nva

l CK

logiwan

c School of Biotechnology and Bioengineering, Kangwon National University, Chuncheon 200-701, Republic of Korea

2006 Elsevier Inc. All rights reserved.

This pathological situation is mediated by the formation of thepotent oxidizing agent, peroxynitrite (ONOO), by the chemicalreaction between NO and superoxide (Beckman et al., 1994;Lipton et al., 1993) or the formation of toxic dopamine oxidative

Life Sciences 79 (2006) 2

Corresponding author. Cho is to be contacted at the School of Biotechnologyand Bioengineering, Kangwon National University, 192-1, Hyoja-2-dong,

Chuncheon 200-701, Republic of Korea. Tel.: +82 33 250 6562; fax: +82 33 2536560.Keywords: Curcumin; Primary microglia; NO; iNOS; p38; JNK; NF-B; AP-1

Introduction

Microglial cells are a class of brain mononuclear phagocytesthat carry out phagocytosis, antigen presentation, the secretion ofcytokine and the production of inflammatory mediators such aseicosanoids, reactive oxygen species and nitric oxide (NO)(Simmons and Murphy, 1992; Wang et al., 2002). Like othertissue macrophage's role in pathophysiology, these cells par-

ticipate in certain brain inflammatory conditions via excessiveproduction of the inflammatorymediators. Indeed, over-activatedmicroglial cells are found in many neurodegenerative diseasessuch as Alzheimer's disease, multiple sclerosis and humanimmunodeficiency virus-associated dementia (Aloisi, 1999). Forthis, the effective control of microglial cell function in numerousneuronal diseases is regarded as an important therapeutic target.

NO released from microglia is known to induce neurotoxicity(Dawson et al., 1991; Joe and Lokesh, 1994; Kim and Ko, 1998).Abstract

Curcumin has been shown to exhibit anti-inflammatory, antimutagenic, and anticarcinogenic activities. However, the modulatory effect ofcurcumin on the functional activation of primary microglial cells, brain mononuclear phagocytes causing the neuronal damage, largely remainsunknown. The current study examined whether curcumin influenced NO production in rat primary microglia and investigated its underlyingsignaling pathways. Curcumin decreased NO production in LPS-stimulated microglial cells in a dose-dependent manner, with an IC50 value of3.7 M. It also suppressed both mRNA and protein levels of inducible nitric oxide synthase (iNOS), indicating that this drug may affect iNOSgene expression process. Indeed, curcumin altered biochemical patterns induced by LPS such as phosphorylation of all mitogen-activated proteinkinases (MAPKs), and DNA binding activities of nuclear factor-B (NF-B) and activator protein (AP)-1, assessed by reporter gene assay. Byanalysis of inhibitory features of specific MAPK inhibitors, a series of signaling cascades including c-Jun N-terminal kinase (JNK), p38 and NF-B was found to play a critical role in curcumin-mediated NO inhibition in microglial cells. The current results suggest that curcumin is apromising agent for the prevention and treatment of both NO and microglial cell-mediated neurodegenerative disorders.d Laboratory of Physiology and Signaling, College of Veterinary Medicine, Kyungpook National University, Daegu 702-701, Republic of Korea

Received 16 November 2005; accepted 26 June 2006Inhibitory effect of curcumin olipopolysaccharide-acti

Ki Kyung Jung a,b, Hae Sung Lee a,b, Jae YouTae Gyun Kim a, Ju Hye Kang a, Seung Hee

a Pharmacology Department, National Institute of Toxicob Department of Genetic Engineering, SungkyunkE-mail address: jaecho@kangwon.ac.kr (J.Y. Cho).1 Pharmacology Department, National Institute of Toxicological Research,

KFDA, 5 Nokbun-Dong, Eunpyung-Ku, Seoul 122-704, Republic of Korea.Tel.: +82 2 380 1812; fax: +82 2 901 8386.

0024-3205/$ - see front matter 2006 Elsevier Inc. All rights reserved.doi:10.1016/j.lfs.2006.06.048nitric oxide production fromted primary microglia

ho c,, Won Cheol Shin c, Man Hee Rhee d,im a, Sungyoul Hong b, Seog Youn Kang a,1

cal Research, KFDA, Seoul 122-704, Republic of KoreaUniversity, Suwon 440-746, Republic of Korea

0222031www.elsevier.com/locate/lifescieproducts (Cook et al., 1996). Therefore, NO production is acritical step in modulation of NO-mediated diseases. Thegeneration of NO following an inflammatory stimulation is

ienccatalyzed by inducible NO synthase (iNOS) and its regulationdepends on the formation of a multiple intracellular signalingcomplex composed of Janus kinases, protein tyrosine kinases,protein kinaseC, andmitogen-activated protein kinases (MAPKs)as well as transcription system such as nuclear factor-B (NF-B)and activator protein (AP)-1 (Nick et al., 1999; Kim et al., 2003a;Kang et al., 2004).

There is increasing interest in the role of food components inhealth and disease. One such component is curcumin. Curcuminis a major chemical component of turmeric (Curcuma longa)which is used as a spice to give a specific flavor and yellowcolor in curry. The form of herbal powder turmeric has beenused for centuries as an anti-inflammatory remedy in Asianmedicine. Curcumin has been shown to display anti-inflamma-tory, antioxidant, and anticarcinogenic properties (Huang et al.,1997; Kumar et al., 1998). The anti-inflammatory effects ofcurcumin are most likely mediated through its ability to inhibitexpression of pro-inflammatory genes such as cyclooxygenase-2, adhesion molecules, chemokines, cytokines, metalloprotei-nases (MMP), lipoxygenase, and iNOS (Huang et al., 1991;Surh et al., 2001; Woo et al., 2005) via down-regulation oftranscription factors such as NF-B, AP-1 and Egr-1 (Aggarwalet al., 2003; Kang et al., 2004) and intracellular signalingpathways such as Janus kinase (JAK)-STAT signaling (Kimet al., 2003a). A recent study has shown that curcumin reducesoxidative damage and amyloid pathology in an Alzheimertransgenic mouse (Lim et al., 2001).

Although the anti-inflammatory properties of curcumin areknown, its molecular basis in neuronal system is not fullyunderstood yet. In particular, how curcumin can modulate NOproduction in primary microglial cells has not been fully eluci-dated yet in terms of its molecular aspects, although it has beenreported that curcumin blocked iNOS expression via suppres-sing JAK-STAT inflammatory signaling (Kim et al., 2003a,b).Therefore, in the present study, the NO inhibitory effect ofcurcumin and its molecular mechanism in primary microgliawere carefully investigated. From this study, our results suggestthat curcumin may effectively modulate the pathophysiologicalfunction of microglia via regulating iNOS gene expressionmediated by a series of signaling cascades including c-Jun N-terminal kinase (JNK), p38, and NF-B.

Materials and methods

Reagents

Curcumin (1,7-bis[4-hydroxy-3-methoxyphenyl]-1,6-hepta-diene-3,5-dione), lipopolysaccharide (LPS; from Salmonellaenteriditis), interferon-, aminoguanidine (AG), a selectiveiNOS inhibitor, and MTT were purchased from Sigma-AldrichChemical Co. (St. Louis, MO). PD98059 (a extracellular signal-regulated kinase [ERK] inhibitor), SB203580 [a p38 inhibitor],and SP600125 (a c-Jun N-terminal kinase [JNK] inhibitor) wereobtained from Calbiochem. (La Jolla, CA). Minimum essential

K.K. Jung et al. / Life Scmedium (MEM), Dulbecco's modified Eagle's medium(DMEM), neurobasal A medium, fetal bovine serum (FBS),Penicillinstreptomycin antibiotics and TrypsinEDTA werepurchased from GIBCO BRL Life Technologies (Grand Island,NY). The BV2 cell line was obtained from American TissueCulture Center (Manassas, VA). [-32P]-ATP (250 Ci), West-ern blotting detection system, and ECL Plus were fromAmersham-Pharmacia Biotech. Ltd. (Little Chalfont, Buckin-ghamshire, UK). Antibodies to OX-42 (CD11b), glial fibrillaryacidic protein (GFAP), and iNOS were purchased fromChemicon International Inc. (Temecula, CA). Antibodies top65 (Rel A) of NF-B, -actin, IB- and IB- were fromSanta Cruz Biotechnology Inc. (Santa Cruz, CA). Antibodies toJNK, phospho-JNK (p-JNK), ERK, p-ERK, p38, and p-p38were obtained from cell signaling Technology (Beverley, MA).Protein assay kit and gelatin were obtained from Bio-Rad Lab(Hercules, CA). Other common chemicals all came from Sigma-Aldrich Chemical Co. (St. Louis, MO).

Primary microglial cell culture

Experimental protocols were approved by the Animal Careand Use Committees, National Institute of Toxicology Center,and conformed to regulations detailed in the National Institutesof Health publication Guide for the Care and Use of LaboratoryAnimals (revised in 1996). All efforts were made to minimizethe suffering and the number of animals used according to theabovementioned guidelines and derived guidelines on the ethicaluse of animals. Harlan SpragueDawley rats were purchasedfrom the Dae-Han/Biolink Experimental Animal Center (Dae-jeon, Korea). Microglial cells were cultured from the cerebralcortices of 1 to 3 day old rats by a modification of Park's method(Park et al., 1999). In brief, the meninges were removed from theforebrains, and tissues collected from forebrains were trituratedinto single cells using fire-polished long Pasteur pipettes inserum-free media. Cells were plated onto T-75-cm2 flask inMEM containing 10% heat-inactivated FBS and incubated at37 C in a humidified incubator containing 5%CO2 and 95% air.The following week, the cells were replaced with newmedia andincubated for 12 weeks. Microglial cells were then purifiedfrom the initial mixed culture by sequential shaking at 180 rpmfor 30 min at room temperature. The resultant supernatant wascollected and centrifuged at 150 g for 5 min. The pellet wassuspended in new neurobasal A media containing 10% FBS,applied to a nylon mesh to remove astrocytes and cell clumps,and then plated on a culture slide or in 24-well culture plates. Theplate was under the culture hood, allowing to settle it for 1 h.After 1 h, microglial cells were further purified by washing twicewith serum-free media and grown in new neurobasal A media.To determine the purity of the microglial cells, immunocyto-chemical analysis was carried out using microglial-specific OX-42 and astrocyte-specific GFAP antibodies. These cultures wereN95% OX-42 positive and GFAP negative as determined byimmunocytochemistry indicating that they were composed ofmicroglial cells.

Measurement of nitrite

2023es 79 (2006) 20222031NO production in cell culture supernatants was spectrophoto-metrically evaluated bymeasuring the nitrite, a stable end product

of NO. Nitrite was determined by the Griess reaction (Ding et al.,1988; Cho et al., 2000). Fiftymicroliters of the culture supernatantwas mixed with an equal volume of Griess reagent (0.1%naphthyl-ethylenediamine, 1% sulfanylamide, and 2.5% phos-phoric acid). Absorbance was measured in a microplate reader at540 nm, using a calibration curve with sodium nitrite standards.

Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNAwas prepared from rat primarymicroglial cells withTRIzol reagent (Roche Molecular Biochemicals, Mannheim,Germany), according to the manufacturer's instructions. Twomicrograms of total RNAwere reverse-transcribed and then usedfor PCR as a template as previously described (Hong et al., 2003).The primers (Bioneer, Daejeon, Korea) used for amplifying iNOSand GAPDH, a housekeeping gene, were as follows: for the

iNOS, ACA ACG TGG AGA AAA CCC CAG GTG, and ACAGCT CCG GGC ATC GAA GAC C were used as a sense andanti-sense primer, respectively. For the GAPDH, CTGCCACTCAGAAGACTGTGG and CTTGATGTCATCATACTTGGCwere used as a sense and anti-sense primer, respectively (Leeet al., 2003a).

Western blot analysis

For Western blot analysis, cells were pelleted, washed withPBS, pH 7.5, and resuspended in lysis buffer consisting of TrisHCl (pH 6.8) buffer containing 2% SDS, 1 mM EDTA, 100 mMDTT, and protease inhibitor cocktail. After 30 min on ice, celllysates were cleared by centrifugation for 5 min at 10,000 g.10 g of total proteins in Tris-glycine SDS electrophoresis bufferwas loaded on 10% acrylamide gels and subjected to SDS-PAGE

y minddetom

2024 K.K. Jung et al. / Life Sciences 79 (2006) 20222031Fig. 1. Effects of curcumin on NO production and iNOS expression in rat primarml) (upper panel) or BV2 cells (5 x106 cells/ml) (lower panel) pretreated with theof LPS. Cultured medium was then collected after 24 h, and nitrite level wasexperiments performed with triplicate. Asterisk indicates significant difference fr

of iNOS was assessed by RT-PCR using LPS-activated microglial cells pre-treated witof microglia treated with LPS and/or curcumin. iNOS and -actin expression was aanalysis was carried out using Vectastain ABC kit as described in Materials and methoicroglial cells stimulated with LPS. (A) Primary microglial cells (1.5 x106 cells/icated concentrations of curcumin or AG (0.2 mM) were stimulated with 1 g/mlermined by Griess reaction. Results are the meanSEM of three independentLPS-stimulated group (: Pb0.05, : Pb0.01). (B) Transcriptional expression

h curcumin (4 and 8 M). (C) Whole cell lysates were prepared from 5106 cellsnalyzed by immunoblotting with antibody to iNOS. (D) Immunocytochemicalds. The data are representative of three different experiments with similar results.

iencK.K. Jung et al. / Life Scbefore transfer to polyvinylidene difluoride membranes. Mem-branes were blocked with Tris-buffered saline and, 5% nonfat drymilk before being probed with primary antibodies to iNOS, p65,IB-, IB-, JNK, p-JNK, p38, p-p38, ERK, and p-ERK. Allblots were visualized with enhanced chemiluminescence (Amer-sham-Pharmacia Biotech Inc.).

Immunocytochemistry

Microglial cells were seeded onto culture slides. After 24 h,media were removed and slides were air-dried. The cells werethen fixed with 50% methanol and 50% acetone for 30 min atroom temperature. Following three rinses in phosphate buffedsaline (PBS, pH 7.6), sections were blocked with 1% goat serumin PBS for 30 min, and incubated with primary antibodies againstOX-42, GFAP, and iNOS dissolved in PBS containing 0.3%Triton X-100. Incubations were performed for 1618 h at 4 C.After several washes in PBS, sections were incubated withbiotinylated anti-mouse or anti-rabbit secondary antibodies(1:200, Vector Laboratories) for 1 h at room temperature. Stainingwas visualized by the biotin-avidin-peroxidase method (ABCElite Kit, Vector Laboratories) using diaminobenzidine aschromogen. Negative control data were obtained with the isotypeantibodies of each tested antibody (data not shown).

Fig. 2. Role ofMAPKs in curcumin-mediated NO production in LPS-stimulated primarythat were stimulated with LPS (1 g/ml) for 30 min after a 2-h pretreatment with curcumiand p-JNKwere analyzed by immunoblotting, as described inMaterials andmethods. TheMAPK inhibitors (SP600125 [15 M], SB203580 [25 M], and PD98059 [50 M]) on N(upper panel) or BV2 cells (5106 cells/ml) (lower panel) was assessed. Culturedmediumare the meanSEMof three independent experiments performedwith triplicate. Asterisk i2025es 79 (2006) 20222031BV2 cell culture and transient transfection assay

Mouse microglial cell line BV2 cells were grown in DMEM,supplemented with 10% FBS, streptomycin, and penicillin, asdescribed previously. Transfection was performed by a standardcalcium phosphate method. BV2 cells were transfected with 4 gof the reporter construct (NF-B-luc or AP-1-luc) and 1 g pRSVRenillar-Luc. Plasmids used for transient transfection assays wereprepared by Qiagen (Santa Clarita, CA) columns. After 48 h, cellswere harvested and luciferase assayswere performed as previouslydescribed (Woo et al., 2005). To correct for differences in transfec-tion efficiencies among different DNA precipitates, luciferaseactivity was normalized to that of Renilla luciferase activity. Alltransfection assayswere carried out at least three times in triplicate.

Electrophoretic mobility shift assay

Nuclear extractionNuclear extracts were prepared by the method previously

reported (Kim et al., 2005). Microglial cells (3106 cells/well)were seeded into 6-well plates and treated with or withoutcurcumin for 2 h, followed by exposure to 1 g of LPS. The cellsthen were washed twice with ice-cold PBS followed byincubation on ice for 15 min with 0.2 ml of ice-cold lysis buffer

microglial cells. (A)Whole cell lysates were prepared from 5106 cells of microglian (4 or 8 M). The total or phosphorylation forms of ERK, p-ERK, p38, p-p38, JNKdata are representative of three different experimentswith similar results. (B) Effect ofO production in LPS (1 g/ml)-activated primarymicroglial cells (1.5106 cells/ml)was collected after 24 h, and nitrite level was determined byGriess reaction. Resultsndicates significant difference from LPS-stimulated group (:Pb0.05, :Pb0.01).

ienc2026 K.K. Jung et al. / Life Scthat consisted of 10 mM HEPES (pH 7.9) containing 1.5 mMMgCl2, 10 mM KCl, 0.5 mM DTT, and 0.2 mM PMSF. Cellswere then scraped and collected in 1.5 ml Eppendorf tubes andplaced on ice for an additional 30 min. The homogenates thenunderwent centrifugation at 4 C at 1200 g for 10 min. Theresulting pellets were washed once with 0.5 ml of ice ice-coldlysis buffer and incubated on ice for 1 h with 80 l of nuclearextraction buffer composed of 20 mM HEPES (pH 7.9) buffercontaining 20% (v/v) glycerol, 420 mM NaCl, 1.5 mM MgCl2,0.2 mM EDTA, 0.5 mM DTT and 0.2 mM PMSF. The resultinghomogenates were centrifuged at 4 C at 110,000 g for 15 min.The supernatants were collected and stored at 70 C until use.

Electrophoretic mobility shift assay for NF-BNF-B, which binds to B enhancer elements on DNA, was

detected in nuclear extracts by an electrophoretic mobility shiftassay (EMSA), according to our previous report (Kim et al.,

Fig. 3. Effects of curcumin andMAPK inhibitors on transcriptional activation ofNF-Ban[25 M], and PD98059 [50 M]) on LPS-induced NF-B and AP-1 reporter gene activitythree independent experiments performedwith triplicate. Asterisk indicates significant diffeprepared from3106 cells ofmicroglia thatwere stimulatedwith LPS for 24 h after a 2-h pras described in Material and methods. (C) Whole cell lysates were prepared from 5106 ccurcumin. Expression of p65, I-B( and) and-actinwas analyzedby immunoblotting acells of microglia that were stimulated with LPS for 24 h after a 2-h pretreatment with MNuclear translocation of NF-Bwas evaluated with EMSA, as described inMaterials andmes 79 (2006) 202220312005). For EMSA, 40 g of nuclear proteins were incubated for30 min at room temperature with approximately 100,000 cpm ofan oligonucleotide containing NF-B consensus sequence (5-AGT TGA GGG GAC TTT CCC AGG C-3) that had 5-endlabeled with [-32P] ATP using T4 polynucleotide kinase(Promega). Supershift and competitive binding assay for NF-Bwas carried out using a p65 antibody and non-labeled coldprobe (data not shown). Samples were then electrophoresed in a6% nondenaturing polyacrylamide gel. Autoradiographs wereobtained from radioactive signals.

Statistical analysisUnless otherwise stated, all measurements were made from

four or ten observations and at least three separate experiments.Data are expressed as meanSEM. For statistical comparison,results were analyzed using ANOVA/Scheffe's post-hoc test andKruskalWallis/MannWhitney test. P valueb0.05 was

dAP-1. (A) Effect of curcumin andMAPK inhibitors (SP600125 [15M], SB203580was examined as described inMaterials and methods. Results are the meanSEM ofrence fromLPS-stimulated group (:Pb0.05, :Pb0.01). (B)Nuclear extracts wereetreatmentwith curcumin.Nuclear translocation ofNF-Bwas evaluatedwithEMSA,ells of microglia that were stimulated with LPS for 24 h after a 2-h pretreatment withs described inMaterials andmethods. (D)Nuclear extractswere prepared from3106

APK inhibitors (SP600125 [15 M], SB203580 [25 M], and PD98059 [50 M]).ethods. The data are representative of three different experiments with similar results.

iencconsidered a statistically significant difference. All statistical testswere carried out using the computer program STATISTICA,version 4.5 (StatSoft Inc, Microsoft corporation, Oklahoma,USA).

Results

Inhibition of NO production by curcumin in primary microglia

First, we investigated whether curcumin can inhibit LPS-mediated induction of NO production in rat primary microglialcells. Cells were treatedwith curcumin andAG, a selective iNOSinhibitor, in the culture medium for 2 h, followed by stimulationwith LPS for 20 h. LPS caused greater than 10-fold increases inNO production compared to the control. LPS-induced NOproduction was suppressed by AG, and also inhibited bycurcumin (1 to 8 M) in a dose-dependent manner with an IC50value of 3.7 M(Fig. 1A, left panel). Furthermore, the inhibitoryactivity of curcumin was also shown in the experiments withBV2 cells, a microglial cell line. Thus, NO production in LPS-activated BV2 cells was concentration-dependently suppressedby curcumin (Fig. 1A, lower panel), suggesting that it may act asa potent NO inhibitor in microglial cells.

Cell viability was also measured by MTT assay to determinewhether the inhibitory effects of curcumin on NO productionwere attributable to non-specific cytotoxicity. In the presence ofup to 8 M curcumin, a concentration at which NO synthesiswas almost inhibited, cell viability was not different from that ofLPS-stimulated cells (data not shown). Next, to determinewhether the inhibitory effect of curcumin on NO production isdue to inhibition of iNOS protein, RT-PCR, Western blottingand immunohistochemical analyses were carried out. Fig. 1B,C, and D showed that curcumin dose-dependently diminishediNOS expression at the transcriptional and translational levels.

Effect of curcumin on MAPK activation

To understand the inhibitory mechanism by which curcuminstrongly regulates NO production in primary microglial cells, theeffect of curcumin on LPS-induced signaling activation wasexamined. To do this, MAPKs (Erk1/2, p38 and JNK) were firstchosen, based on previous reports (Nick et al., 1999; Bodles andBarger, 2005; Woo et al., 2005). As shown in Fig. 2A, curcumindown-regulated the activation of all MAPKs, as indicated by theirphosphorylation patterns, a hallmark for activation, withoutalteration of normal protein levels. To determine which MAPK iscritical for NO production in primary microglia, specificinhibitors of MAPKs were employed in a NO assay under thesame conditions. As shown in Fig. 2B (upper panel), SP600125, aJNK inhibitor, and SB203580, a p38 inhibitor, but not PD98059,an ERK inhibitor, strongly suppressed NO release in rat primarymicroglial cells stimulated by LPS. Furthermore, these inhibitorypatterns were also similarly demonstrated in the case of BV2 cells(Fig. 2B, lower panel), suggesting that NO release from

K.K. Jung et al. / Life Scmicroglial cells is dependent on the activation of p38 and JNKand that their inhibition by curcumin may lead to suppressiveconditions.Inhibition of NF-B activation by curcumin

To investigate whether the expression of iNOS is mainlydependent on the activation of NF-B and AP-1, we analyzedwhether curcumin modulated NF-B and AP-1 activities usingtransient transfection assays with the reporter constructs. Asindicated in Fig. 3A, curcumin blocked both NF-B-luc andAP-1-luc activities induced by LPS stimulation. In the case ofMAPK inhibitors, two inhibitors (SP600125 and SB203580)were very effective in NF-B-luc activity assay, but all dim-inished AP-1 activity. Since curcumin more strongly suppressedNF-B-luc, we further explored the inhibitory process in NF-Bactivation pathway. As shown in Fig. 3B and C, curcumin dosedependently inhibited NF-B binding assessed by EMSAwith-out alteration of p65, a component of NF-B dimmer, and alsosuppressed degradation of I-Bs ( and ), a critical process fortranslocation of NF-B to the nuclei, shown in LPS stimulation.Similarly, exposure of microglial cells to SP600125 andSB203580 but not PD98059 also down-regulated DNA bindingactivity of NF-B (Fig. 3D), suggesting that p38 and JNK play acentral role in NF-B activation process and that these are themajor inhibitory pathways managed by curcumin treatment.Specific NF-B binding was confirmed by supershift and com-petitive assay with antibody to p65 and an unlabeled probe (datanot shown), as reported previously (Kim et al., 2005).

Discussion

Microglial cells play a central role in pathological eventsleading to neuronal cell death occurring in ischemia and neuro-degenerative diseases such as Alzheimer's disease, Parkinson'sdisease and multiple sclerosis. Nonetheless, not many papershave reported on primary microglial cells due to cultural dif-ficulties. In particular, curcumin's regulating effect on primarymicroglial cell function has not been reported yet, even thoughthere are numerous studies on its molecular pharmacologicalfeatures. In the current study, therefore, the potential immuno-modulatory effects of curcumin on NO production in microglialcells were carefully evaluated using primary microglial cellsactivated by inflammatory stimuli such as LPS (Szabo andThiemermann, 1995; Macmicking et al., 1997).

As reported previously using other macrophage cell lines(Chan et al., 1998; Chan, 1995; Brouet and Oshima, 1995), inour study, curcumin clearly prevented microglia from neuro-toxic circumstance caused by excessive NO production. Thus,as indicated in Fig. 1, curcumin strongly blocked NO generationfrom both primary and cell lined microglial cells mediated byLPS and other pathological stimuli such as IFN- and A(25-35) (Bodles and Barger, 2005) in a dose-dependent manner(data not shown). Curcumin-mediated inhibition was due tosuppression of iNOS expression at the transcriptional andtranslational levels, according to a line of evidence that 1) AG, aselective iNOS inhibitor (Corbett and McDaniel, 1996),diminished NO production under the same conditions and 2)

2027es 79 (2006) 20222031a down-regulated level of iNOS but not eNOS or constitutiveNOS (data not shown) was observed by RT-PCR, immunoblot-ting and immunohistochemical analyses (Fig. 1). The inhibitory

iencpotency (IC50=3.7 M) of curcumin in microglial cells was twoto ten-fold higher than that of macrophages including J774.1(IC50=12.3 M), RAW264.7 (IC50=6 M), peritoneal macro-phages (IC50=approximately 25 M), and rat mammary glands(IC50=approximately 35 M) (Meselhy, 2003; Bhaumik et al.,2000; Onoda and Inano, 2000; Brouet and Oshima, 1995).Although it is not clear how microglial cells display highersensitivity to curcumin, the potency might be decided by bothdirect NO scavenging activity and indirect blockade effects ofNO producing pathways. With reactive oxygen species, neuro-pathologically, reactive NO has been known to generateperoxynitrite, a stable toxic component, causing neuro-degen-erative diseases (Huie and Padmaja, 1993). Curcumin itself hasbeen known to be a potent radical scavenger against reactivityof peroxynitrite, superoxide and nitric oxide (Biswas et al.,2005; Vajragupta et al., 2004; Kim et al., 2003a,b; Sreejayanand Rao, 1997). However, under our DPPH [1,1-diphenyl-2-picrylhydrazyl] assay condition, we obtained that the directscavenging effect of curcumin was not strong with IC50 valuesof 91.3 M (data not shown), suggesting that indirect way maygive curcumin a strong NO inhibitory potential in primarymicroglial cells. Consequently, our present and previous datastrongly suggest that curcumin may more effectively act onmicroglial cells from various oxidative damages than othertarget cells, consequently protecting against neuronal celldegeneration (Hewett et al., 1994).

To produce inflammatory mediators in immune cells, intracel-lular signaling pathways linked to the activation of transcriptionfactors should be followed. These include multiple activation ofsignaling enzymes such as protein tyrosine kinase (Lyn, Fgr andHck) (Khadaroo et al., 2003), JAKs (Kim et al., 2003a), proteinkinase C (, and isoforms) (Cuschieri et al., 2004; Asehnouneet al., 2005), phosphoinositide 3-kinase (Jhun et al., 2004),MAPKs(Erk1/2, p38 and SAPK/JNK) (Fiebich et al., 2002), andtranscription factors (such as NF-B, AP-1 and CCAATenhancer-binding protein ) (Kim et al., 2005). Therefore, wenext explored the potential inhibitory mechanism of LPS-mediatedNO production by curcumin, since there have been no reports onthe LPS-induced signaling aspects of curcumin in primarymicroglial cells, although similar data obtained from IFN-signaling study were previously published (Kim et al., 2003a). Todo this, MAPK and transcription factors were primarily selected,based on previous reports (Guzik et al., 2003; Otani, 2004). Fig. 2indicated that curcumin is able tomodulate allMAPKactivation, asjudged by analyzing their phosphorylation levels, suggesting thatthis compound may act as a broad-spectrum MAPK inhibitor.Although the mechanism whereby the compound is capable ofdown-regulating all MAPK molecules at the same time has notbeen fully elucidated yet, it is hypothesized that the inhibitory effectis due to indirect action. Thus, radical scavenging effect of thiscompound is regarded as one of potential drug's actionmechanisms(Vajragupta et al., 2004; Kim et al., 2003a,b; Sreejayan and Rao,1997), for MAPKs are reported to be activated by cellular redoxsystem (Torres, 2003; Bundy et al., 2005). Since curcumin was not

2028 K.K. Jung et al. / Life Scstrongly scavenged the reactivity of the radicals under ourcondition, it is thought that the indirect effect may be not criticalin inhibiting all MAPKs. Considering that protein kinase C,commonly found during various mitogenic exposure, was directlyinhibited by curcumin (Woo et al., 2005), there is a possibility thatthe compound may have an inhibitory capacity on the broad-spectrum kinase activity, which remains to be verified.

It is known that IFN- produced from T helper type I cells actsas a critical factor of LPS-mediatedNOproduction (Matsuura et al.,2003). Indeed, anti-IFN- antibody strikingly affected NOproduction from primary splenocyte- or bone marrow-derivedmacrophages activated by LPS. Normally, the production of IFN-from T helper cells also requires macrophage- or dendritic cell-derived IL-12 and IL-18 (Matsuura et al., 2003), suggesting thatLPS-induced NO production is also IL-12-, IL-18- and IFN--dependent. However, various macrophage-like cells showeddifferent NO production pattern in which IFN- induced additiveNO release only, not completely inhibited by anti-IFN- antibody,indicating that theremay be another signaling pathways induced byLPS itself. Considering these, therefore, IFN--induced NOproduction pathway may participate in late signaling phase inprimary cell condition or may be involved as another completelyindependent event in macrophage cell lines. By the reasons, whattypes of macrophages are chosen and what signaling steps areselected to be tested should be carefully considered to evaluate adrug's efficacy and its pharmacological mechanism. The fact thatcurcumin suppressed IFN--mediated NO production pathway viasuppressing the activity of JAK and STAT machinery (Kim et al.,2003a,b), therefore, seems thought to explain curcumin's NOmodulation by blockade of relatively late phase activation underLPS stimulation. In contrast,MAPKchosen in our study are knownto be key regulatory signaling molecules in LPS-mediated earlysignaling as well as IL-12/IL-18-and IFN--mediated iNOSexpression. Our paper, therefore, showed that curcumin is able toregulate early signaling phase raised by LPS stimulation, which isclearly distinct from previous findings reported by Kim et al.(2003a,b).

Despite the critical involvement of MAPK in activatedmacrophages, which kinds of MAPKs (ERK, p39 and JNK) areinvolved in iNOS gene expression seem to conflict yet dependingon cell types [chondrocytes, murine macrophage cell lines (J771and RAW264.7), rat macrophages, rat primary microglia and C6glioma cells] and stimulators. Therefore, which MAPKs are trulyinvolved in NO production frommicroglial cells were carefully re-evaluated using their specific inhibitors in this study. Significantly,as shown in Fig. 2B, SP600125 and SB203580 interrupted NOrelease process in primary microglial cells, as similarly shown inmicroglial cell line BV2 cells. More interestingly, these threeinhibitors also showed different inhibitory patterns to NF-B andAP-1-mediated luciferase activities. According to reporter geneassays, SP600125 and SB203589 but not PD98059 stronglyblocked NF-B activation, whereas all were effective in AP-1-mediated luciferase activity. Hence, these results suggest that NF-B activation triggered by JNK and p38 but not ERK play domi-nant roles in iNOS expression and NO production in microglialcells rather thanAP-1-mediated gene expression. Indeed, these twoinhibitors (SP600125 and SB203580) and curcumin also strongly

es 79 (2006) 20222031blocked DNA binding of NF-B, as evaluated by EMSA (Fig. 3Band D). Furthermore, curcumin blocked degradation of I-B (and), induced by the phosphorylation of IB and the conjunction

iencof I-B to ubiquitin (Baldwin, 1996), without alteration of one ofheterodimeric components, p65 (Fig. 3C), unlike a report that thiscompound is able to down-regulate the heterodimeric components(p50 and p65) upon IFN- treatment (Lee et al., 2005). Therefore,these results suggest that curcumin-mediated inhibition of JNK,p38 and NF-B is a critical mechanism explaining its pharmacol-ogy in microglial cells. Numerous researchers have reported thatstrong activation of p38 and NF-Bwas observed in brain diseasessuch as Parkinson's disease (Wilms et al., 2003; Saccani et al.,2002; Pyo et al., 1998; Walton et al., 1998; Jeng et al., 2005; Liet al., 2001) and that JNK and p38 are required for induction ofapoptosis in Parkinson's disease cybrids (Onyango et al., 2005),suggesting neuro-pathophysiological roles of these molecularcomponents. Some of evidence that p38 acted as a major kinaseinvolved in phosphorylation of p65 to enhance its binding property(Schwenger et al., 1998; Nick et al., 1999; Waetzig et al., 2002),and that JNK and p38 indirectly up-regulate NF-B bindingactivity via enhancing rapid degradation of I-B components(Spiegelman et al., 2001; Jijon et al., 2004) also indicates theirimportant roles in NF-B activation. However, our results are stilldistinct from others findings that ERK and AP-1 have beencritically involved in the production of NO and even otherinflammatory molecules such as MMP-9 in different cellsincluding macrophages, C6 cells and astroglioma (Lee et al.,2003b; Kristof et al., 2001; Woo et al., 2005). However, inhibitionof ERK and AP-1 by curcumin may be involved in expression ofother inflammatory genes, such as cytokines (IL-1, IL-6 and TNF-) (Christman et al., 1998). This discrepancy seems to be due todifferent cells and stimuli used, but further studies should beconducted to exactly understand pathological features of eachinflammatory cell.

In conclusion, we found that curcumin strongly regulatedNO production in LPS-activated primary microglial cells viainhibiting the activation of JNK, p38 and NF-B. The inhibitoryeffect by curcumin was higher than with other tissue macro-phages and cell lines, indicating that brain microglial cells arethe most predominant cells in curcumin pharmacology. Con-sidering that 1) curcumin is one of dietary phenolic compoundswith low toxicity, found in spice turmeric and 2) pharmacolog-ically effective level of curcumin in brain was obtainable whentreated with liver metabolism regulators such as piperine (Shobaet al., 1998), our data obtained in primary microglial modelsuggest that curcumin is a promising agent for both the pre-vention and treatment of both NO and microglial cell-mediatedneurodegenerative disorders.

Acknowledgments

This work was supported by grant from the Korea Food andDrug Administration, Korea.

References

Aggarwal, B.B., Kumar, A., Bharti, A.C., 2003. Anticancer potential ofcurcumin: preclinial and clinical studies. Anticancer Research 23, 363398.

K.K. Jung et al. / Life ScAloisi, F., 1999. The role of microglia and astrocytes in CNS immune surveillanceand immunopathology. Advances in Experimental Medicine and Biology 468,123133.Asehnoune, K., Strassheim, D., Mitra, S., Yeol Kim, J., Abraham, E., 2005.Involvement of PKC alpha/beta in TLR4 and TLR2 dependent activation ofNF-kappaB. Cellular Signalling 17, 385394.

Baldwin Jr., A.S., 1996. The NF-kappa B and I kappa B proteins: newdiscoveries and insights. Annual Review of Immunology 14, 649683.

Beckman, J.S., Chen, J., Crow, J.P., Ye, Y.Z., 1994. Reactions of nitric oxide,superoxide and peroxynitrite with superoxide dismutase in neurodegenera-tion. Progress in Brain Research 103, 371380.

Bhaumik, S., Jyothi, M.D., Khar, A., 2000. Differential modulation of nitricoxide production by curcumin in host macrophages and NK cells. FEBSLetters 483, 7882.

Biswas, S.K., McClure, D., Jimenez, L.A., Megson, I.L., Rahman, I., 2005.Curcumin induces glutathione biosynthesis and inhibits NF-B activationand interleukin-8 release in alveolar epithelial cells: mechanism of freeradical scavenging activity. Antioxidants & Redox Signaling 7, 3241.

Bodles, A.M., Barger, S.W., 2005. Secreted beta-amyloid precursor proteinactivatesmicroglia via JNKand p38-MAPK.NeurobiologyofAging26, 916.

Brouet, I., Oshima, H., 1995. Curcumin, an anti-tumour promoter and anti-inflammatory agent, inhibit induction of nitric oxide synthase in activatedmacrophages. Biochemical and Biophysical Research Communications 206,533540.

Bundy, R.E., Hoare, G.S., Kite, A., Beach, J., Yacoub, M., Marczin, N., 2005.Redox regulation of p38 MAPK activation and expression of ICAM-1 andheme oxygenase-1 in human alveolar epithelial (A549) cells. Antioxidants& Redox Signaling 7, 1424.

Chan, M.M., 1995. Inhibition of tumor necrosis factor by curcumin, aphytochemical. Biochemical Pharmacology 49, 15511556.

Chan, M.M., Huang, H.I., Fenton, M.R., Fong, D., 1998. In vivo inhibition of nitricoxide synthase gene expression by curcumin, a cancer preventive natural productwith anti-inflammatory properties. Biochemical Pharmacology 55, 19551962.

Cho, J.Y., Baik, K.U., Jung, J.H., Park, M.H., 2000. In vitro anti-inflammatoryeffects of cynaropicrin, a sesquiterpene lactone, from Saussurea lappa.European Journal of Pharmacology 398, 399407.

Christman, J.W., Lancaster, L.H., Blackwell, T.S., 1998. Nuclear factor B: apivotal role in the systemic inflammatory response syndrome and new targetfor therapy. Intensive Care Medicine 24, 11311138.

Cook, J.A., Wink, D.A., Blount, V., Krishna, M.C., Hanbauer, I., 1996. Role ofantioxidants in the nitric oxide-elicited inhibition of dopamine uptake incultured mesencephalic neurons. Insights into potential mechanisms of nitricoxidemediated neurotoxicity. Neurochemistry International 28, 609617.

Corbett, J.A., McDaniel, M.L., 1996. Selective inhibition of inducible nitricoxide synthase by aminoguanidine. Methods in Enzymology 268, 398408.

Cuschieri, J., Umanskiy, K., Solomkin, J., 2004. PKC- is essential for endotoxin-induced macrophage activation. Journal of Surgery Research 121, 7683.

Dawson, V.L., Dawson, T.M., London, E.D., Bredt, D.S., Snyder, S.H., 1991.Nitric oxide mediates glutamate neurotoxicity in primary cortical cultures.Proceedings of the National Academy of Sciences 88, 63686371.

Ding, A., Nathan, C.F., Stuehr, D.J., 1988. Release of reactive nitrogenintermediates and reactive oxygen intermediates from mouse peritonealmacrophages. Journal of Immunology 141, 24072418.

Fiebich, B.L., Lieb, K., Engels, S., Heinrich, M., 2002. Inhibition of LPS-inducedp42/44 MAP kinase activation and iNOS/NO synthesis by parthenolide in ratprimary microglial cells. Journal of Neuroimmunology 132, 1824.

Guzik, T.J., Korbut, R., Adamek-Guzik, T., 2003. Nitric oxide and superoxide ininflammation and immune regulation. Journal of Physiology and Pharma-cology 54, 469487.

Hewett, S.J., Csernansky, C.A., Choi, D.W., 1994. Selective potentiation ofNMDA-induced neuronal injury following induction of astrocytic iNOS.Neuron 13, 487494.

Hong, S., Kim, S.H., Rhee, M.H., Kim, A.R., Jung, J.H., Chun, T., Yoo, E.S.,Cho, J.Y., 2003. In vitro anti-inflammatory and pro-aggregative effects of alipid compound, petrocortyne A, from marine sponges. Naunyn-Schmiede-berg's Archives of Pharmacology 368, 448456.

Huang, M.T., Lysz, T., Ferraro, T., Abidi, T.F., Laskin, J.D., Conney, A.H., 1991.Inhibitory effects of curcumin on in vitro lipoxygenase and cyclooxygenase

2029es 79 (2006) 20222031activities in mouse epidermis. Cancer Research 51, 813819.Huang, M.T., Newmark, H.L., Frenkel, K., 1997. Inhibitory effects of curcumin on

tumorigenesis inmice. Journal ofCellular Biochemistry. Supplement 27, 2634.

iencHuie, R.E., Padmaja, S., 1993. The reaction of no with superoxide. Free RadicalResearch Communications 18, 195199.

Jeng, K.C., Hou, R.C., Wang, J.C., Ping, L.I., 2005. Sesamin inhibitslipopolysaccharide-induced cytokine production by suppression of p38mitogen-activated protein kinase and nuclear factor-B. Immunology Letters97, 101106.

Jhun, B.S., Jin, Q., Oh, Y.T., Kim, S.S., Kong, Y., Cho, Y.H., Ha, J., Baik, H.H.,Kang, I., 2004. 5-Aminoimidazole-4-carboxamide riboside suppresseslipopolysaccharide-induced TNF-alpha production through inhibition ofphosphatidylinositol 3-kinase/Akt activation in RAW 264.7 murinemacrophages. Biochemical and Biophysical Research Communications318, 372380.

Jijon, H., Allard, B., Jobin, C., 2004. NF-kappaB inducing kinase activates NF-kappaB transcriptional activity independently of IkappaB kinase gammathrough a p38 MAPK-dependent RelA phosphorylation pathway. CellularSignalling 16, 10231032.

Joe, B., Lokesh, B.R., 1994. Role of capsaicin, curcumin and dietary n-3 fattyacids in lowering the generation of reactive oxygen species in rat peritonealmacrophages. Biochimica et Biophysica Acta 124, 255263.

Kang, G., Kong, P.J., Yuh, Y.J., Lim, S.Y., Yim, S.V., Chun, W., Kim, S.S.,2004. Curcumin suppresses lipopolysaccharide-induced cyclooxygenase-2expression by inhibiting activator protein 1 and nuclear factor kappa bbindings in BV2 microglial cells. Journal of Pharmacological Sciences 94,325328.

Khadaroo, R.G., Kapus, A., Powers, K.A., Cybulsky, M.I., Marshall, J.C.,Rotstein, O.D., 2003. Oxidative stress reprograms lipopolysaccharidesignaling via Src kinase-dependent pathway in RAW 264.7 macrophagecell line. Journal of Biological Chemistry 278, 4783447841.

Kim, W.K., Ko, K.H., 1998. Potentiation of N-methyl-D-aspartate-mediatedneurotoxicity by immunostimulated murine microglia. Journal of Neurosci-ence Research 54, 1726.

Kim, H.Y., Park, E.J., Joe, E.H., Jou, I., 2003a. Curcumin suppresses Januskinase-STAT inflammatory signaling through activation of Src homology 2domain-containing tyrosine phosphatase 2 in brain microglia. Journal ofImmunology 171, 60726079.

Kim, J.E., Kim, A.R., Chung, H.Y., Han, S.Y., Kim, B.S., Choi, J.S., 2003b. Invitro peroxynitrite scavenging activity of diarylheptanoids from Curcumalonga. Phytotherapy Research 17, 481484.

Kim, A.R., Cho, J.Y., Lee, J.Y., Choi, J.S., Chung, H.Y., 2005. Hydroquinonemodulates reactivity of peroxynitrite and nitric oxide production. Journal ofPharmacy and Pharmacology 57, 475481.

Kristof, A.S., Marks-Konczalik, J., Moss, J., 2001. Mitogen-activated proteinkinases mediate activator protein-1-dependent human inducible nitric-oxidesynthase promoter activation. Journal of Biological Chemistry 276,84458452.

Kumar, A., Dhawan, S., Hardegen, N.J., Aggarwal, B.B., 1998. Curcumin(diferuloyl-methane) inhibition of tumor necrosis factor (TNF)-mediatedadhesion of monocytes to endothelial cells by suppression of cell surfaceexpression of adhesion molecules and of nuclear factor-kappa B activation.Biochemical Pharmacology 55, 775783.

Lee,H.,Kim,Y.O.,Kim,H.,Kim, S.Y.,Noh,H.S.,Kang, S.S., Cho,G.J., Choi,W.S.,Suk, K., 2003a. Flavonoid wogonin from medicinal herb is neuroprotective byinhibiting inflammatory activation of microglia. FASEB Journal 17, 19431944.

Lee, J.K., Choi, S.S., Won, J.S., Suh, H.W., 2003b. The regulation of induciblenitric oxide synthase gene expression induced by lipopolysaccharide andtumor necrosis factor-alpha in C6 cells: involvement of AP-1 and NF-kappaB. Life Sciences 73, 595609.

Lee, J., Im, Y.H., Jung, H.H., Kim, J.H., Park, J.O., Kim, K., Kim, W.S., Ahn, J.S.,Jung, C.W., Park, Y.S., Kang, W.K., Park, K., 2005. Curcumin inhibitsinterferon-alpha induced NF-kappaB and COX-2 in human A549 non-smallcell lung cancer cells. Biochemical andBiophysical ResearchCommunications334, 313318.

Li, Y., Liu, L., Barger, S.W., Mrak, R.E., Griffin, W.S., 2001. Vitamin Esuppression of microglial activation is neuroprotective. Journal ofNeuroscience Research 66, 163170.

2030 K.K. Jung et al. / Life ScLim, G.P., Chu, T., Yang, F., Beech, W., Frautschy, S.A., Cole, G.M., 2001. Thecurry spice curcumin reduces oxidative damage and amyloid pathology in anAlzheimer transgenic mouse. Journal of Neuroscience 21, 83708377.Lipton, S.A., Choi, Y., Pan, Z., Lei, S.Z., Chen, H.V., Sucher, N.J., Loscalzo, J.,Singel, D.J., Stamler, J.S., 1993. A redox based mechanism for theneuroprotective and neurodestructive effects of nitric oxide and relatednitroso-compounds. Nature 364, 626632.

Macmicking, J., Xie, Q.W., Nathan, C., 1997. Nitric oxide and macrophagefunction. Annual Review of Immunology 15, 323350.

Matsuura, M., Saito, S., Hirai, Y., Okamura, H., 2003. A pathway throughinterferon-gamma is the main pathway for induction of nitric oxide uponstimulation with bacterial lipopolysaccharide in mouse peritoneal cells.European Journal of Biochemistry 270, 40164025.

Meselhy, M.R., 2003. Inhibition of LPS-induced NO production by the oleogumresin of Commiphora wightii and its constituents. Phytochemistry 62,213218.

Nick, J.A., Avdi, N.J., Young, S.K., Lehman, L.A., McDonald, P.P., Frasch, S.C.,Billstrom, M.A., Henson, P.M., Johnson, G.L., Worthen, G.S., 1999.Selective activation and functional significance of p38alpha mitogen-activated protein kinase in lipopolysaccharide-stimulated neutrophils.Journal of Clinical Investigation 103, 851858.

Onoda, M., Inano, H., 2000. Effect of curcumin on the production of nitric oxideby cultured rat mammary gland. Nitric Oxide 4, 505515.

Onyango, I.G., Tuttle, J.B., Bennett Jr., J.P., 2005. Activation of p38 and N-acetylcysteine-sensitive c-Jun NH2-terminal kinase signaling cascades isrequired for induction of apoptosis in Parkinson's disease cybrids.Molecular and Cellular Neurosciences 28, 452461.

Otani, H., 2004. Reactive oxygen species as mediators of signal transduction inischemic preconditioning. Antioxidants & Redox Signaling 6, 449469.

Park, L.C.H., Zhang, H., Sheu, K.F.R., Calingasan, N.Y., Kristal, B.S., Lindsay,J.G., Gibson, G.E., 1999. Metabolic impairment induces oxidative stress,compromises inflammatory responses, and inactivates a key mitochondrialenzyme in microglia. Journal of Neurochemistry 72, 19481958.

Pyo, H., Jou, I., Jung, S., Hong, S., Joe, E., 1998. Mitogen-activated proteinkinases activated by lipopolysaccharide and -amyloid in cultured ratmicroglia. NeuroReport 9, 871874.

Saccani, S., Pantano, S., Natoli, G., 2002. p38-dependent marking ofinflammatory genes for increased NF-B recruitment. Nature Immunology3, 6975.

Schwenger, P., Alpert, D., Skolnik, E.Y., Vilcek, J., 1998. Activation of p38mitogen-activated protein kinase by sodium salicylate leads to inhibition oftumor necrosis factor induced IB phosphosphorylation and degradation.Molecular and Cellular Biology 18, 7884.

Shoba, G., Joy, D., Joseph, T., Majeed, M., Rajendran, R., Srinivas, P.S., 1998.Influence of on the pharmacokinetics of curcumin in animal and humanvolunteers. Planta Medica 64, 353356.

Simmons, M.L., Murphy, S., 1992. Induction of nitric oxide synthase in glialcells. Journal of Neurochemistry 59, 897905.

Spiegelman, V.S., Stavropoulos, P., Latres, E., Pagano, M., Ronai, Z., Slaga, T.J.,Fuchs, S.Y., 2001. Induction of beta-transducin repeat-containing protein byJNK signaling and its role in the activation of NF-kappaB. Journal ofBiological Chemistry 276, 2715227158.

Sreejayan, Rao, M.N., 1997. Nitric oxide scavenging by curcuminoids. Journalof Pharmacy and Pharmacology 49, 105107.

Surh, Y.J., Chun, K.S., Cha, H.H., Han, S.S., Keum, Y.S., Park, K.K., Lee, S.S.,2001. Molecular mechanisms underlying chemopreventive activities of anti-inflammatory phytochemicals: down-regulation of COX-2 and iNOSthrough suppression of NF-B activation. Mutation Research 480481,243268.

Szabo, C., Thiemermann, C., 1995. Regulation of the expression of theinducible isoform of nitric oxide synthase. Advances in Pharmacology 34,113153.

Torres, M., 2003. Mitogen-activated protein kinase pathways in redox signaling.Frontiers in Bioscience 8, d369d391.

Vajragupta, O., Boonchoong, P., Berliner, L.J., 2004. Manganese complexes ofcurcumin analogues: evaluation of hydroxyl radical scavenging ability,superoxide dismutase activity and stability towards hydrolysis. Free RadicalResearch 38, 303314.

es 79 (2006) 20222031Waetzig, G.H., Seegert, D., Rosenstiel, P., Nikolaus, S., Schreiber, S., 2002. p38mitogen-activated protein kinase is activated and linked to TNF- signalingin inflammatory bowel disease. Journal of Immunology 168, 53425351.

Walton, K.M., DiRocco, R., Bartlett, B.A., Koury, E., Marcy, V.R., Jarvis, B.,Schaefer, E.M., Bhat, R.V., 1998. Activation of p38 MAPK in microgliaafter ischemia. Journal of Neurochemistry 70, 17641767.

Wang, M.J., Lin, W.W., Chen, H.L., Chang, Y.H., Ou, H.C., Kuo, J.S., Hong, J.S.,Jeng, K.C., 2002. Silymarin protects dopaminergic neurons against lipopoly-saccharide-induced neurotoxicity by inhibiting microglia activation. EuropeanJournal of Neuroscience 16, 21032112.

Wilms, H., Rosenstiel, P., Sievers, J., Deuschl, G., Zecca, L., Lucius, R., 2003.Activation of microglia by human neuromelanin is NF-B dependent and

involves p38 mitogen-activated protein kinase: implications for Parkinson'sdisease. FASEB Journal 17, 500502.

Woo, M.S., Jung, S.H., Kim, S.Y., Hyun, J.W., Ko, K.H., Kim, W.K., Kim, H.S.,2005. Curcumin suppresses phorbol ester-induced matrix metalloproteinase-9 expression by inhibiting the PKC to MAPK signaling pathways in humanastroglioma cells. Biochemical and Biophysical Research Communications335, 10171025.

2031K.K. Jung et al. / Life Sciences 79 (2006) 20222031

Inhibitory effect of curcumin on nitric oxide production from lipopolysaccharide-activated prim.....IntroductionMaterials and methodsReagentsPrimary microglial cell cultureMeasurement of nitriteReverse transcription-polymerase chain reaction (RT-PCR)Western blot analysisImmunocytochemistryBV2 cell culture and transient transfection assayElectrophoretic mobility shift assayNuclear extractionElectrophoretic mobility shift assay for NF-BStatistical analysis

ResultsInhibition of NO production by curcumin in primary microgliaEffect of curcumin on MAPK activationInhibition of NF-B activation by curcumin

DiscussionAcknowledgmentsReferences