at P rrnPCl1 templates having mutation at 3ntds and/or 3 and 4 ntds (ntds- nucleotides downstream to -10 element). (B). The stability of open complexes were determined by monitoring the time dependent dissociation RNAP using filter binding assay. The radioactivity counts in the filters spotted with reactions at different time-points were normalized to that obtained at zero time point. (C). k off was determined by single phase exponential decay analysis using Graph pad ver The SigA (wild type /mutant) present in the holo-RNAP in the reaction is shown in the table. Non- template Template ntds 3 4 CG GC CT GA A B C 6 Supplementary Fig. S4 A PromoterRelative k off T3ntds 1.06 C3ntds0.16 Bubble C CT0.15 CC0.2 CA0.45 B Supplementary Fig.S5 Contribution of cytosine in non-template strand to open complex stability (A). Representation of various templates used in the assay. Templates with a complementary base-pairing at three nucleotide down stream (3ntds) to -10 are labeled as T3ntds (wild type P rrnPCL1 ) and C3ntds (mutant P rrnPCL1 ). Templates having a mis-match at 3ntds position are labeled as bubble templates. (B). Stability of open complexes at bubble templates. The stability of open complexes were determined by monitoring the time dependent dissociation RNAP using filter binding assay. The radioactivity counts in the filters spotted with reactions at different time-points were normalized to that obtained at zero time point. (C). k off was determined by single phase exponential decay analysis using Graph pad ver.2.3. The values are normalized to the k off of TT bubble and referred as relative k off. Bubble C- non-template strand with C in non-template strand annealed with templates having A, T or C [refer (A)]. C complementary base pair at 3ntds mis-match at 3ntds C3ntds P rrnPCL1 T3ntds P rrnPCL1 3ntds Bubble templates CT P rrnPCL1 CC P rrnPCL1 CA P rrnPCL1 Non- template Template C A C C T C T A T T C G C TT P rrnPCL1 7 Supplementary Fig. S5 PromoterRelative k off T3ntds 1.06 C3ntds0.16 Bubble G TG1 AG0.96 GG0.86 G A B Supplementary Fig. S6 Contribution of G in template strand in open complex stability. (A) Representation of various templates used in the assay. Templates with a complementary base-pairing at three nucleotide down stream (3ntds) to -10 are labeled as T3ntds (wild type P rrnPCL1 ) and C3ntds (mutant P rrnPCL1 ). Templates having a mis-match at 3ntds position are labeled as bubble templates. Stability of open complexes at G bubble templates. (B) The stability of the open complexes were determined as described in legend to Supplementary Fig. S5. The radioactivity counts in the filters spotted with reactions at different time-points were normalized to that obtained at zero time point. (C) k off was determined by single phase exponential decay analysis using Graph pad ver.2.3. The values are normalized to the k off of TT bubble. Bubble G- non-template strand with G in template strand annealed with non template strand having A, T or C (refer A). complementary base pair at 3ntds mis-match at 3ntds C3ntds P rrnPCL1 T3ntds P rrnPCL1 3ntds Bubble templates TG P rrnPCL1 GG P rrnPCL1 AG P rrnPCL1 Non- template Template T A C G T G A G G G C 8 Supplementary Fig. S6 T T TT P rrnPCL1 Supplementary Fig.S7 Sequences of rrn promoters from representative bacteria of gram positive and gram negative groups. -35 and -10 elements are in upper case and underlined. Nucleotide at two nucleotide downstream to -10 element (2ds) is marked bold and underlined in promoters of gram negative bacteria. Promoters from gram positive having conserved thymine at (3ds) three nucleotides downstream to -10 element (upper case, bold and underlined) are also listed. Sequences are taken from (32). 9 Supplementary Fig. S ds +1 E.coli TTGTCA TATAATgcgccaccA V.cho TTGACA TATAATccgccctcA S.ent TTGTCT TATAATgcgcctccA S.typhim TGTCTT TATATTgcgcctccA M.tub TTGACT TATTAGacTggca-G M.sm TTGACT TAACTTatTccag-G B.su TTGCAA TATATTatTaaac-G L.mon TTGCAA TATATTtaTaaac-G S.aue TTGAAA TAAAATaaTattt-G S.pn TTGACA TAT A ATagTaaga- G 3ds