1-s2.0-S0960852415016041-main

8/18/2019 1-s2.0-S0960852415016041-main

1/7

8/18/2019 1-s2.0-S0960852415016041-main

2/7

for cell growth through reaction (3) (Phillips et al., 1994) and

reduces the protons to form H2.

Carboxydothermus hydrogenoformans, Desulfotomaculum

carboxydivorans et al. (Table S1) are able to metabolize CO to H2by biological water–gas shift reaction (Parshina et al., 2005;

Tiquia-Arashiro, 2014), and the process has special advantages

over chemical catalytic process, which generally requires high

temperature or pressure and has low product selectivity (Henstra

et al., 2007). The temperature and pressure needed in the biological

reaction are moderate, inducing an energy saving in the operation.

Besides, the high specificity of enzymes enable a higher product

yield with fewer by-products evolved during the process.

Furthermore, most biocatalysts can tolerate trace amounts of con-

taminants such as sulfur and chorine (Mohammadi et al., 2011).

Until now, there are only studies on H2 production from CO by

pure microorganisms (Haddad et al., 2014; Jung et al., 2002; Kim

et al., 2015; Younesi et al., 2008). The conversion of CO to H2 by

mixed culture has not been investigated until now, which has

the potential advantages including non-sterilized conditions and

utilization of wastewater as nutrients. It is possible to enrich one

or more of the pure microorganisms listed in Table S1 in a mixed

culture if the operation conditions are available. The conversion

of CO to CH4 or acetate by mixed culture has been reported before

(Alves et al., 2013; Guiot et al., 2011), and H2 was observed as an

intermediate during the mixed culture conversion of syngas, espe-

cially in thermophilic conditions (Guiot et al., 2011). The activities

of hydrogenotrophic methanogens (4H2 + CO2? CH4 + 2H2O) and

homoacetogens (4H2 + 2CO2? CH3COOH+ 2H2O) need to be fully

inhibited (Luo et al., 2011a) in order to achieve selective conver-

sion of CO to H2 by the mixed culture. Other scientific questions

are also needed to be considered. First, CO is both substrate and

inhibitor to microorganisms and its effect on the CO conversion

efficiency by mixed culture is still unknown (Oelgeschlager and

Rother, 2008). Second, CO has low solubility in water, and the

gas–liquid mass transfer may limit its conversion in a continuously

operated reactor. Therefore, the methods to overcome the gas–

liquid mass transfer limitation have to be investigated (Yasinet al., 2015). In addition, mixed culture fermentation may involve

various microorganisms that could achieve CO conversion, and it

is necessary to characterize the microbial community composi-

tions in the mixed culture.

Based on the above considerations, the present study aimed at

developing a new biological process for H2 production from CO

by anaerobic mixed culture. Specifically, the effects of inoculum

sources, pH, methods to inhibit hydrogen consuming microorgan-

isms, and CO partial pressures on H2 production from CO were

investigated to achieve selective conversion of CO to H2. Moreover,

a continuous reactor was operated to study the performance of

continuous production of H2 from CO, and also gas recirculation

was tested to increase the gas–liquid mass transfer. The microbial

community composition in the long-term operated reactor wasanalyzed by high-throughput sequencing of the 16S rRNA genes.

2. Methods

2.1. Inoculum sources

Two different inocula were tested in order to compare their

potentials to convert CO into H2. One was the waste activated

sludge (WAS) (pH = 6.4 ± 0.2, TSS = 15± 0.1 g/L, VSS = 11.7 ± 0.1 g/

L) obtained from Quyang wastewater treatment plant (Shanghai,

China), and the other one was anaerobic granular sludge

(AGS) (pH = 7.5 ± 0.5, TSS = 133.4 ± 4.6 g/L, VSS = 103.3 ± 2.5 g/L)obtained from an up-flow anaerobic sludge blanket (UASB) reactor

treating papermaking wastewater in Longchen Paper CO., LTD

(Jiangsu, China).

2.2. H 2 production potential from CO by mixed culture

Four batch experiments were carried out. In batch experiment

1, both WAS and AGS were tested for their potentials to convert

CO to H2

. The inocula were diluted by basic medium (prepared

according to a previous publication (Angelidaki and Sanders,

2004)) to 100 mL with a final VSS concentration 10 g/L. The mix-

ture also contained 50 mM phosphate buffer saline (pH 7.5) to

keep a constant pH. The 100 mL mixtures were added to 320 mL

serum bottles, and the pH of the mixtures were then adjusted to

7.5 by 2 M NaOH. The bottles were closed with butyl stoppers

and aluminum crimps to make them air tight, and they were sub-

sequently purged with N2 for 2 min to maintain anaerobic condi-

tions. CO was injected into the closed bottles to achieve CO

partial pressure 0.2 atm in the gas phase. Finally, all the bottles

were incubated in a shaker at 55 C. The shaker was controlled at

300 rpm to overcome the gas–liquid mass transfer limitation.

Bottles without CO were used as control to determine H2 produc-

tion from endogenous respiration. During the experiments, the

gas composition (CO, H2 and CH4) in the headspace of each bottle

was measured every day, and the liquid samples were collected

and analyzed for the possible presence of volatile fatty acids

(VFA) every two days. All the tests were prepared in triplicate. In

batch experiment 2, the effect of different pH (5.5 and 7.5) on

the H2 production from CO was conducted by AGS based on the

results from batch experiment 1. In batch experiment 3, three dif-

ferent methods (heat pretreatment of the inoculum (120 C, 1 h),

the addition of 2-bromoethanesulfonic acid (BES) (10 mM) and

the addition of chloroform (5 mM)), were investigated to inhibit

the hydrogen consumption to increase the H2 production from

CO. The methods were chosen according to the previous studies

focusing on fermentative hydrogen production from organic

wastes/wastewater (Bundhoo et al., 2015; Luo et al., 2010) and also

our preliminary experiments. CO is both substrate and inhibitor formicroorganisms, and therefore the effect of different CO partial

pressures (0.05, 0.1, 0.2, 0.4 and 0.8 atm) on H2 production from

CO was tested in batch experiment 4. 320 mL serum bottles with

100 mL mixture containing both inoculum and nutrients were

used. The stability of H2 production process was also studied by

successively refreshing the CO in the headspace of each bottle.

The experimental procedure for batch experiments 2, 3, and 4

was similar to batch experiment 1.

2.3. H 2 production from CO in a continuous reactor

A lab-scale UASB reactor with 1L working volume was used to

study the performance of continuous H2 production from CO by

anaerobic mixed culture. The reactor was inoculated with AGS,and the VSS concentration in the reactor was 10 g/L. The tempera-

ture and pH in the bioreactor were controlled at 55 C and pH 7.5,

respectively. 2 M NaOH was used to adjust the pH. Basic medium

containing chloroform (5 mM) was fed to the UASB reactor every

two days (100 mL/2d) in order to provide nutrients and inhibit

hydrogen-consuming microorganisms. Three experimental phases

were set to study the effect of gas recirculation and increased CO

loading rate on the CO conversion efficiency. In phase I, pure CO

was continuously pumped into the reactor through a gas diffuser

at a flow rate of 1 L/d with no gas circulation. The volume and con-

centration of H2 and COin the collected gas, as well as the VFA con-

centration in the liquid were measured periodically. From day 22

onwards (phase II), gas recirculation was implemented with a

recirculation flow rate of 1 L/h. After the reactor achieved a steadystate, the CO loading rate was doubled while the gas recirculation

2 Y. Liu et al. / Bioresource Technology 202 (2016) 1–7

http://-/?-http://-/?-http://-/?-http://-/?-

8/18/2019 1-s2.0-S0960852415016041-main

3/7

was kept at 1 L/h in phase III (from 97 days), and the CO conversion

rate with increased CO loading rate was investigated.

2.4. Microbial community analysis

The inoculum of the reactor and also the sample collected from

the reactor under steady-state of phase II were used for microbial

community analysis. Three samples were obtained from the reac-tor on days 92, 94 and 96, and then the samples were equally

mixed together to get a representative sample. Total genomic

DNA was extracted from each sample using QIAamp DNA Stool

Mini Kit (QIAGEN,51504) according to the manufacturer’s instruc-

tions. 341f (CCTACACGACGCTCTTCCGATCTN) and 805r (GACTG

GAGTTCCTTGGCACCCGAGAATTCCA) were used as primers. The

PCR conditions were as follows: 94 C for 3 min; 5 cycles of three

steps: 94 C for 30 s, 45 C for 20 s, and 65 C for 30 s; 20 cycles

of three steps: 94 C for 20 s, 55 C for 20 s, and 72 C for 30 s; a

final step at 72 C for 5 min. The PCR products were purified, quan-

tified, and used for barcoded libraries preparation and sequencing

on an Illumina Miseq platform according to the standard protocols.

The low-quality sequences were removed. The numbers of

sequences were normalized to the same sequencing depths

(3649) by MOTHUR program in order to facilitate the comparison

of the two samples. The sequences were then used for taxonomic

classification by RDP and a diversity analysis (OTU, Chao1,

Refraction curve, Shammon index and Venn diagram) by MOTHUR

program. Detailed information about the analysis can be found in

our previous study (Luo et al., 2013). The sequences of the two

samples were deposited into the NCBI sequence read archive data-

base (PRJNA294844).

2.5. Analytic methods

The gas composition in the headspace was analyzed by a gas

chromatography equipped with a TCD. For H2, the carrier gas

was N2

, and the temperatures of the injector, detector and oven

were 190 C, 110 C, and 190 C, respectively. For CH4 and CO,

the carrier gas was He, and the temperatures of the injector, detec-

tor and oven were 120 C, 110 C and 120 C, respectively. The

concentrations of acetate, propionate, iso-butyrate, butyrate, iso-

valerate and valerate were determined by HPLC and they were sep-

arated with a 7.8 300 Aminex HPX-87-H column (Bio-Rad) at

55 C with a refractive index detector at 50 C. The mobile phase

was 5 mmol H2SO4, at a flow rate of 0.4 mL/min. Total suspended

solids and volatile suspended solids were analyzed according to

APHA (APHA, 1995).

3. Results and discussion

3.1. H 2 production potentials from CO by two different inocula

The AGS and WAS were first investigated for their potential to

convert COto H2 under thermophilic condition at pH 7.5. As shown

in Table 1, only around 50% of the CO was consumed with WAS

after 8 days of fermentation, while CO was fully consumed with

AGS, which indicated that AGS had high potential for CO conver-

sion. It could be due to that the WAS contained mainly aerobic

microorganisms, and it took time to accumulate the anaerobic

microorganisms for CO conversion. It was supported by the long

lag phase for the experiment with WAS (four days). For the exper-

iment with AGS, CO was fully consumed even in the first four days.

Fig. 1 shows the time course of CO consumption and products (H2and CH4) formation by AGS. Initially H2 was the only product from

CO, but H2

was fully converted to CH4

after 6 days of fermentation.

The CH4 production was probably due to the methanogens con-

tained in the inoculum and also the favorable conditions (pH

7.5). It was consistent with a previous study that H2 was an inter-

mediate for CO conversion to CH4 in thermophilic anaerobic reac-

tor for biogas production (Luo et al., 2013). Table 1 also shows the

CO balance in the batch experiment, and it was 92% for WAS and

93% for AGS. The missing 7–8% CO could be related with the

growth of microorganisms. Considering the higher specific activity

of CO consumption by AGS compared to WAS, further studies were

conducted to achieve selective conversion of CO to H2 by AGS.

It is known that the methanogens are sensitive to pH (Luo et al.,

2011a), and therefore the H2 production from CO at pH 5.5 with

AGS was investigated. As shown in Table 1, CO was fully consumed

after 8 days of fermentation. Although only trace amount of CH4was found, acetate was observed as an important product besides

H2. Most of the isolated thermophilic CO-utilizing microorganisms

were hydrogenogenic bacteria and archaea (Sokolova et al., 2009),

and the production of acetate was most probably due to the pres-

ence of homoacetogens, which converted H2 and CO into acetate

(Siriwongrungson et al., 2007). From Table 1, it can be seen that

specific activities of CO consumption and H2 production at pH

7.5 by AGS were much higher than that at pH 5.5. It is consistent

with the previous reports that most of the isolated thermophilic

CO-utilizing microorganisms had optimal pH around 7 (Henstra

et al., 2007; Sokolova et al., 2009). Therefore, pH 7.5 should be

more suitable for H2 production from CO if the H2 consuming

microorganisms, especially methanogens, were inhibited.

3.2. Effects of different pretreatment methods on H 2 production from

CO by AGS

Three different methods were tested to inhibit the H2 consum-

ing microorganisms in the AGS in order to increase the H 2 produc-

tion efficiency from CO. The time courses of CO consumption and

products formation by AGS with different pretreatment methods

are shown in Fig. 2. In the presence of BES, a considerable amount

of H2 was observed initially, but the produced H2 was consumed

gradually since day 5. CH4 was not observed during the whole fer-

mentation process, which demonstrated BES was effective to inhi-

bit methanogens. The consumption of H2 was due to the

homoacetogens which formed acetate from H2 and CO2, and it

was proved by the detected acetate as seen in Table 2.Homoacetogenesis has been found in fermentative H2 produc-

tion from organic wastes/wastewater in many previous publica-

tions, which is still an unresolved challenge for efficient H2production (Saady, 2013). Our results also showed that both

methanogens and homoacetogens were present in AGS at pH 7.5.

Fig. 2 (Heat) shows that a rapid CO conversion took place after

Table 1

The summary of specific activities and final products from batch experiments 1 and 2.

Inoculum pH Specific activity Products formed after 8d incubation

mmol CO/g VSSd mmol H2/g VSSd Acetate (mmol) CH4 (mmol) H2 (mmol) Residual CO (mmol) CO balance (%)

Waste activated sludge 7.5 0.23 ± 0.04 0.19 ± 0.02 0.03 ± 0.01 0 0.81 ± 0.13 0.89 ± 0.12 92

Anaerobic granular sludge 7.5 0.68 ± 0.06 0.50 ± 0.07 0.07 ± 0.01 0.39 ± 0.02 0 0 93

Anaerobic granular sludge 5.5 0.32 ± 0.06 0.23 ± 0.05 0.28 ± 0.03 0.08 ± 0.02 0.25 ± 0.05 0 86

Y. Liu et al. / Bioresource Technology 202 (2016) 1–7 3

http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-

8/18/2019 1-s2.0-S0960852415016041-main

4/7

2 days of fermentation and resulted in the obvious H2 accumula-

tion. However, the produced H2 decreased rapidly resulting in

CH4 production, and it showed that methanogens were not effec-

tively inhibited by heat pretreatment. Although heat pretreatment

has been demonstrated to be able to inhibit methanogens previ-

ously for H2 production from wastes/wastewater, most of the pre-

vious studies were carried out at pH around 5.5 ( Guo et al., 2008;

Wong et al., 2014). In the present study, the fermentation pH was

7.5, and heat pretreatment was not effective for inhibitingmethane production from AGS. The results demonstrated that a

low fermentation pH, instead of heat pretreatment, was able to

inhibit methanogens. Fig. 2 (Chloroform) shows that in the pres-

ence of chloroform, the maximal amount of produced H2 was

nearly equal to the initial amount of CO supplied. Also, the pro-

duced H2 was not converted in 8 days of fermentation, indicating

that chloroform inhibited the activities of both methanogens and

homoacetogens. It is known BES as a structural analogue of coen-

zyme M, can be used to specifically inhibit methanogenesis, and

therefore the activity of homoacetogens still could be present with

the additionof BES (Xuet al., 2010). For heat pretreatment, it might

not kill the methanogens and therefore methane was produced

during the fermentation due to the suitable pH (7.5). However,chloroform was nonspecific inhibitors, and therefore it can inhibit

both methanogens as well as homoacetogens (Liu et al., 2011).

Chloroform can block the function of corrinoid enzymes and to

inhibit methyl-coenzyme M reductase of methanogens. The pre-

sent study demonstrated that it was possible to achieve selective

conversion of CO to H2 by AGS, even at pH 7.5.

3.3. Effects of CO partial pressures on H 2 production from CO by AGS

CO is known to be an inhibitor to microorganisms, and

therefore the sensitivity of the AGS to CO was also investigated.

Different CO partial pressures (0.05, 0.1, 0.2, 0.4, and 0.8 atm) were

studied at pH 7.5 with the addition of chloroform. Assuming there

were equilibriums between the gas and liquid phase in the bottles,the different CO partial pressures were equal to around 0.83, 1.66,

3.32, 6.64 and 13.28 mgCO/L based on a value of around

1700 atm L/mol for the Henry constant at 55 C (Lide, 1999). The

specific activities relating with CO consumption and H2 production

of the AGS are shown in Fig. 3. The increase of CO partial pressures

from 0.05 atm to 0.4 atm resulted in the increase of the specific

activities of CO consumption. However, the CO partial pressures

higher than 0.4 atm seriously inhibited the specific activities of

CO consumption, which was due to the toxicity of CO to microor-

ganisms. The specific activities of H2 production was also

decreased. The consumed CO was almost stoichiometrically

converted to H2 under all the tested CO partial pressures. The CO

partial pressures higher than 0.2 atm were shown to inhibit CH4

production by mixed anaerobic culture (Guiot et al., 2011; Luoet al., 2013). However, the maximum specific activities of CO con-

sumption were observed at CO partial pressures as high as 0.4 atm

for H2 production. The results indicated that H2 production from

CO was not so sensitive to high CO partial pressures compared to

CH4 production, and therefore it might be a better choice to pro-

duce H2 from CO instead of CH4. Since gas–liquid mass transfer is

a main engineering challenge for syngas fermentation (Guiot

et al., 2011; Munasinghe and Khanal, 2010), the higher tolerance

to CO for H2 production meant the higher CO partial pressure that

could be allowed in the gas phase (e.g. fermentation at high gas

pressure), which would increase the dissolved CO concentration

based on Henry’s Law and thereby increase the gas–liquid mass

transfer rate.

Based on the above results, further study was carried out toinvestigate the stability for H2 production from CO. When the

0 2 4 6 80.0

0.4

0.8

1.2

1.6

2.0CO

CH 4

H2

Time (d)

G a s ( m m o l )

pH=7.5

Fig. 1. The time courses of CO and product (H2 and CH4) amount with anaerobic

granular sludge at pH 7.5 and thermophilic condition.

0 2 4 6 80.0

0.5

1.0

1.5

2.0

2.5

G a s ( m

m o l )

CO

CH4

H2

pH 7.5, BES

0 2 4 6 80.0

0.5

1.0

1.5

2.0

2.5

G a s ( m m o l )

pH 7.5, Heat

0 2 4 6 8 10 120.0

0.5

1.0

1.5

2.0

2.5

G a s ( m m o l )

Time (d

pH 7.5, Chloroform

Fig. 2. The time courses of CO and product (H2 and CH4) amount with anaerobic

granular sludge at pH 7.5 and thermophilic condition with different methods for

inhibiting H2 consuming microorganisms.

Table 2

The summary of final products from batch experiment 3.

Pretreatment Final product

Acetate

(mmol)

CH4(mmol)

H2 (mmol) Residual

CO

(mmol)

CO

balance

(%)

BES 0.3 ± 0.09 0 0.56 ± 0.17 0 93

Heat 0.08 ± 0.01 0.35 ± 0.02 0 0 91

Chloroform 0 0 ± 0.02 1.8 ± 0.11 0 94


8/18/2019 1-s2.0-S0960852415016041-main

5/7

experiment was conducted at CO partial pressure 0.2 atm, CO was

completely converted to H2 within 4 days, and then the experi-

ment was repeated by using the same inoculum without additional

chloroform addition. Almost full conversion of CO to H2 was suc-

cessfully repeated for another 3 times, as shown in Fig. S1. At CO

partial pressure of 0.4 atm, CO conversion was similar to that at

CO partial pressure of 0.2 atm. CO was depleted completely and

H2 was produced steadily in three successive incubations. The

results further demonstrated that stable and efficient H2 produc-

tion from CO could be achieved by anaerobic mixed culture

fermentation.

3.4. Process performance and microbial community composition

analysis of the UASB reactor converting CO to H 2

The H2 production from CO by anaerobic mixed culture was

then tested in a UASB reactor, in order to investigate the long-

term process performance and microbial community composition

of the enriched mixed culture. Different operational conditions

were investigated and the reactor performances are shown in

Table 3. In phase I, CO was directly injected into the UASB reactorby gas diffuser. It was found that only around 38% of the CO was

consumed, which resulted in the high CO concentration (51%) in

the gas collected from the UASB reactor. The higher CO in the

collected gas might be due to its low solubility and therefore lim-

ited by the low gas–liquid mass transfer rate (Yasin et al., 2015). In

phase II, gas recirculation (1 L/h) was implemented in order to

increase the gas–liquid mass transfer rate of CO. Gas recirculation

was an effective method to improve the CO conversion efficiency,

since the amount of consumed CO was increased to around 86%.

The CO in the collected gas was decreased, and correspondingly

the concentration of H2

was increased from 28.5% (phase I) to

45.3% (phase II). The residual gas in the collected gas was CO2,

which was produced during the conversion of CO to H2 as shown

in Eq. (1). In phase III, the CO loading rate was doubled. A decrease

of CO conversion rate (from 85.9% to 75.3%) was observed, and it

could possibly be improved by further increasing the gas recircula-

tion rates. Although there were still CO left in the collected gas

(51.2% phase I, 8.1% phase II and 15.1% phase III), it can be further

reduced by increasing the gas–liquid mass-transfer rate

(Munasinghe and Khanal, 2010). For example, hollow fiber mem-

brane, which can achieve bubbleless gas diffusion, would be able

to increase the CO conversion efficiency and should be tested in

the future (Sahinkaya et al., 2011). In all three phases, the accumu-

lation of VFA was not detected, and around 90% of the consumed

CO was converted to H2. The missing 10% of CO could be due to

the growth of the microorganisms in the reactor. The H2 produc-

tion rate was increased from phase I to phase III due to the

increased gas–liquid mass transfer (phase II) and also the increased

CO loading rate (phase III) (Table 3). It should be noted that the H2production rate in the continuous experiment was higher than that

in the batch experiments (Fig. 3). For example, in phases II and III,

the H2 production rates were 3.6 and 6.1 mmol/gVSS/d, which was

much higher than the maximum value (1.6 mmol/gVSS/d)

observed in Fig. 3. The reason was that the CO-converting microor-

ganisms were enriched in the UASB reactor due to the continuous

feeding of CO to the reactor, which resulted in the gradual growth

of CO-converting microorganisms, while in batch experiments AGS

were not accumulated to CO.

High-throughput sequencing of the 16S rRNA genes was con-

ducted in order to understand the differences of microbial commu-nity compositions between the inoculum and the enriched mixed

culture in the UASB reactor. The species richness of the inoculum

was higher than that of the enriched mixed culture, which was

reflected by the large numbers of OTUs and Chao 1 (Table S2).

The reason was that the enriched mixed culture only used CO as

substrate, while the inoculum was obtained from the UASB reactor

treating complex organic wastewater. The rarefaction curves of the

two samples at 0.03 distance are shown in Fig. S2, which suggested

that the sequencing depths were still not enough to cover the

whole diversity. Nevertheless, most common OTUs were detected

in the present study since the coverage values were all around

70%. The Shannon diversity, which reflects both species richness

and evenness of the communities (Lu et al., 2012), was also slightly

higher in the inoculum than that in the enriched mixed culture.Fig. S3 shows that only 291 OTUs (11.7% of the total detected

OTUs) were shared by the inoculum and the enriched mixed cul-

ture at 0.03 distance, and it indicated that the microbial communi-

ties of the two samples were largely different, and CO converting

microorganisms might be enriched in the reactor.

Phylogenetic classification was then performed on the

sequences of the two samples, and the results are shown in

Fig. 4. The differences between the two samples were not obvious

standing in the phylum and class levels. Firmicutes and Proteobac-

teria, which were reported to be dominant in anaerobic digestion

process treating organic wastes (Sundberg et al., 2013), were also

the dominant phyla for the two samples. Clostridia were the dom-

inant class for the two samples. However, obvious difference was

found in the genus level. The sequences belonging to Clostridiumwere less, while the unclassified sequences were higher in the

Fig. 3. The effects of different CO partial pressures on specific activities of CO

consumption and H2 production.

Table 3

The summary of reactor performances under different operational conditions.

Phase I (1–21) II (22–96) III (97–102)

CO loading rate (mmol/d) 45 45 90

Gas retention time (d) 1 1 0.5

Gas recirculation rate (L/h) 0 1 1

Collected gas (mmol/d) 53.8 ± 2.6 78.5 ± 5.9 146.3 ± 9.4

H2 concentration (%) 28.5 ± 1.3 45.3 ± 2 .1 41.3 ± 2.3

CO concentration (%) 51.2 ± 2.8 8.1 ± 1.2 15.1 ± 1.7

CO conversion efficiency (%) 38.8± 3.8 85.9± 2.4 75.3± 4.3

H2

production rate (mmol/gVSS/d) 1.53± 0.1 3.6 ± 0.1 6.1 ± 0.1

Yield H2/CO (%) 88 91.8 89.4


http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-http://-/?-

8/18/2019 1-s2.0-S0960852415016041-main

6/7

enriched mixed culture compared to the inoculum. The known

hydrogenogenic CO-oxidizing thermophilic bacteria were

summarized in Table S1. Only the genus Desulfotomaculum,

containing hydrogenogenic CO-oxidizing thermophilic specieDesulfotomaculum carboxydivorans (Parshina et al., 2005), was

found in the enriched mixed culture, but not in the inoculum.

The result suggested that Desulfotomaculum were enriched by CO

in the continuous reactor. More sequences relating to CO

conversion should be expected, however, the percentage of

Desulfotomaculum in the enriched mixed culture was only 1%.

The lower abundance of CO relating sequences might be due to

the possible presence of unknown hydrogenogenic CO-oxidizing

thermophilic bacteria, and it was reflected by the higher percent-

age of unclassified sequences in the enriched mixed culture.

Similar result was also reported in a previous study (Luo et al.,

2013), where the lack of known CO-utilizing bacteria and high per-

centage of unclassified sequences were found from the bacterial

sequences in a continuous reactor that converting both CO andsewage sludge to CH4. The above results probably indicated that

more efforts should be made to identify unknown CO-utilizing bac-

teria, especially from the mixed anaerobic culture enriched from

CO.

For the first time, continuous and efficient H2 production from

CO by anaerobic mixed culture was successfully achieved in the

present study. In previous studies, either acetate or CH4 was the

final product after long-term accumulation of the mixed culture

for CO fermentation under thermophilic condition at neutral pH

(Alves et al., 2013; Guiot et al., 2011). However, stable and efficient

H2 production was achieved in our study by the inhibition of the H2consuming microorganisms with the addition of chloroform. In the

current study, chloroform was added together with the nutrient

solution (basic medium) every two days (100 mL/2d, equals to 20

d HRT). In a further study, we found that chloroform was not nec-

essarily added to the reactor every two days, and the stable H2 pro-

duction could last at least one month (data not shown). Although

there were studies on H2 production from lignocellulosic biomass

(e.g. straw) by dark fermentation, the H2 yields were generally

low due to the production of organic acids and the difficulty to

be biodegraded (He et al., 2014; Liu et al., 2014). Correspondingly,

the recovered energy as H2 was very low (only around 5–6% even

for some easily biodegradable organics (Luo et al., 2011b; Zhu

et al., 2008)). By thermal gasification of the lignocellulosic biomass

and then fermentative conversion of the CO in the syngas to H2,

ideally full conversion of biomass to H2 could be achieved.

However, gas–liquid mass transfer is the main bottleneck for the

fermentative conversion of CO to H2 in large-scale facilities due

to its low solubility. The improvement of gas–liquid mass transfer

rate is needed in future study. Hollow fiber membrane, which can

achieve efficient and bubbleless gas transfer to the liquid (Luo

et al., 2013), might be a promising solution for increasing the CO

conversion efficiency.

4. Conclusions

The study showed AGS had higher potential for the anaerobicconversion of CO to H2 compared to WAS at 55 C and pH 7.5,

and the addition of chloroform was necessary to inhibit both

methanogens and homoacetogens in AGS to achieve the conver-

sion of CO to H2. The continuous experiment showed stable and

efficient H2 production was obtained from a UASB reactor, and

gas recirculation was crucial to increase the CO conversion effi-

ciency. Microbial community analysis showed low abundance

(1%) of known CO-utilizing bacteria Desulfotomaculum and high

abundance (44%) of unclassified sequences were enriched in the

reactor.

Acknowledgements

This study was funded by the Yangfan project from Science andTechnology Commission of Shanghai Municipality (14YF1400400),

National Natural Science Foundation of China (51408133,

51378373), SRF for ROCS, SEM.

Appendix. A. Supplementary data

Supplementary data associated with this article can be found, in

the online version, at http://dx.doi.org/10.1016/j.biortech.2015.11.

071.

References

Alves, J.I., Stams, A.J.M., Plugge, C.M., Alves, M.M., Sousa, D.Z., 2013. Enrichment of

anaerobic syngas-converting bacteria from thermophilic bioreactor sludge.FEMS Microbiol. Ecol. 86, 590–597.

Fig. 4. Phylogenetic classification of the sequences in phylum, class and genus

levels. ‘‘CO” the enriched culture obtained from the reactor; ‘‘I” the inoculum.


http://-/?-http://dx.doi.org/10.1016/j.biortech.2015.11.071http://dx.doi.org/10.1016/j.biortech.2015.11.071http://refhub.elsevier.com/S0960-8524(15)01604-1/h0005http://refhub.elsevier.com/S0960-8524(15)01604-1/h0005http://refhub.elsevier.com/S0960-8524(15)01604-1/h0005http://refhub.elsevier.com/S0960-8524(15)01604-1/h0005http://refhub.elsevier.com/S0960-8524(15)01604-1/h0005http://refhub.elsevier.com/S0960-8524(15)01604-1/h0005http://refhub.elsevier.com/S0960-8524(15)01604-1/h0005http://dx.doi.org/10.1016/j.biortech.2015.11.071http://dx.doi.org/10.1016/j.biortech.2015.11.071http://-/?-

8/18/2019 1-s2.0-S0960852415016041-main

7/7

Angelidaki, I., Sanders, W., 2004. Assessment of the anaerobic biodegradability of

macropollutants. Rev. Environ. Sci. Biotechnol. 3, 117–129.

APHA, 1995. Standard Methods for the Examination of Water and Wastewater,

19th ed. American Public Health Association, New York, USA.

Bundhoo, M.A.Z., Mohee, R., Hassan, M.A., 2015. Effects of pre-treatment

technologies on dark fermentative biohydrogen production: a review. J.

Environ. Manage. 157, 20–48.

Guiot, S.R., Cimpoia, R., Carayon, G., 2011. Potential of wastewater-treating

anaerobic granules for biomethanation of synthesis gas. Environ. Sci. Technol.

45, 2006–2012.

Guo, W.Q., Ren, N.Q., Wang, X.J., Xiang,W.S., Meng, Z.H., Ding, J., Qu, Y.Y., Zhang, L.S.,2008. Biohydrogen production from ethanol-type fermentation of molasses in

an expanded granular sludge bed (EGSB) reactor. Int. J. Hydrogen Energy 33,

4981–4988.

Haddad, M., Cimpoia, R., Guiot, S.R., 2014. Performance of Carboxydothermus

hydrogenoformans in a gas-lift reactor for syngas upgrading into hydrogen. Int.

J. Hydrogen Energy 39, 2543–2548.

He,L., Huang, H., Lei, Z.,Liu, C.,Zhang, Z.,2014. Enhancedhydrogen productionfrom

anaerobic fermentation of rice straw pretreated by hydrothermal technology.

Bioresour. Technol. 171, 145–151.

Henstra, A.M., Sipma, J., Rinzema, A., Stams, A.J.M., 2007. Microbiology of synthesis

gas fermentation for biofuel production. Curr. Opin. Biotechnol. 18, 200–206.

Jung, G.Y., Kim, J.R., Park, J.-Y., Park, S., 2002. Hydrogen production by a new

chemoheterotrophic bacterium Citrobacter sp. Y19. Int. J. Hydrogen Energy 27,

601–610.

Kim, M.-S., Choi, A.R., Lee, S.H., Jung, H.-C., Bae, S.S., Yang, T.-J., Jeon, J.H., Lim, J.K.,

Youn, H., Kim, T.W., Lee, H.S., Kang, S.G., 2015. A novel CO-responsive

transcriptional regulator and enhanced H2 production by an engineered

Thermococcus onnurineus NA1 Strain. Appl. Environ. Microbiol. 81, 1708–1714.

Lide, D.R., 1999. CRC Handbook of Chemistry and Physics, 80th ed. CRC Press, Boca

Raton, FL .

Liu, H., Wang, J., Wang, A., Chen, J., 2011. Chemical inhibitors of methanogenesis

and putative applications. Appl. Microbiol. Biotechnol. 89, 1333–1340.

Liu, Z., Li, Q., Zhang, C., Wang, L., Han, B., Li, B., Zhang, Y., Chen, H., Xing, X.-H., 2014.

Effects of operating parameters on hydrogen production from raw wet steam-

exploded cornstalk and two-stage fermentation potential for biohythane

production. Biochem. Eng. J. 90, 234–238.

Lu, L., Xing, D., Ren, N., 2012. Pyrosequencing reveals highly diverse microbial

communities in microbial electrolysis cells involved in enhanced H-2

production from waste activated sludge. Water Res. 46, 2425–2434.

Luo, G., Karakashev, D., Xie, L., Zhou, Q., Angelidaki, I., 2011a. Long-term effect of

inoculum pretreatment on fermentative hydrogen production by repeated

batch cultivations: homoacetogenesis and methanogenesis as competitors to

hydrogen production. Biotechnol. Bioeng. 108, 1816–1827.

Luo, G., Wang, W., Angelidaki, I., 2013. Anaerobic digestionfor simultaneous sewage

sludge treatment and CO biomethanation: process performance and microbial

ecology. Environ. Sci. Technol. 47, 10685–10693.

Luo, G., Xie, L.,Zhou, Q., Angelidaki, I., 2011b. Enhancementof bioenergy productionfrom organic wastes by two-stage anaerobic hydrogen and methane production

process. Bioresour. Technol. 102, 8700–8706.

Luo, G., Xie, L., Zou, Z.H., Wang, W., Zhou, Q., 2010. Evaluation of pretreatment

methods on mixed inoculum for both batch and continuous thermophilic

biohydrogen production from cassava stillage. Bioresour. Technol. 101, 959–

964.

Mohammadi, M., Najafpour, G.D., Younesi, H., Lahijani, P., Uzir, M.H., Mohamed, A.

R., 2011. Bioconversion of synthesis gas to second generation biofuels: a review.

Renewable Sustainable Energy Rev. 15, 4255–4273.

Munasinghe, P.C., Khanal, S.K., 2010. Syngas fermentation to biofuel: evaluation of

carbon monoxide mass transfer coefficient (k(L)a) in different reactor

configurations. Biotechnol. Progr. 26, 1616–1621.

Oelgeschlager, E., Rother, M., 2008. Carbon monoxide-dependent energy

metabolism in anaerobic bacteria and archaea. Arch. Microbiol. 190, 257–269.

Parshina, S.N., Sipma, J., Nakashimada, Y., Henstra, A.M., Smidt, H., Lysenko, A.M.,Lens, P.N.L., Lettinga, G., Stams, A.J.M., 2005. Desulfotomaculum

carboxydivorans sp. nov., a novel sulfate-reducing bacterium capable of

growth at 100% CO. Int. J. Syst. Evol. Microbiol. 55, 2159–2165.

Phillips, J., Clausen, E., Gaddy, J., 1994. Synthesis gas as substrate for the biological

production of fuels and chemicals. Appl. Biochem. Biotechnol. 45–46, 145–157 .

Saady, N.M.C., 2013. Homoacetogenesis during hydrogen production by mixed

cultures dark fermentation: Unresolved challenge. Int. J. Hydrogen Energy 38,

13172–13191.

Sahinkaya, E., Hasar, H., Kaksonen, A.H., Rittmann, B.E., 2011. Performance of a

sulfide-oxidizing, sulfur-producing membrane biofilm reactor treating sulfide-

containing bioreactor effluent. Environ. Sci. Technol. 45, 4080–4087.

Siriwongrungson, V., Zeny, R.J., Angelidaki, I., 2007. Homoacetogenesis as the

alternative pathway for H-2 sink during thermophilic anaerobic degradation of

butyrate under suppressed methanogenesis. Water Res. 41, 4204–4210 .

Sokolova,T.G., Henstra, A.M., Sipma, J., Parshina, S.N., Stams, A.J.M., Lebedinsky, A.V.,

2009. Diversity and ecophysiological features of thermophilic carboxydotrophic

anaerobes. FEMS Microbiol. Ecol. 68, 131–141.

Sundberg, C., Al-Soud, W.A., Larsson, M., Alm, E., Yekta, S.S., Svensson, B.H.,

Sorensen, S.J., Karlsson, A., 2013. 454 pyrosequencing analyses of bacterial and

archaeal richness in 21 full-scale biogas digesters. FEMS Microbiol. Ecol. 85,

612–626.

Tiquia-Arashiro, S., 2014. CO-oxidizing microorganisms. In: Thermophilic

Carboxydotrophs and their Applications in Biotechnology. Springer

International Publishing, pp. 11–28.

Wong, Y.M., Wu, T.Y., Juan, J.C., 2014. A review of sustainable hydrogen production

using seed sludge via dark fermentation.Renewable Sustainable Energy Rev. 34,

471–482.

Xu, K., Liu, H., Chen, J., 2010. Effect of classic methanogenic inhibitors on the

quantity and diversity of archaeal community and the reductive

homoacetogenic activity during the process of anaerobic sludge digestion.


Yasin, M., Jeong, Y., Park, S., Jeong, J., Lee, E.Y., Lovitt, R.W., Kim, B.H., Lee, J., Chang, I.

S., 2015. Microbial synthesis gas utilization and ways to resolve kinetic and

mass-transfer limitations. Bioresour. Technol. 177, 361–374.

Younesi, H., Najafpour, G., Ku Ismail, K.S., Mohamed, A.R., Kamaruddin, A.H., 2008.

Biohydrogen production in a continuous stirred tank bioreactor from synthesis

gas by anaerobic photosynthetic bacterium: Rhodopirillum rubrum. Bioresour.Technol. 99, 2612–2619.

Zhu, H., Stadnyk, A., Béland, M., Seto, P., 2008. Co-production of hydrogen and

methane from potato waste using a two-stage anaerobic digestion process.


http://refhub.elsevier.com/S0960-8524(15)01604-1/h0010http://refhub.elsevier.com/S0960-8524(15)01604-1/h0010http://refhub.elsevier.com/S0960-8524(15)01604-1/h0015http://refhub.elsevier.com/S0960-8524(15)01604-1/h0015http://refhub.elsevier.com/S0960-8524(15)01604-1/h0020http://refhub.elsevier.com/S0960-8524(15)01604-1/h0020http://refhub.elsevier.com/S0960-8524(15)01604-1/h0020http://refhub.elsevier.com/S0960-8524(15)01604-1/h0025http://refhub.elsevier.com/S0960-8524(15)01604-1/h0025http://refhub.elsevier.com/S0960-8524(15)01604-1/h0025http://refhub.elsevier.com/S0960-8524(15)01604-1/h0030http://refhub.elsevier.com/S0960-8524(15)01604-1/h0030http://refhub.elsevier.com/S0960-8524(15)01604-1/h0030http://refhub.elsevier.com/S0960-8524(15)01604-1/h0030http://refhub.elsevier.com/S0960-8524(15)01604-1/h0035http://refhub.elsevier.com/S0960-8524(15)01604-1/h0035http://refhub.elsevier.com/S0960-8524(15)01604-1/h0035http://refhub.elsevier.com/S0960-8524(15)01604-1/h0040http://refhub.elsevier.com/S0960-8524(15)01604-1/h0040http://refhub.elsevier.com/S0960-8524(15)01604-1/h0040http://refhub.elsevier.com/S0960-8524(15)01604-1/h0045http://refhub.elsevier.com/S0960-8524(15)01604-1/h0045http://refhub.elsevier.com/S0960-8524(15)01604-1/h0050http://refhub.elsevier.com/S0960-8524(15)01604-1/h0050http://refhub.elsevier.com/S0960-8524(15)01604-1/h0050http://refhub.elsevier.com/S0960-8524(15)01604-1/h0050http://refhub.elsevier.com/S0960-8524(15)01604-1/h0055http://refhub.elsevier.com/S0960-8524(15)01604-1/h0055http://refhub.elsevier.com/S0960-8524(15)01604-1/h0055http://refhub.elsevier.com/S0960-8524(15)01604-1/h0055http://refhub.elsevier.com/S0960-8524(15)01604-1/h0055http://refhub.elsevier.com/S0960-8524(15)01604-1/h0055http://refhub.elsevier.com/S0960-8524(15)01604-1/h0055http://refhub.elsevier.com/S0960-8524(15)01604-1/h0060http://refhub.elsevier.com/S0960-8524(15)01604-1/h0060http://refhub.elsevier.com/S0960-8524(15)01604-1/h0065http://refhub.elsevier.com/S0960-8524(15)01604-1/h0065http://refhub.elsevier.com/S0960-8524(15)01604-1/h0070http://refhub.elsevier.com/S0960-8524(15)01604-1/h0070http://refhub.elsevier.com/S0960-8524(15)01604-1/h0070http://refhub.elsevier.com/S0960-8524(15)01604-1/h0070http://refhub.elsevier.com/S0960-8524(15)01604-1/h0075http://refhub.elsevier.com/S0960-8524(15)01604-1/h0075http://refhub.elsevier.com/S0960-8524(15)01604-1/h0075http://refhub.elsevier.com/S0960-8524(15)01604-1/h0080http://refhub.elsevier.com/S0960-8524(15)01604-1/h0080http://refhub.elsevier.com/S0960-8524(15)01604-1/h0080http://refhub.elsevier.com/S0960-8524(15)01604-1/h0080http://refhub.elsevier.com/S0960-8524(15)01604-1/h0085http://refhub.elsevier.com/S0960-8524(15)01604-1/h0085http://refhub.elsevier.com/S0960-8524(15)01604-1/h0085http://refhub.elsevier.com/S0960-8524(15)01604-1/h0085http://refhub.elsevier.com/S0960-8524(15)01604-1/h0090http://refhub.elsevier.com/S0960-8524(15)01604-1/h0090http://refhub.elsevier.com/S0960-8524(15)01604-1/h0090http://refhub.elsevier.com/S0960-8524(15)01604-1/h0090http://refhub.elsevier.com/S0960-8524(15)01604-1/h0095http://refhub.elsevier.com/S0960-8524(15)01604-1/h0095http://refhub.elsevier.com/S0960-8524(15)01604-1/h0095http://refhub.elsevier.com/S0960-8524(15)01604-1/h0095http://refhub.elsevier.com/S0960-8524(15)01604-1/h0100http://refhub.elsevier.com/S0960-8524(15)01604-1/h0100http://refhub.elsevier.com/S0960-8524(15)01604-1/h0100http://refhub.elsevier.com/S0960-8524(15)01604-1/h0105http://refhub.elsevier.com/S0960-8524(15)01604-1/h0105http://refhub.elsevier.com/S0960-8524(15)01604-1/h0105http://refhub.elsevier.com/S0960-8524(15)01604-1/h0110http://refhub.elsevier.com/S0960-8524(15)01604-1/h0110http://refhub.elsevier.com/S0960-8524(15)01604-1/h0110http://refhub.elsevier.com/S0960-8524(15)01604-1/h0115http://refhub.elsevier.com/S0960-8524(15)01604-1/h0115http://refhub.elsevier.com/S0960-8524(15)01604-1/h0115http://refhub.elsevier.com/S0960-8524(15)01604-1/h0115http://refhub.elsevier.com/S0960-8524(15)01604-1/h0120http://refhub.elsevier.com/S0960-8524(15)01604-1/h0120http://refhub.elsevier.com/S0960-8524(15)01604-1/h0125http://refhub.elsevier.com/S0960-8524(15)01604-1/h0125http://refhub.elsevier.com/S0960-8524(15)01604-1/h0125http://refhub.elsevier.com/S0960-8524(15)01604-1/h0130http://refhub.elsevier.com/S0960-8524(15)01604-1/h0130http://refhub.elsevier.com/S0960-8524(15)01604-1/h0130http://refhub.elsevier.com/S0960-8524(15)01604-1/h0135http://refhub.elsevier.com/S0960-8524(15)01604-1/h0135http://refhub.elsevier.com/S0960-8524(15)01604-1/h0135http://refhub.elsevier.com/S0960-8524(15)01604-1/h0140http://refhub.elsevier.com/S0960-8524(15)01604-1/h0140http://refhub.elsevier.com/S0960-8524(15)01604-1/h0140http://refhub.elsevier.com/S0960-8524(15)01604-1/h0145http://refhub.elsevier.com/S0960-8524(15)01604-1/h0145http://refhub.elsevier.com/S0960-8524(15)01604-1/h0145http://refhub.elsevier.com/S0960-8524(15)01604-1/h0145http://refhub.elsevier.com/S0960-8524(15)01604-1/h0145http://refhub.elsevier.com/S0960-8524(15)01604-1/h0150http://refhub.elsevier.com/S0960-8524(15)01604-1/h0150http://refhub.elsevier.com/S0960-8524(15)01604-1/h0150http://refhub.elsevier.com/S0960-8524(15)01604-1/h0155http://refhub.elsevier.com/S0960-8524(15)01604-1/h0155http://refhub.elsevier.com/S0960-8524(15)01604-1/h0155http://refhub.elsevier.com/S0960-8524(15)01604-1/h0155http://refhub.elsevier.com/S0960-8524(15)01604-1/h0160http://refhub.elsevier.com/S0960-8524(15)01604-1/h0160http://refhub.elsevier.com/S0960-8524(15)01604-1/h0160http://refhub.elsevier.com/S0960-8524(15)01604-1/h0160http://refhub.elsevier.com/S0960-8524(15)01604-1/h0165http://refhub.elsevier.com/S0960-8524(15)01604-1/h0165http://refhub.elsevier.com/S0960-8524(15)01604-1/h0165http://refhub.elsevier.com/S0960-8524(15)01604-1/h0170http://refhub.elsevier.com/S0960-8524(15)01604-1/h0170http://refhub.elsevier.com/S0960-8524(15)01604-1/h0170http://refhub.elsevier.com/S0960-8524(15)01604-1/h0170http://refhub.elsevier.com/S0960-8524(15)01604-1/h0175http://refhub.elsevier.com/S0960-8524(15)01604-1/h0175http://refhub.elsevier.com/S0960-8524(15)01604-1/h0175http://refhub.elsevier.com/S0960-8524(15)01604-1/h0175http://refhub.elsevier.com/S0960-8524(15)01604-1/h0175http://refhub.elsevier.com/S0960-8524(15)01604-1/h0175http://refhub.elsevier.com/S0960-8524(15)01604-1/h0175http://refhub.elsevier.com/S0960-8524(15)01604-1/h0170http://refhub.elsevier.com/S0960-8524(15)01604-1/h0170http://refhub.elsevier.com/S0960-8524(15)01604-1/h0170http://refhub.elsevier.com/S0960-8524(15)01604-1/h0170http://refhub.elsevier.com/S0960-8524(15)01604-1/h0165http://refhub.elsevier.com/S0960-8524(15)01604-1/h0165http://refhub.elsevier.com/S0960-8524(15)01604-1/h0165http://refhub.elsevier.com/S0960-8524(15)01604-1/h0160http://refhub.elsevier.com/S0960-8524(15)01604-1/h0160http://refhub.elsevier.com/S0960-8524(15)01604-1/h0160http://refhub.elsevier.com/S0960-8524(15)01604-1/h0160http://refhub.elsevier.com/S0960-8524(15)01604-1/h0155http://refhub.elsevier.com/S0960-8524(15)01604-1/h0155http://refhub.elsevier.com/S0960-8524(15)01604-1/h0155http://refhub.elsevier.com/S0960-8524(15)01604-1/h0150http://refhub.elsevier.com/S0960-8524(15)01604-1/h0150http://refhub.elsevier.com/S0960-8524(15)01604-1/h0150http://refhub.elsevier.com/S0960-8524(15)01604-1/h0145http://refhub.elsevier.com/S0960-8524(15)01604-1/h0145http://refhub.elsevier.com/S0960-8524(15)01604-1/h0145http://refhub.elsevier.com/S0960-8524(15)01604-1/h0145http://refhub.elsevier.com/S0960-8524(15)01604-1/h0140http://refhub.elsevier.com/S0960-8524(15)01604-1/h0140http://refhub.elsevier.com/S0960-8524(15)01604-1/h0140http://refhub.elsevier.com/S0960-8524(15)01604-1/h0135http://refhub.elsevier.com/S0960-8524(15)01604-1/h0135http://refhub.elsevier.com/S0960-8524(15)01604-1/h0135http://refhub.elsevier.com/S0960-8524(15)01604-1/h0130http://refhub.elsevier.com/S0960-8524(15)01604-1/h0130http://refhub.elsevier.com/S0960-8524(15)01604-1/h0130http://refhub.elsevier.com/S0960-8524(15)01604-1/h0125http://refhub.elsevier.com/S0960-8524(15)01604-1/h0125http://refhub.elsevier.com/S0960-8524(15)01604-1/h0125http://refhub.elsevier.com/S0960-8524(15)01604-1/h0120http://refhub.elsevier.com/S0960-8524(15)01604-1/h0120http://refhub.elsevier.com/S0960-8524(15)01604-1/h0115http://refhub.elsevier.com/S0960-8524(15)01604-1/h0115http://refhub.elsevier.com/S0960-8524(15)01604-1/h0115http://refhub.elsevier.com/S0960-8524(15)01604-1/h0115http://refhub.elsevier.com/S0960-8524(15)01604-1/h0110http://refhub.elsevier.com/S0960-8524(15)01604-1/h0110http://refhub.elsevier.com/S0960-8524(15)01604-1/h0105http://refhub.elsevier.com/S0960-8524(15)01604-1/h0105http://refhub.elsevier.com/S0960-8524(15)01604-1/h0105http://refhub.elsevier.com/S0960-8524(15)01604-1/h0100http://refhub.elsevier.com/S0960-8524(15)01604-1/h0100http://refhub.elsevier.com/S0960-8524(15)01604-1/h0100http://refhub.elsevier.com/S0960-8524(15)01604-1/h0095http://refhub.elsevier.com/S0960-8524(15)01604-1/h0095http://refhub.elsevier.com/S0960-8524(15)01604-1/h0095http://refhub.elsevier.com/S0960-8524(15)01604-1/h0095http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0090http://refhub.elsevier.com/S0960-8524(15)01604-1/h0090http://refhub.elsevier.com/S0960-8524(15)01604-1/h0090http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0085http://refhub.elsevier.com/S0960-8524(15)01604-1/h0085http://refhub.elsevier.com/S0960-8524(15)01604-1/h0085http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0080http://refhub.elsevier.com/S0960-8524(15)01604-1/h0080http://refhub.elsevier.com/S0960-8524(15)01604-1/h0080http://refhub.elsevier.com/S0960-8524(15)01604-1/h0080http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0075http://refhub.elsevier.com/S0960-8524(15)01604-1/h0075http://refhub.elsevier.com/S0960-8524(15)01604-1/h0075http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0070http://refhub.elsevier.com/S0960-8524(15)01604-1/h0070http://refhub.elsevier.com/S0960-8524(15)01604-1/h0070http://refhub.elsevier.com/S0960-8524(15)01604-1/h0070http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0065http://refhub.elsevier.com/S0960-8524(15)01604-1/h0065http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0060http://refhub.elsevier.com/S0960-8524(15)01604-1/h0060http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0055http://refhub.elsevier.com/S0960-8524(15)01604-1/h0055http://refhub.elsevier.com/S0960-8524(15)01604-1/h0055http://refhub.elsevier.com/S0960-8524(15)01604-1/h0055http://refhub.elsevier.com/S0960-8524(15)01604-1/h0055http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0050http://refhub.elsevier.com/S0960-8524(15)01604-1/h0050http://refhub.elsevier.com/S0960-8524(15)01604-1/h0050http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0045http://refhub.elsevier.com/S0960-8524(15)01604-1/h0045http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0040http://refhub.elsevier.com/S0960-8524(15)01604-1/h0040http://refhub.elsevier.com/S0960-8524(15)01604-1/h0040http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0035http://refhub.elsevier.com/S0960-8524(15)01604-1/h0035http://refhub.elsevier.com/S0960-8524(15)01604-1/h0035http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0030http://refhub.elsevier.com/S0960-8524(15)01604-1/h0030http://refhub.elsevier.com/S0960-8524(15)01604-1/h0030http://refhub.elsevier.com/S0960-8524(15)01604-1/h0030http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0025http://refhub.elsevier.com/S0960-8524(15)01604-1/h0025http://refhub.elsevier.com/S0960-8524(15)01604-1/h0025http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0020http://refhub.elsevier.com/S0960-8524(15)01604-1/h0020http://refhub.elsevier.com/S0960-8524(15)01604-1/h0020http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0015http://refhub.elsevier.com/S0960-8524(15)01604-1/h0015http://-/?-http://refhub.elsevier.com/S0960-8524(15)01604-1/h0010http://refhub.elsevier.com/S0960-8524(15)01604-1/h0010http://-/?-

Documents

1-s2.0-S0960852415016041-main