in

l AMilwcolo

a r t i c l e i n f o

Article history:Received 7 January 2014Received in revised form 19 May 2014Accepted 29 May 2014

a b s t r a c t

Despite the severity and prevalence of SCD-associated pain, theunderlying mechanisms remain poorly understood.

al afferentents of h

subtypes of Ab, Ad, and C bers exhibiting heightened responsesto both noxious mechanical and light touch stimuli [17,20]. In con-junction with altered central nervous system processing, enhancedperipheral cold detection may contribute to cold hypersensitivityin SCD.

The ability of sensory neurons to detect cold temperatures hasbeen attributed to the cold activation properties of ion channelsin peripheral nerve terminals. Transient receptor potential

Corresponding author. Address: Department of Cell Biology, Neurobiology andAnatomy, Medical College of Wisconsin, 8701 Watertown Plank Road, Milwaukee,WI 53226, USA. Tel.: +1 (414) 955 8373; fax: +1 (414) 955 6517.

E-mail address: cstucky@mcw.edu (C.L. Stucky).1 K.J.Z. and S.R.G. contributed equally to this work.

PAIN155 (2014) 247stimuli including light wind, brushing of the skin [41], andenhanced detection of and pain sensitivity to mild cold [8,38,49].

gesia and allodynia. Recently, we reported that primary afferentbers in sickle mice are sensitized to mechanical stimuli, withtivity during adulthood [8,54]. The lives of patients with SCD arefurther affected by pain elicited by a host of innocuous common

altered in sickle mice. Sensitization of periphermay correlate with the psychophysical measuremhttp://dx.doi.org/10.1016/j.pain.2014.05.0300304-3959/ 2014 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.ight bebers

yperal-1. Introduction

In sickle cell disease (SCD), sickle hemoglobin in erythrocytespolymerizes under low oxygen conditions, distorting the cellshape, leading to sporadic vaso-occlusive crises and tissue ische-mia [21,39,54]. Although the most severe pain occurs during theseacute, tissue-damaging crises, many patients (50%) also developchronic baseline pain and experience heightened cutaneous sensi-

Recent evidence has shown that the Berkeley mouse model ofsevere sickle cell disease, in which mice express either 100% sickleor normal human hemoglobin [43], exhibits increased reexivenocifensive behaviors in response to static cold (4C and 20C)[9,20]. However, the static cold temperature assay does not reectthe mouses preferred temperature environment, nor does it offersufcient resolution to quantify the degree of cold aversion.Therefore, there is a need to address how thermotaxis mKeywords:TRPA1TRPM8Endothelin 1C berAgingKCNKSickle cell disease (SCD) is associated with acute vaso-occlusive crises that trigger painful episodes andfrequently involves ongoing, chronic pain. In addition, both humans and mice with SCD experienceheightened cold sensitivity. However, studies have not addressed the mechanism(s) underlying the coldsensitization or its progression with age. Here we measured thermotaxis behavior in young and agedmice with severe SCD. Sickle mice had a marked increase in cold sensitivity measured by a cold prefer-ence test. Furthermore, cold hypersensitivity worsened with advanced age. We assessed whetherenhanced peripheral input contributes to the chronic cold pain behavior by recording from C bers, manyof which are cold sensitive, in skin-nerve preparations. We observed that C bers from sickle mice dis-played a shift to warmer (more sensitive) cold detection thresholds. To address mechanisms underlyingthe cold sensitization in primary afferent neurons, we quantied mRNA expression levels for ion channelsthought to be involved in cold detection. These included the transient receptor potential melastatin 8(Trpm8) and transient receptor potential ankyrin 1 (Trpa1) channels, as well as the 2-pore domain potas-sium channels, TREK-1 (Kcnk2), TREK-2 (Kcnk10), and TRAAK (Kcnk4). Surprisingly, transcript expressionlevels of all of these channels were comparable between sickle and control mice. We further examinedtranscript expression of 83 additional pain-related genes, and found increased mRNA levels for endothe-lin 1 and tachykinin receptor 1. These factors may contribute to hypersensitivity in sickle mice at both theafferent and behavioral levels. 2014 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.Sponsorships or competing interests that may be relevant to content are disclosed at the end of this article.Research papers

Cold hypersensitivity increases with age

Katherine J. Zappia a,1, Sheldon R. Garrison a,1, CheryaDepartment of Cell Biology, Neurobiology and Anatomy, Medical College of Wisconsin,bDepartment of Pediatrics and Childrens Research Institute, Division of Hematology/OncBlood Research Institute, BloodCenter of Wisconsin, Milwaukee, WI, USAmice with sickle cell disease

. Hillery b,c, Cheryl L. Stucky a,aukee, WI, USA

gy, Medical College of Wisconsin, Milwaukee, WI, USA

www.e l sev ie r . com/ loca te /pa in

62485

15melastatin 8 (TRPM8) is reported to directly transduce mild cool-ing stimuli and is implicated in contributing to moderate and morenoxious cold transduction [6,27,36]. Likewise, transient receptorpotential ankyrin 1 (TRPA1) contributes to cold sensitivity in mul-tiple neuropathic and inammatory states [11,12,42], and has beendebated as a contributor to noxious cold transduction in naive con-ditions [5,26,31,32,55]. Other channels involved in cold sensationinclude the 2-pore domain potassium channels TREK-1 (KCNK2)[40], TREK-2 (KCNK10) [24], and TRAAK (KCNK4) [24,40]. Beyonddirect ion channel gating, an overall increase in afferent excitabilityin SCD may also contribute to enhanced cold stimulus detection.

We rst assessed cold sensitivity of sickle mice using a temper-ature preference assay. Because cold sensitivity relies on the coldactivation of peripheral sensory neurons, we also assessed the coldresponses of C ber nociceptors using teased ber recordings[29,48]. Calcium imaging was used to determine whether sensoryneurons of sickle and control mice have altered responses to ago-nists of TRPM8 and TRPA1. In addition, we measured mRNAexpression levels of known cold-sensitive ion channels and of 83additional pain-related genes that may contribute to the peripheralneuron sensitization in sickle mice. To determine how theobserved phenotype changes with age, we also performed behav-ioral analyses and mRNA expression studies using aged SCDanimals.

2. Methods

2.1. Animals

In the Berkeley model of sickle cell disease, sickle mice (HbSS)express 100% sickle human hemoglobin in circulating erythrocytes,and this model mimics many pathological features of severe SCD inhumans [43]. Control mice were either transgenic control (HbAA)mice that express 100% normal human hemoglobin on the samemixed Berkeley background or C57BL/6 wild-type mice (identiedwhere appropriate throughout the manuscript). Cain et al. havepreviously shown that the C57BL/6 and HbAA mice have similarsensitivity to cold stimuli by assessing paw withdrawal latencyand frequency [9]. Male sickle and control mice were usedthroughout these studies. Adult sickle mice and controls averaged7.9 0.3 months old; aged mice averaged 18.4 0.4 months old, apoint beyond which sickle mice show a rapid increase in mortality.The experimenters were blinded to genotype for behavioral studiesand, wherever possible, for teased ber and calcium imaging stud-ies. The care and use of animals, along with the experimental pro-tocols used, were reviewed and approved by the Medical College ofWisconsin Institutional Animal Care and Use Committee.

2.2. Behavioral testing

For temperature preference assessment, HbSS or HbAA animalswere placed in a 13-inch square Plexiglas chamber in which theoor is a dual temperature-controlled metal plate allowing inde-pendent temperature control for each side (AHP1200-HCP, TECACorp, Chicago, IL). The testing apparatus was placed in a constantlocation within a dedicated behavior testing room, and all spatialcues remained constant throughout all experiments. All animalswere habituated to the chamber (with 30C on both plates) for20 minutes before testing. For all temperature preference tests,both the time spent on each plate and the number of times the ani-mal crossed the midline to the opposite side were recorded duringa 5-minute testing period. Baseline measurements were performedon the rst day of testing; animals were individually placed in the

K.J. Zappia et al. / PAINchamber with both oor plates set at 30C (gently warm to thetouch). Animals were then tested for preference between either23C and 30C, or 20C and 30C. To control for a preferred plateside, we randomly altered both the plate where we introducedthe animal (either the 23C and 30C side or the 20C and 30Cside) and the temperatures on each plate. We have found thatexcessive testing reduces the exploratory behavior of the animals,as determined by a decrease in the number of crosses during thelater tests in preliminary studies (data not shown). Some groupsof animals were also tested after experimentally induced hypoxia(2 hours of hypoxia at 10% O2, followed by 3.5 hours at room air).Because multiple tests were performed on the same animal,including testing before and after hypoxia, the baseline preferenceat 30:30 was not repeated. The same animals were used before andafter hypoxia to make the most direct comparison regarding theeffect of hypoxia treatment. The experimenter was blinded tomouse genotype during testing.

To determine the extent of sensitivity to light mechanical touch,we used a Light Touch Behavioral Assay [16]. HbSS or HbAA micewere placed on a wire mesh platform in an enclosure, and habitu-ated to this apparatus for 1 hour before testing. For this assay, theglabrous skin of the plantar hind paw was tested by applying alight, punctate 0.7 mN von Frey lament 10 times to each hindpaw, and separately applying a dynamic light stimulus using apuffed cotton swab applied 5 times to each hind paw. Care wastaken to avoid stimulating hair follicles during testing. For allmechanical behavior assays, we averaged the responses betweenboth hind paws, as no side difference would be expected withSCD. As before, the experimenter was blinded to mouse genotype.

2.3. Teased ber skin-nerve recordings

The ex vivo saphenous skin-nerve preparation was used todetermine the response properties of cutaneous primary afferentbers in HbAA and HbSS mice following established protocols[48]. Briey, ex vivo skin-nerve preparations were dissected fromHbSS and control mice and immediately placed into a recordingchamber superfused with oxygenated synthetic interstitial uidat 32C 0.5C [29]. The skin was placed in the chamber coriumside up. The saphenous nerve was desheathed and teased to distin-guish functionally discrete bers, which were single active bersresiding in a lament and which had a dened, isolated receptiveeld in the skin. A combined electrical and mechanical search ofthe corium side of the skin using a blunt glass rod was used to ndactive bers, and an electrical stimulus was used to identify func-tionally single bers.

Fibers were characterized by mechanical threshold using cali-brated von Frey laments (range 0.044147.0 mN) and conductionvelocity. Conduction velocity was measured by inserting a Teon-coated steel stimulating electrode into the most mechanically sen-sitive area of the receptive eld and applying square-wave pulses(500 ls). Action potential latency and the distance betweenelectrodes were quantied to determine conduction velocity.Functional units were classied by conduction velocity and adap-tation properties, as previously described [32]. Fibers conducting61.2 m per second were C bers; all recordings described hereinwere obtained from C bers.

Once functionally single C bers were isolated, a 2-minute base-line recording was taken to assess spontaneous, nonstimulus-evoked activity. This activity rate was subtracted from subsequentrecordings of the same ber. A 20-second cold ramp of buffer from32C to 2C was applied to the receptive eld. We reasoned thatsuch a cold ramp would be better than a static cold temperaturepulse to identify a cold ring threshold and cold-induced responsesto a wide range of temperatures. C bers were considered cold sen-sitive if they responded to cold stimulation with at least 2 action

5 (2014) 24762485 2477potentials more than the average spontaneous activity rate. Actionpotential waveforms were visualized on an oscilloscope and audi-bly monitored using an audio amplier and speaker. Extracellular

15recordings of action potentials were recorded and analyzed usingLabChart 6 data acquisition software (ADInstruments, ColoradoSprings, CO) on a personal computer (PC) for ofine analysis.

2.4. Calcium imaging

Lumbar 1 to 6 dorsal root ganglia (DRG) neurons were isolatedbilaterally from HbSS and C57 mice and placed in Hanks BalancedSalt Solution (Gibco, Life Technologies, Carlsbad, CA). DRG neuronswere cultured as previously described [4]. Ganglia were dissoci-ated into single somata via enzymatic digestion and triturationthrough a P200 pipette tip. The neurons were plated onto lami-nin-coated glass coverslips and incubated overnight to allowadherence. The neurons were provided with complete cell mediumconsisting of Dulbeccos modied Eagles medium (DMEM)/Hams-F12 medium supplemented with 10% heat-inactivated equineserum, 2 mmol/L L-glutamine, 0.8% D-glucose, 100 units penicillin,and 100 lg/mL streptomycin. No exogenous growth factors wereadded.

Calcium imaging was performed on small-diameter neurons(20% above baseline was considered a response. At the end of eachprotocol, a 50-mmol/L KCl solution was applied to depolarize neu-rons, thereby allowing identication of viable small diameter sen-sory neurons.

2.5. Gene expression

Gene expression studies were performed on isolated dorsal rootganglia (T5L6) removed from HbSS and HbAA mice. DRGs weredissected and stored overnight in RNAlater at 20C. RNA was iso-lated using TRIzol Reagent following the manufacturers recom-mendations (LifeTechnologies, Carlsbad, CA). Total RNA wasanalyzed with a NanoDrop Lite spectrophotometer (Thermo Scien-tic, Wilmington, DE), and integrity was assessed via visualizationwith ethidium bromide in a 1% agarose gel.

For assessment of individual ion channel mRNA expression lev-els, quantitative polymerase chain reaction (PCR) was performedon a Mastercycler ep Realplex2 thermal cycler (Eppendorf,

2478 K.J. Zappia et al. / PAINHamburg, Germany). RNA was reverse-transcribed to cDNA usingSuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad,CA). Real-time PCR was performed with SYBR Green using thefollowing primers: Trpa1 (forward: GCTTTTGGCCTCAGCTTT, reverse:CTCGATAATTGATGTCTCCTAGCA), Trpm8 (forward: GTCTTCGTCCTCTTCTGTGAT, reverse: ACAATACCCGCTATGAAGTAGAAG), Trek1(Kcnk2, IDT PrimeTime qPCR Assay Mm.PT.56a.14314703, Inte-grated DNA Technologies, Coralville, IA), Traak (Kcnk4, IDT assayMm.PT.56a.7651558), and Trek2 (Kcnk10, IDT assay Mm.PT.56a.30470172). Expression of glyceraldehyde 3-phosphate dehy-drogenase (Gapdh) was used as a housekeeping control gene(forward: AATGGTGAAGGTCGGTGTG, reverse: GTGGAGTCATACTGGAACATGTAG). The PCR conditions for Trpa1 and Trpm8 were 40cycles of 15 seconds at 95C, 30 seconds at 57C, and 30 secondsat 72C, followed by melting curve analysis to ensure specicityof gene amplication. Conditions for Kcnk2 and Kcnk10 were 40cycles of 15 seconds at 95C, 30 seconds at 57C, and 20 secondsat 72C; those for Kcnk4 were 40 cycles of 15 seconds at 95C,25 seconds at 58C, and 20 seconds at 72C. Calculations of com-parative fold changes in mRNA expression levels between groupsused a comparative Ct method, using DDCt with normalization toGapdh.

A PCR array of 84 genes related to neuropathic and inamma-tory pain (SABiosciences, Venlo, Netherlands) was also performedon RNA extracted from DRGs (levels T5L6) isolated from HbSS(n = 6) and HbAA (n = 7) mice. These PCR arrays are based onreal-time PCR using optimized primer sets that have been vali-dated by the manufacturer. For this assay, RNA was reverse tran-scribed using a protocol outlined by SABiosciences for use withtheir PCR arrays. PCR conditions were used per the manufacturersprotocol. Gene expression was normalized to the following 3housekeeping genes: Gapdh, b-actin, and heat shock protein 90a(cystosolic class B member 1) (Hsp90ab1). Also included were amouse genomic DNA contamination control, a reverse transcrip-tion control, and a positive PCR control.

2.6. Data analysis

Temperature preference (percentage of time spent on a givenside) was analyzed by 2-way analysis of variance (ANOVA), com-paring young and old mice, using a Bonferroni post hoc test. Anadditional repeated-measures 2-way ANOVA with Bonferroni posthoc was used to compare temperature preference with or withouthypoxia treatment. The number of crosses performed during ther-mal preference testing was analyzed in a similar manner. Baselinebehavior on the thermal plate at 30C was compared to a hypothet-ical value of 50% with a 1-sample t test for both genotypes. Thepercentage of cold-responsive C bers in skin-nerve recordingswas analyzed with Fishers exact tests. The percentage of neuronsresponding to the chemical agonists (cinnamaldehyde and men-thol) in calcium imaging experiments was also analyzed withFishers exact tests. Expression of individual genes was comparedamong 4 groups (2 ages 2 genotypes) using a 2-way ANOVAand a Bonferroni post hoc. Gene expression levels measured inthe PCR array were analyzed with the DDCt method using RT2 Pro-ler PCR Array Data Analysis software provided by SABiosciences(Qiagen). Data from the remaining assays were compared using2-tailed Student t tests when 2 groups were considered. Data wereanalyzed using Prism software (GraphPad, La Jolla, CA). Resultswere considered statistically signicant when P < 0.05. In theResults section, below, data are presented as mean standard errorof the mean (SEM).

3. Results

3.1. Enhanced cold avoidance in sickle mice

5 (2014) 24762485We have previously reported that sickle mice exhibit a height-ened sensitivity to static cold temperatures (20C) [20], and others

have reported hypersensitivity to extreme cold (4C) [9]. Althoughthis is one method used to identify cold hyperalgesia in sickle mice,it does not recapitulate the hypersensitivity that humans with SCDexperience in response to smaller changes in environmental coldstimuli. Therefore, we used a temperature preference assay usinga milder cold temperature with reduced deviation from skin tem-perature, in which one plate was set to 23C and the other to 30C.This assay also removes possible bias from observers interpreta-tion of mouse responses. Our baseline measurement, with bothplates set to 30C, revealed a similar amount of time spent on eachplate (Fig. 1A, left) and number of crosses between plates (Fig. 1B,left). This ensured that there was no overall baseline preference forone side of the chamber based on spatial or other cues. We thenallowed HbSS or HbAA control mice to choose between the 23Cand 30C plates. We found a marked decrease in the time thatsickle mice spent on the 23C plate (36.3% 4.0% spent on cold).HbAA mice exhibited no aversion to the 23C plate, as they spent

ex vivo skinsaphenous nerve preparation and quantied the num-ber of action potentials red during a 20-second cold buffer rampfrom 32C to 2C applied to the cutaneous receptive eld. C berswere considered cold sensitive if they responded to the cold rampwith more than 2 action potentials above the bers averagespontaneous activity rate. We found a similar percentage ofcold-sensitive C bers from sickle mice (57%) compared to HbAAcontrols (52%) (Fig. 2A). Of these cold-sensitive C bers, those fromsickle mice responded at higher (warmer) temperatures of thecold ramp, with a cold threshold at 19.2C 1.2C compared to14.6C 1.6C in HbAA controls (Fig. 2B). However, the cold-sensitive C bers from HbSS and HbAA mice red similar numbersof cold-evoked action potentials during the cold ramp (Fig. 2C;P = 0.14). Together, these data showing warmer cold thresholdssuggest that peripheral afferent terminals are sensitized to cold.

3.3. Aged sickle mice exhibit increasing sensitivity to cold

ed sine)n th

K.J. Zappia et al. / PAIN155 (2014) 24762485 247946.1% 2.5% on the cold plate (Fig. 1A, left). Sickle mice and con-trols explored both thermal plates equally, as there was no differ-ence in the number of crosses between genotypes (Fig. 1B, left).

We then used 2 hours of hypoxia to further exacerbate the SCDphenotype to promote acute sickling. At 3.5 hours after returningto room air after hypoxia exposure, mouse behavior was againtested using the 23C and 30C plates. Sickle mice exhibited amarked aversion to the cold plate, and spent signicantly less timeon the cold plate than did the HbAA controls (Fig. 1A, right). Sicklemice also exhibited a trend toward a decreased time spent on thecold plate after hypoxia compared to their preference beforehypoxia (P = 0.08). On the other hand, control HbAA miceresponded to the 23C cold plate similarly before and after hypoxia(P = 0.60). We then decreased cold plate temperature further to20C from 23C to evoke a response from control mice and to com-pare these responses with those from sickle mice. The sickle micecontinued to exhibit increased cold sensitivity when compared tothe HbAA controls and to their initial baseline test (Fig. 1A). Therewas no difference in the number of crosses between groups afterhypoxia, showing that sickle mice did not have less general activitycompared to control mice (Fig. 1B, right).

3.2. Sensitization of C bers contributes to cold hypersensitivity

Chronic pain associated with disease can have both peripheraland central components. Therefore, to address one peripheral com-ponent, we asked whether peripheral afferent neurons in sicklemice were sensitized to cold. To test for increased sensitivity alongthe afferent axon and terminals of cutaneous C bers, we used the

Fig. 1. Sickle mice display cold temperature aversion, which is enhanced after inducsides of the thermal preference plate at baseline when both sides are at 30 (baseldifferent from chance during a 5-minute test (50%, P > 0.05). When the temperature o

plate compared to their baseline preferences (P < 0.01). After hypoxia and reoxygenatcontrol animals, when tested on cold plates of both 23C (P < 0.05) and 20C (P < 0.05).number of plate crosses compared between sickle and HbAA control animals (P > 0.05).In humans, sickle cell disease involves the development ofchronic pain [54]. Importantly, human patients with sickle cell dis-ease also have heightened sensitivity to cold stimulation, reportingboth cold pain and cold detection at lower thresholds (warmertemperatures) [8]. In that study, older age was also associated withlowered (warmer) thresholds for both cold pain and detection(interquartile range of all study participants with SCD, 1119 years); this was observed in both the sickle cell disease groupand the healthy control group. This suggests that the cold hyper-sensitivity in sickle mouse populations may also increase withage. To test this, we repeated the temperature preference assayin aged sickle and control HbAA mice (average age, 18.4 months),at an age corresponding to a much older human population (age56+ years) [14]. Although we and others have reported increasedthermal and mechanical sensitivity of younger adult sickle mice[9,17,20,28], sensitivity has not been assessed in aged sickle mice.When compared with younger adult animals (average age,7.9 months; Figs. 1 and 3), we found enhanced cold aversion inaged sickle mice, which spent only 15.9% 3.6% of the time onthe 23C cold plate, compared to 36.2% 4.0% in the younger HbSSadults (Fig. 3A, left). The aged HbAA mice continued to show littleaversion to the 23C cold plate (Fig. 3A). There were no differencesbetween the number of crosses performed by HbAA and HbSSmice, showing that aged sickle mice did not have decreased gen-eral exploratory activity compared to aged control mice (Fig. 3B,right).

The enhanced cold aversion in aged sickle mice prompted us toask if there was a more generalized age-related behavioral change.

ickling crises. (A) Both HbAA and HbSS male mice show no preference between the, as evidenced by both groups spending time on one side at a rate not signicantlye test plate was reduced to 23C, HbSS mice spent signicantly less time on the cold

ion, sickle animals showed an enhanced avoidance of the cold plate compared to(B) During all behavioral thermal preference tests, there were no differences in the

152480 K.J. Zappia et al. / PAINBecause human populations report increased pain in elderly sicklepatient populations [54], and because we previously found hyper-sensitivity to light touch in sickle mice, we used a Light TouchBehavioral Assay on the aged mice. As expected, we foundincreased light touch sensitivity in the HbSS mice compared toage-matched HbAAmice when testing an aged population (Supple-mentary Fig. 1A and B). However, unlike the enhanced age-relatedcold sensitivity in aged HbSS mice, there was no change in sensitiv-ity to light mechanical touch in aged sickle mice compared toyounger adult sickle mice.

Fig. 2. C bers from sickle mice are sensitized to cold stimuli. (A) C bers isolated fromHbAA control C bers. (B) Cold-activated C bers from sickle mice had signicantly lowetemperatures than HbAA controls (P < 0.05). (C) There was no signicant difference in tmice in response to cold stimulation (P = 0.1848).

Fig. 3. Cold aversion increases with age in sickle mice. Aged mice were on average 18behavior was tested using a thermally controlled oor with one side at 30C and the othercolder plate during a 5-minute test. (A) Aged male HbSS mice portrayed heightened cold aHbSS mice showed much greater cold aversion than their aged control counterparts (Pthermal preference compared to younger adult HbAA mice (P > 0.05). (B) There were n(P > 0.05).5 (2014) 247624853.4. Expression of known cold-sensitive channels does not change insickle sensory neurons

The cold phenotype at both the behavioral and afferent terminallevels led us to ask what ion channels might be contributing to theincreased neuronal excitability. Because transduction of the coldstimulus by the neuron may be affected, we investigated sensoryneuron expression of the known cold-sensitive channel TRPM8[36]. We also quantied expression levels of TRPA1, which has beenreported to be involved in cold sensitivity [31,55], particularly in

sickle mice were activated by cold stimulation at a similar proportion compared tor cold detection thresholds, meaning they responded to cold stimulation at warmerhe number of action potentials red by cold-responsive C bers from SCD or HbAA

.4 (0.4) months; younger adult mice were on average 7.9 (0.3) months. Mouseside at 23C, and cold aversion was measured as the percentage of time spent on theversion compared with younger adult HbSS mice (P < 0.001). In addition, the aged< 0.0001). Aged male HbAA mice (controls) showed no difference in cold aversion oro differences in the number of crosses performed by older control or HbSS mice

circumstances of tissue injury [11,12,42]. In addition, a change infunctional expression of TRPM8 or TRPA1 could contribute toafferent activity. Therefore, we used TRPM8 and TRPA1 agonists(menthol and cinnamaldehyde, respectively) to quantify both thepercentage of TRPM8- and TRPA1-expressing small-diameter neu-rons and their response amplitude, as many of these small neuronscorrespond to C bers in vivo, and they comprise a signicant pop-ulation of nociceptors and thermoreceptors. We expected to nd anincrease in responsiveness to agonists of TRPM8, TRPA1, or both inDRG neurons from sickle mice. Using calcium imaging, we found nodifferences in the percentage of neurons that responded to submax-imal concentrations of either the TRPM8 agonist menthol (Fig. 4A)or the TRPA1 agonist cinnamaldehyde (Fig. 4C). This suggests thatthere are equal proportions of TRPM8- and TRPA1-expressingsmall-diameter neurons in sickle and control C57 mice. Further-more, we found no increase in the amplitude of response to eitheragonist (Fig. 4B and D). This result suggests that TRPM8- andTRPA1-independent mechanisms are likely mediating theenhanced cold response in sickle mice.

We concurrently quantied expression of Trpm8 and Trpa1mRNA expression levels in whole DRGs that contain the cell bodiesof all sensory afferent subpopulations (Ab, Ad, and C ber neurons)by quantitative PCR. All mRNA expression studies were performedusing HbSS and HbAA mice. In agreement with our ndings fromthe calcium imaging data with TRPM8 and TRPA1 agonists, wefound no differences in mRNA expression levels between HbSSand HbAA mice (Trpa1, Fig. 5A; Trpm8, Fig. 5C). Moreover, becausewe found that cold hypersensitivity increased in aged sickle micebehaviorally, we quantied expression levels in aged DRG neurons.Again, we found no differences between aged sickle and controlneurons (Trpa1, Fig. 5B; Trpm8, Fig. 5D). We then quantied the

has linked these channels to altered cold responses [24,40]. Wealso observed no differences in the mRNA expression levels ofany of these channels (Fig. 5E).

3.5. Sickle DRGs have increased expression of tachykinin receptor 1and endothelin 1

Our previous work has shown that using a TRPV1-specicantagonist results in reduced mechanical hypersensitivity in sicklemice [20]. TRPV1 is not known to be mechanically sensitive, andtherefore it is likely that there is an upregulation of a diverse setof proteins that may underlie the increased responses of primaryafferents to cold and to touch by sensitizing TRPV1 and one ormore cold-sensitive channels. Therefore we investigated the tran-script expression levels of a broad range of genes in DRGs that havebeen documented to be involved in pain and inammation andthat might contribute to the SCD phenotype. Using a PCR array of84 genes commonly implicated in pain sensation, we observed lim-ited dysregulation of gene expression between DRGs from youngeradult HbSS and HbAA control animals (Supplementary Table 1). Forexample, there were no changes in glial cell linederived neurotro-phic factor, nerve growth factor, GTP cyclohydrolase 1, or theassessed interleukins, bradykinin receptors, purinergic receptors,cannabinoid receptors, adenosine receptors, or prostaglandinreceptors. However, mRNA expression level of the tachykinin recep-tor 1 (neurokinin 1 receptor; substance P receptor) was increased2.7-fold in DRGs from sickle animals compared to control animals(Supplementary Table 1). Expression of the precursor gene of theligand of tachykinin receptor 1 (Tac1; tachykinin; preprotachyki-nin) was not altered between SCD and control animals.

In addition, expression of the ligand endothelin 1 also increased

xpreponseur

K.J. Zappia et al. / PAIN155 (2014) 24762485 2481potassium channels Kcnk2, Kcnk4, and Kcnk10, because evidence

Fig. 4. Sickle and control (C57) dorsal root ganglia (DRGs) have similar functional econtrol (C57BL/6) and sickle mice were exposed to 100 lmol/L menthol and their resand sickle mice responded to the chemical stimulation. (B) Control (C57) and sickle n

inux, as measured by percent increase in Fura-2 ratio over baseline measurements. (cinnamaldehyde. There was no signicant difference in the percentage of sickle or controalso responded to 70 lmol/L cinnamaldehyde stimulation with similar amplitude increa1.6-fold in sickle DRGs compared to controls (Supplementary

ssion of cold-sensitive ion channels. (A) Isolated small-diameter DRG neurons fromes assessed via calcium imaging. A similar percentage of small neurons from controlons responded to 100 lmol/L menthol with a similar amplitude response of calcium

C) Additional groups of small-diameter DRG neurons were exposed to 70 lmol/Ll neurons responding to cinnamaldehyde stimulation. (D) Control and sickle neuronsses in intracellular calcium.

152482 K.J. Zappia et al. / PAINTable 1). Conversely, we observed no differences in expression ofthe receptor for endothelin 1, endothelin receptor A (ETA). Also ofnote, we observed no differences in mRNA expression of the volt-age-gated sodium channels tested (SCN3A/Nav1.3, SCN9A/Nav1.7,SCN10A/Nav1.8, and SCN11A/Nav1.9). In addition, there was nodysregulation in expression of the remaining genes of the 84assessed genes, including Trpa1, which we had previously investi-gated using traditional quantitative PCR.

4. Discussion

The mechanisms contributing to cold hypersensitivity in SCDpatients and sickle mice are poorly understood. Here we reportincreased cold aversion in sickle mice, which corresponds to previ-ous reports of increased sensitivity to cold in both humans andmice with SCD [8,20,54]. The measurement of thermotaxis behav-ior via temperature preference allows higher-resolution analysis ofcold sensitivity and aversion than previous studies in mice usingstatic cold plates. We report a phenotype in which younger adultsickle mice exhibited enhanced hypersensitivity to mildly coldtemperatures after hypoxia/reoxygenation, which was designedto partially mimic acute sickling crises in humans. These ndingswere similar to our previous report showing that chronic mechan-ical hypersensitivity was exacerbated by oxidative stress [20]. Ourndings also correlate with reports that hypoxia/reoxygenationreduces paw withdrawal latency from a static cold plate at 4C

Fig. 5. Sickle (HbSS) and HbAA control dorsal root ganglia (DRGs) have similar mRNA expmRNA expression of either Trpa1 (A and B) or Trpm8 (C and D) between control and Sdifferences in the expression levels of Kcnk2, Kcnk10, or Kcnk4 measured from DRGs col5 (2014) 24762485[9]. The oxidative stress from reoxygenation may be sufcient tosensitize ion channels involved in cold sensitivity or to upregulatetheir expression.

In addition, we observed that the cold-induced behavioralresponse increased with age selectively in sickle mice, but not inHbAA controls. These results correlate well with ndings that coldsensitivity in the human SCD patient population increases with age[8]. To our knowledge, this is the only clinical study that has quan-titatively addressed the age component of cold sensitivity in SCD.In general, few studies have investigated changes in somatosensa-tion throughout normal aging [7,15], and even fewer studies haverelated sensation and aging in disease conditions. Thus, there is aneed to better understand how chronic disease processes, likethose in SCD, contribute to chronic pain and immeasurably affectquality of life. Beyond the direct sensitivity to cold, some studiessuggest that SCD patients may experience increased pain intensityand frequency in the colder months, even in the absence of sicklingcrisis [41,47,50,53]. This further highlights that the link betweencold and pain in SCD warrants further investigation.

The behavioral cold hypersensitivity in SCD appears to be due,at least in part, to enhanced contribution of peripheral afferentbers. Our ndings demonstrate that peripheral afferent bersfrom sickle mice are sensitized to cold stimuli. Furthermore, ourndings indicate that the sensitization is a stable phenotype thatis not dependent on intact vasculature or concurrent hypoxia. Thisenhanced peripheral contribution in SCD may be also compounded

ression levels of cold-sensitive ion channels. (AD) There were no differences in theCD DRGs obtained from aged or younger adult mice. (E) Similarly, there were nolected from younger adult SCD and HbAA mice (P > 0.05).

15in vivo by central mechanisms, leading to the behavioral coldhypersensitivity. Regarding the peripheral component, one possi-ble mechanism is that the rst-line, cold-sensing mechanism ofthe neurons is altered in either expression levels or function.

To assess whether TRPM8 and TRPA1 are sensitized or function-ally upregulated in SCD, we used a functional approach (calciumimaging). Agonists for these channels linked to cold sensitivity,namely, menthol for TRPM8 and cinnamaldehyde for TRPA1, werechosen because they are selective for those channels at the concen-trations used. However, we found no functional evidence thateither channel is sensitized or upregulated to directly contributeto the altered cold response in SCD mice.

To expand beyond these functional results, we used the moresensitive technique, quantitative PCR, to evaluate expression levelsof Trpa1 and Trpm8, and also of Kcnk2, Kcnk4, and Kcnk10. Althoughwe did not observe dysregulation in the mRNA expression of any ofthe channels tested, it is possible that these channels may be sen-sitized to the effects of cold through some form of posttranslationalmodication, covalent modication, or other form of dynamicinteractions. In addition, there could be a change in localizedexpression, trafcking, or sensitization at the nerve terminals thatis not apparent at the DRG somata.

Sickle mice appear to be sensitized to multiple modalities ofsomatosensory input. This study and others [9,17,20,28] demon-strate that sickle mice are hypersensitive to a range of intensitiesof mechanical stimuli, ranging from light to noxious, and to cold.It is possible that oxidative stress, induced by hypoxia from vaso-occlusion, may lead to dysregulation of proteins that interact withthe cold receptors on sensory neurons. These changes could mod-ulate cold sensitivity without affecting either TRPM8 or TRPA1responses to chemical stimuli, which were used in the calciumimaging studies to assess functional expression. A similar modula-tory mechanism may be occurring with other cold-sensitivechannels.

We expected to nd dysregulation in expression levels of genesknown to be involved in neuropathic and inammatory pain. Wereasoned that, although mechanical and cold sensitivity were bothenhanced in afferent terminals, each modality likely relies on theinvolvement of different protein complexes. The skin-nerverecordings revealed differences in the threshold at which C bersbegan to re cold-evoked action potentials, but no difference inthe number of cold-sensitive afferents or in action potential ringfrequency between sickle and control mice. These data suggest thatproteins involved in cold transduction, and not action potentialpropagation, likely dictate cold sensitivity in the sickle mice. How-ever, our previous ndings showed that it was the mechanicallyevoked action potential ring frequency, not the mechanicalthreshold, which increased in C bers of SCD mice [20], suggestinga possible involvement of proteins that contribute to both mechan-ical amplication and action potential propagation. Therefore, weexpanded our search by using the PCR array of proteins that arewidely involved in pain. This search revealed that DRGs from sicklemice have increased mRNA expression of endothelin 1 and tachy-kinin receptor 1. Interestingly, there was also no change in expres-sion of Nav 1.3, 1.7, 1.8, or 1.9 sodium channels known to beinvolved in action potential threshold or generation [30](Supplementary Table 1).

Endothelin 1 has long been implicated in pain modulation[13,23]. Endothelin 1 may act indirectly, possibly by sensitizingvascular endothelial cells to mechanical stimulation and ATPrelease [22]. It may also act directly at sensory neurons by activat-ing both endothelin receptors ETA and ETB to sensitize TRP chan-nels; ETA and ETB are each co-expressed on approximately 30% of

K.J. Zappia et al. / PAINTRPV1-immunopositive neurons [10], and endothelin 1 modulatesTRPV1 through the ETA receptor [46,60]. TRPA1 may also beinvolved in the pain-like behavior induced by ET1 [34]. Endothelin1 could also lead to neuronal sensitization through other mecha-nisms, as endothelin 1 activity can increase intracellular calciumlevels, activate protein kinases, and alter activation gating ofNav1.8 and Nav1.9 [25].

Interestingly, intradermal injection of endothelin 1 rapidlyinduces cold hyperalgesia in humans [19]. Similarly, blockade ofeither ETA or ETB reduces nerve injuryinduced cold allodynia inrats [59]. Not only is endothelin 1 vastly increased in plasma dur-ing a vaso-occlusive sickling event, it also remains elevated at 1 to3 weeks after hospital discharge after a crisis [18]. Furthermore, astudy in children with SCD showed a positive correlation betweenplasma endothelin 1 levels and self-reported pain during acuteprocedural pain caused by medically required venipuncture [52].As endothelin 1 appears to be increased in both plasma and locallyat the DRGs, endothelin 1 at either location may be contributing tomechanical as well as cold hypersensitivity and pain in SCD. Fur-ther parallel studies of protein expression levels and functionalassays will likely help to determine the functional consequenceof changes in mRNA transcript levels in vivo.

Tachykinin receptor 1 (NK1 receptor) and its primary ligand,substance P, also play a role in pain and sensation [45,56,57]. Inaddition to substance P release at the spinal cord during injury,substance P is also released from the sensory nerve endings intothe peripheral tissues, consequently contributing to cutaneousneurogenic inammation [51]. Cutaneous tissues, includingperipheral nerves and blood vessels, of sickle mice displayenhanced substance P immunoreactivity [28]. Serum levels of sub-stance P are increased in patients with sickle cell disease, and risefurther during painful crises [37]. Mirroring the ndings in humanpatients, substance P is also increased in plasma of SCD mice [58].The same study also showed that neurogenic inammation occursin mice with SCD, and that mast cell activation contributes to thisinammatory state. Interestingly, mast cell inhibition with imati-nib reduces plasma substance P levels to near those found in con-trol mice. Inhibition of mast cell activation with either cromolynsodium or imatinib reduces both substance P and CGRP (calcitoningene-related peptide) release into the skin and in DRGs. Moreover,mast cell inhibition partly ameliorates the hypoxia-induced exac-erbation of hyperalgesia [58]. Thus, mast cell activation and subse-quent substance P release appear to have major implications forpain in SCD.

Although previous studies have focused on sensory neuronrelease of substance P onto NK1 receptorexpressing spinal cordneurons or into skin [1,58], few studies have assessed NK1 receptorexpression or function in dorsal root ganglia. Baseline expressionlevels of NK1 receptor may be low in DRGs [2]; however, an upreg-ulation of expression may lead to previously unstudied effects onsensory neuron excitability. There is evidence suggesting thatNK1 receptors located in both the peripheral and central terminalsof sensory neurons are involved in sensation [33]. Therefore, theupregulation of tachykinin receptor 1 expression at the DRG mayalso contribute to the pain and hypersensitivity in sickle mice.Consequently, examining proteins that modulate pain sensitivityin sickle populations in subsequent studies may provide insightinto the mechanism of SCD-related pain.

Conict of interest statement

The authors declare no conict of interest.

Acknowledgements

We thank Victoria Muller Ewald (MCW/Luther College) for

5 (2014) 24762485 2483assisting with the polymerase chain reaction experiments andMarianne Escobar-Klumph for assistance with calcium imagingexperiments. We also thank Dawn Retherford for helping with

(Elsevier); 2007. p. 63772.

15[15] Gagliese L. Pain and aging: the emergence of a new subeld of pain research. JPain 2009;10:34353.

[16] Garrison SR, Dietrich A, Stucky CL. TRPC1 contributes to light-touch sensationand mechanical responses in low-threshold cutaneous sensory neurons. JNeurophysiol 2012;107:91322.

[17] Garrison SR, Kramer AA, Gerges NZ, Hillery CA, Stucky CL. Sickle cell miceexhibit mechanical allodynia and enhanced responsiveness in light touchcutaneous mechanoreceptors. Mol Pain 2012;8:62.

[18] Graido-Gonzalez E, Doherty JC, Bergreen EW, Organ G, Telfer M, McMillen MA.Plasma endothelin-1, cytokine, and prostaglandin E2 levels in sickle celldisease and acute vaso-occlusive sickle crisis. Blood 1998;92:25515.

[19] Hans G, Deseure K, Robert D, De Hert S. Neurosensory changes in a humanmodel of endothelin-1 induced pain: a behavioral study. Neurosci Lett2007;418:11721.hypoxia administration, and Thomas Foster for assistance withgenerating the sickle mice. This work was completed with supportfrom the National Institutes of Health grants NS070711 (C.L.S. andC.A.H), NS040538 (C.L.S.), HL102836 (C.A.H.), and PA-08-190 Sup-plemental Award to NS07011 (S.R.G.). K.J.Z. is a member of theMCW-MSTP, which is partially supported by a T32 grant from NIG-MS, GM080202. Funding was provided through the Research andEducation Initiative Fund, a component of the Advancing a Health-ier Wisconsin endowment at the Medical College of Wisconsin andthe Midwest Athletes Against Childhood Cancer Fund (CAH).

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.pain.2014.05.030.

References

[1] Abbadie C, Trafton J, Liu H, Mantyh PW, Basbaum AI. Inammation increasesthe distribution of dorsal horn neurons that internalize the neurokinin-1receptor in response to noxious and non-noxious stimulation. J Neurosci1997;17:804960.

[2] Andoh T, Nagasawa T, Kuraishi Y. Expression of tachykinin NK1 receptormRNA in dorsal root ganglia of the mouse. Brain Res Mol Brain Res1996;35:32932.

[3] Bandell M, Story GM, Hwang SW, Viswanath V, Eid SR, Petrus MJ, Earley TJ,Patapoutian A. Noxious cold ion channel TRPA1 is activated by pungentcompounds and bradykinin. Neuron 2004;41:84957.

[4] Barabas ME, Kossyreva EA, Stucky CL. TRPA1 is functionally expressedprimarily by IB4-binding, non-peptidergic mouse and rat sensory neurons.PLoS One 2012;7:e47988.

[5] Bautista DM, Jordt SE, Nikai T, Tsuruda PR, Read AJ, Poblete J, Yamoah EN,Basbaum AI, Julius D. TRPA1 mediates the inammatory actions ofenvironmental irritants and proalgesic agents. Cell 2006;124:126982.

[6] Bautista DM, Siemens J, Glazer JM, Tsuruda PR, Basbaum AI, Stucky CL, Jordt SE,Julius D. The menthol receptor TRPM8 is the principal detector ofenvironmental cold. Nature 2007;448:2048.

[7] Bowden JL, McNulty PA. Age-related changes in cutaneous sensation in thehealthy human hand. Age (Dordr) 2013;35:107789.

[8] Brandow AM, Stucky CL, Hillery CA, Hoffmann RG, Panepinto JA. Patients withsickle cell disease have increased sensitivity to cold and heat. Am J Hematol2013;88:3743.

[9] Cain DM, Vang D, Simone DA, Hebbel RP, Gupta K. Mouse models for studyingpain in sickle disease: effects of strain, age, and acuteness. Br J Haematol2012;156:53544.

[10] Chichorro JG, Fiuza CR, Bressan E, Claudino RF, Leite DF, Rae GA. Endothelins aspronociceptive mediators of the rat trigeminal system: role of ETA and ETBreceptors. Brain Res 2010;1345:7383.

[11] da Costa DS, Meotti FC, Andrade EL, Leal PC, Motta EM, Calixto JB. Theinvolvement of the transient receptor potential A1 (TRPA1) in themaintenance of mechanical and cold hyperalgesia in persistentinammation. PAIN 2010;148:4317.

[12] del Camino D, Murphy S, Heiry M, Barrett LB, Earley TJ, Cook CA, Petrus MJ,Zhao M, DAmours M, Deering N, Brenner GJ, Costigan M, Hayward NJ, ChongJA, Fanger CM, Woolf CJ, Patapoutian A, Moran MM. TRPA1 contributes to coldhypersensitivity. J Neurosci 2010;30:1516574.

[13] Ferreira SH, Romitelli M, de Nucci G. Endothelin-1 participation in overt andinammatory pain. J Cardiovasc Pharmacol 1989;13:S2202.

[14] Flurkey K, Currer JM, Harrison DE. The mouse in aging research. In: Fox JG,Barthold SW, Davisson MT, Newcomer CE, Quimby FW, Smith AL, editors. TheMouse in Biomedical Research: Normative biology, husbandry, and models,Vol. III. Burlington, MA: American College of Laboratory Animal Medicine

2484 K.J. Zappia et al. / PAIN[20] Hillery CA, Kerstein PC, Vilceanu D, Barabas ME, Retherford D, Brandow AM,Wandersee NJ, Stucky CL. Transient receptor potential vanilloid 1 mediatespain in mice with severe sickle cell disease. Blood 2011;118:337683.[21] Hillery CA, Panepinto JA. Pathophysiology of stroke in sickle cell disease.Microcirculation 2004;11:195208.

[22] Joseph EK, Green PG, Bogen O, Alvarez P, Levine JD. Vascular endothelial cellsmediate mechanical stimulation-induced enhancement of endothelinhyperalgesia via activation of P2X2/3 receptors on nociceptors. J Neurosci2013;33:284959.

[23] Joseph EK, Levine JD. Sexual dimorphism in endothelin-1 induced mechanicalhyperalgesia in the rat. Exp Neurol 2012;233:50512.

[24] Kang D, Choe C, Kim D. Thermosensitivity of the two-pore domain K+ channelsTREK-2 and TRAAK. J Physiol 2005;564:10316.

[25] Khodorova A, Montmayeur JP, Strichartz G. Endothelin receptors and pain. JPain 2009;10:428.

[26] Knowlton WM, Bifolck-Fisher A, Bautista DM, McKemy DD. TRPM8, but notTRPA1, is required for neural and behavioral responses to acute noxious coldtemperatures and cold-mimetics in vivo. PAIN 2010;150:34050.

[27] KnowltonWM, Palkar R, Lippoldt EK, McCoy DD, Baluch F, Chen J, McKemy DD.A sensory-labeled line for cold: TRPM8-expressing sensory neurons dene thecellular basis for cold, cold pain, and cooling-mediated analgesia. J Neurosci2013;33:283748.

[28] Kohli DR, Li Y, Khasabov SG, Gupta P, Kehl LJ, Ericson ME, Nguyen J, Gupta V,Hebbel RP, Simone DA, Gupta K. Pain-related behaviors and neurochemicalalterations in mice expressing sickle hemoglobin: modulation bycannabinoids. Blood 2010;116:45665.

[29] Koltzenburg M, Stucky CL, Lewin GR. Receptive properties of mouse sensoryneurons innervating hairy skin. J Neurophysiol 1997;78:184150.

[30] Krafte DS, Bannon AW. Sodium channels and nociception: recent concepts andtherapeutic opportunities. Curr Opin Pharmacol 2008;8:506.

[31] Kwan KY, Allchorne AJ, Vollrath MA, Christensen AP, Zhang DS, Woolf CJ, CoreyDP. TRPA1 contributes to cold, mechanical, and chemical nociception but is notessential for hair-cell transduction. Neuron 2006;50:27789.

[32] Kwan KY, Glazer JM, Corey DP, Rice FL, Stucky CL. TRPA1 modulatesmechanotransduction in cutaneous sensory neurons. J Neurosci2009;29:480819.

[33] Lever IJ, Grant AD, Pezet S, Gerard NP, Brain SD, Malcangio M. Basal andactivity-induced release of substance P from primary afferent bres in NK1receptor knockout mice: evidence for negative feedback. Neuropharmacology2003;45:110110.

[34] Liang J, Bi H, Ji W. Involvement of TRPA1 in ET-1-induced pain-like behavior inmice. Neuroreport 2010;21:2015.

[35] Macpherson LJ, Hwang SW, Miyamoto T, Dubin AE, Patapoutian A, Story GM.More than cool: promiscuous relationships of menthol and other sensorycompounds. Mol Cell Neurosci 2006;32:33543.

[36] McKemy DD, Neuhausser WM, Julius D. Identication of a cold receptorreveals a general role for TRP channels in thermosensation. Nature2002;416:528.

[37] Michaels LA, Ohene-Frempong K, Zhao H, Douglas SD. Serum levels ofsubstance P are elevated in patients with sickle cell disease and increasefurther during vaso-occlusive crisis. Blood 1998;92:314851.

[38] Mohan J, Marshall JM, Reid HL, Thomas PW, Hambleton I, Serjeant GR.Peripheral vascular response to mild indirect cooling in patients withhomozygous sickle cell (SS) disease and the frequency of painful crisis. ClinSci (Lond) 1998;94:11120.

[39] Niscola P, Sorrentino F, Scaramucci L, de Fabritiis P, Cianciulli P. Painsyndromes in sickle cell disease: an update. Pain Med 2009;10:47080.

[40] Noel J, Zimmermann K, Busserolles J, Deval E, Alloui A, Diochot S, Guy N,Borsotto M, Reeh P, Eschalier A, Lazdunski M. The mechano-activated K+channels TRAAK and TREK-1 control both warm and cold perception. EMBO J2009;28:130818.

[41] Nolan VG, Zhang Y, Lash T, Sebastiani P, Steinberg MH. Association betweenwind speed and the occurrence of sickle cell acute painful episodes: results ofa case-crossover study. Br J Haematol 2008;143:4338.

[42] Obata K, Katsura H, Mizushima T, Yamanaka H, Kobayashi K, Dai Y, Fukuoka T,Tokunaga A, Tominaga M, Noguchi K. TRPA1 induced in sensory neuronscontributes to cold hyperalgesia after inammation and nerve injury. J ClinInvest 2005;115:2393401.

[43] Paszty C, Brion CM, Manci E, Witkowska HE, Stevens ME, Mohandas N, RubinEM. Transgenic knockout mice with exclusively human sickle hemoglobin andsickle cell disease. Science 1997;278:8768.

[44] Peier AM, Moqrich A, Hergarden AC, Reeve AJ, Andersson DA, Story GM, EarleyTJ, Dragoni I, McIntyre P, Bevan S, Patapoutian A. A TRP channel that sensescold stimuli and menthol. Cell 2002;108:70515.

[45] Pitcher GM, Henry JL. Nociceptive response to innocuous mechanicalstimulation is mediated via myelinated afferents and NK-1 receptoractivation in a rat model of neuropathic pain. Exp Neurol 2004;186:17397.

[46] Plant TD, Zollner C, Mousa SA, Oksche A. Endothelin-1 potentiates capsaicin-induced TRPV1 currents via the endothelin A receptor. Exp Biol Med(Maywood) 2006;231:11614.

[47] Redwood AM, Williams EM, Desal P, Serjeant GR. Climate and painful crisis ofsickle-cell disease in Jamaica. Br Med J 1976;1:668.

[48] Reeh PW. Sensory receptors in a mammalian skin-nerve in vitro preparation.Prog Brain Res 1988;74:2716.

[49] Resar LM, Oski FA. Cold water exposure and vaso-occlusive crises in sickle cell

5 (2014) 24762485anemia. J Pediatr 1991;118:4079.[50] Rogovik AL, Persaud J, Friedman JN, Kirby MA, Goldman RD. Pediatric

vasoocclusive crisis and weather conditions. J Emerg Med 2011;41:55965.

[51] Roosterman D, Goerge T, Schneider SW, Bunnett NW, Steinhoff M. Neuronalcontrol of skin function: the skin as a neuroimmunoendocrine organ. PhysiolRev 2006;86:130979.

[52] Schlenz AM, McClellan CB, Mark TR, McKelvy AD, Puffer E, Roberts CW,Sweitzer SM, Schatz JC. Sensitization to acute procedural pain in pediatricsickle cell disease: modulation by painful vaso-occlusive episodes, age, andendothelin-1. J Pain 2012;13:65665.

[53] Smith WR, Bauserman RL, Ballas SK, McCarthy WF, Steinberg MH, SwerdlowPS, Waclawiw MA, Barton BA. Multicenter study of hydroxyurea in sickle cellA. Climatic and geographic temporal patterns of pain in the multicenter studyof hydroxyurea. PAIN 2009;146:918.

[54] Smith WR, Scherer M. Sickle-cell pain: advances in epidemiology and etiology.Hematology (Am Soc Hematol Educ Program) 2010:40915.

[55] Story GM, Peier AM, Reeve AJ, Eid SR, Mosbacher J, Hricik TR, Earley TJ,Hergarden AC, Andersson DA, Hwang SW, McIntyre P, Jegla T, Bevan S,Patapoutian A. ANKTM1, a TRP-like channel expressed in nociceptive neurons,is activated by cold temperatures. Cell 2003;112:81929.

[56] Stucky CL, Galeazza MT, Seybold VS. Time-dependent changes in Bolton-Hunter-labeled 125I-substance P binding in rat spinal cord followingunilateral adjuvant-induced peripheral inammation. Neuroscience1993;57:397409.

[57] Teodoro FC, Tronco Jr MF, Zampronio AR, Martini AC, Rae GA, Chichorro JG.Peripheral substance P and neurokinin-1 receptors have a role ininammatory and neuropathic orofacial pain models. Neuropeptides2013;47:199206.

[58] Vincent L, Vang D, Nguyen J, Gupta M, Luk K, Ericson ME, Simone DA, Gupta K.Mast cell activation contributes to sickle cell pathobiology and pain in mice.Blood 2013;122:185362.

[59] Werner MF, Trevisani M, Campi B, Andre E, Geppetti P, Rae GA. Contribution ofperipheral endothelin ETA and ETB receptors in neuropathic pain induced byspinal nerve ligation in rats. Eur J Pain 2010;14:9117.

[60] Yamamoto T, Ono K, Hitomi S, Harano N, Sago T, Yoshida M, Nunomaki M,Shiiba S, Watanabe S, Nakanishi O, Inenaga K. Endothelin receptor-mediatedresponses in trigeminal ganglion neurons. J Dent Res 2013;92:3359.

K.J. Zappia et al. / PAIN155 (2014) 24762485 2485

Cold hypersensitivity increases with age in mice with sickle cell disease1 Introduction2 Methods2.1 Animals2.2 Behavioral testing2.3 Teased fiber skin-nerve recordings2.4 Calcium imaging2.5 Gene expression2.6 Data analysis

3 Results3.1 Enhanced cold avoidance in sickle mice3.2 Sensitization of C fibers contributes to cold hypersensitivity3.3 Aged sickle mice exhibit increasing sensitivity to cold3.4 Expression of known cold-sensitive channels does not change in sickle sensory neurons3.5 Sickle DRGs have increased expression of tachykinin receptor 1 and endothelin 1

4 DiscussionConflict of interest statementAcknowledgementsAppendix A Supplementary dataReferences