Upload
moriah-strobridge
View
227
Download
7
Embed Size (px)
Citation preview
1
Origin of Man and the Races
Richard Deem, M.S.
Reasons To Believe
2
General Outline• Biblical data and scientific data
• Origin of man
• Molecular and genetic data – mtDNA and Y chromosome
mtDNAMitochondrial DNA – A small piece of DNA that codes for a small number of proteins within the energy-producing sub-cellular organelle known as the mitochondrion
mtDNAMitochondrial DNA – A small piece of DNA that codes for a small number of proteins within the energy-producing sub-cellular organelle known as the mitochondrion
• Neandertals and humans
• Bipedal primates and chimpanzees
• Origin of the races
3
Why All the Biology?And to the Jews I became as a Jew, that I might win Jews; to those who are under the Law, as under the Law, though not being myself under the Law, that I might win those who are under the Law; to those who are without law, as without law, though not being without the law of God but under the law of Christ, that I might win those who are without law. To the weak I became weak, that I might win the weak; I have become all things to all men, that I may by all means save some. (1 Corinthians 9:20-22)
4
Origin of Man Classic Hypothesis
Neandertals
H. antecessor
H. ergaster
EuropeanHumans
AfricanHumans Asian
Humans
5
Origins of Mammals• Soulish (nephesh) creatures
created on days 5 and 6• Creation of specific mammals
(cattle, rodents, and carnivores) described for day 6.
• Though not specifically mentioned, probably included the creation of bipedal primates
NepheshThe Hebrew word most often translated “soul,” referring to both man and animals, including mind, will, and emotion
NepheshThe Hebrew word most often translated “soul,” referring to both man and animals, including mind, will, and emotion
6
Origin of Man – Biblical Data
Genesis 1:26
Then God said, “Let us make (asah) man in our image, in our likeness…
7
Origin of Man – Biblical Data
Genesis 1:27So God created (bara) man
in his own image, in the image of God he created (bara) him: male and female he created (bara) them.
8
Origin of Man – Biblical Data
Genesis 2:7Then the LORD God formed
(yatsar) man of dust from the ground, and breathed into his nostrils the breath of life; and man became a living being. (Genesis 2:7)
9
Man – Part New, Part Old
• Bara – created new, probably refers to the spiritual qualities, self-awareness, moral understanding
• Asa, yatsar – made or formed from pre-existing material, probably refers to body and soul
10
Genesis 2:10, 14Now a river flowed out of Eden to water the garden; and from there it divided and became four rivers.
Biblical Data – Garden of Eden
And the name of the third river is Tigris; it flows east of Assyria. And the fourth river is the Euphrates.
11
Origin of Man – Biblical Data
• Adequate, but incomplete genealogies
• Ben and ab
• ~10,000 - 50,000 years ago
Dating human origins:
12
Incomplete GenealogiesMatthew 1:8 1 Chronicles 3:10-12
and to Asa was born Jehoshaphat; and to Jehoshaphat, Joram; and to Joram, Uzziah;
Asa his son, Jehoshaphat his son, Jehoram his son, Ahaziah his son, Joash his son, Amaziah his son, Azariah [Uzziah] his son
13
Incomplete GenealogiesGenesis 5-11 Luke 3:34-36
(reversed order)And Lamech… father of a son… Noah, (Genesis 5:28-29)... became the father of Shem. (Genesis 5:32)... The sons of Shem: Elam, Asshur, Arphaxad, Lud and Aram. (Genesis 10:22)... Arphaxad was the father of Shelah, and Shelah the father of Eber. Two sons were born to Eber: One was named Peleg (Genesis 10:24-25)
the son of Serug, the son of Reu, the son of Peleg, the son of Heber, the son of Shelah, (Luke 3:35)the son of Cainan, the son of Arphaxad, the son of Shem, the son of Noah, the son of Lamech, (Luke 3:36)
14
Direct Descent?
• ben – son, grandson, etc.
• ab – father, grandfather
Harris, R.L., G.L. Archer, and B.K. Wilke. 1980. Theological Wordbook of the Old Testament, Vol. 1. Moody Press, Chicago, IL, pp. 5-6, 113-114.
15
Direct Descent?NASB Alternate
Translation
And Enosh lived ninety years, and became the father of Kenan. (Genesis 5:9)
And Enosh lived ninety years, and became the father of the family line that culminated with Kenan. (Genesis 5:9)
16
How Many Generations?
• Deuteronomy 7:9
• 1 Chronicles 16:15
• Psalms 105:8
He has remembered His covenant forever, The word which He commanded to a thousand generations, (Psalms 105:8)
1,000 gen x 40 yr/gen = 40,000 yr
17
Scientific Predictionsfor the
Origin of Humans
Creation Model
18
Scientific Predictions
• Anatomical – basic body plan
• Physiological – the way the body works
• Biochemical – the chemical pathways and machines that underlie everything
Similarities with Other Animals
19
Scientific Predictions
Sudden appearance…
• Human fossils
• Human culture
• Spiritual activity
20
Scientific Predictions
Origin of man:
• Traceable to a single man and a single woman
• Recent origin
21
Origin of man:
Scientific Predictions
• All males directly related to Noah
• All females directly related to Eve
Females should be more genetically diverse
22
Scientific Data for Human Origins
23
Molecular Anthropology
• Similarities and differences
• Extent of differences
Compare DNA sequences among modern human groups
24
Gives
Molecular Anthropology
• Date of humanity’s origin
• Original population size
25
Molecular Anthropology
Gives• Pattern for
humanity’s spread
• Geographic location of humanity’s origin
26
Genetic Diversity
Evidence• Mitochondrial DNA• Y chromosomal DNA
• Linkage disequilibrium• Microsatellites
Mitochondrial DNA (mtDNA)Male sperm contribute only genetic material and no cellular organelles. Therefore, all mtDNA comes from the egg, being passed down exclusively by females.
Mitochondrial DNA (mtDNA)Male sperm contribute only genetic material and no cellular organelles. Therefore, all mtDNA comes from the egg, being passed down exclusively by females.
Y chromosomeA small chromosome that determines the sex of an individual. Embryos that posses a Y chromosome become male. Therefore, the genetic information on the Y chromosome is passed down only by males.
Y chromosomeA small chromosome that determines the sex of an individual. Embryos that posses a Y chromosome become male. Therefore, the genetic information on the Y chromosome is passed down only by males.
Linkage disequilibriumThe non-random association of alleles at different loci (or regions within DNA sequences), not expected from the law of independent assortment.
Linkage disequilibriumThe non-random association of alleles at different loci (or regions within DNA sequences), not expected from the law of independent assortment.
MicrosatellitesMicrosatellites" are loci where short sequences of DNA are repeated in tandem arrays (one right after the other).
MicrosatellitesMicrosatellites" are loci where short sequences of DNA are repeated in tandem arrays (one right after the other).
27
Genetic Diversity• Humanity had
a recent origin• African origin• Small
population that rapidly expanded recently
28
Human Chromosome 21Diversity
• Three haplotypes describe 80% of human population
HaplotypeA combination of alleles (alternate forms of the same gene) of closely linked loci that are found in a single chromosome and tend to be inherited together
HaplotypeA combination of alleles (alternate forms of the same gene) of closely linked loci that are found in a single chromosome and tend to be inherited together
• Far fewer haplotypes than expected
29
Mitochondrial DNA• Humanity
originated less than 150,000 ya
• Small population of women
• Single location (Africa)
30
Y Chromosome MappingTestis Determining Factor (TDF)
Channel Surfing (SRF)Addiction to death and destruction movies (T-2)
The need to always be right (TLD-U)
Spitting and hacking (P2E)
Inability to express affection (ME-2)
Finding humor in bodily noises (BLCH)
Inability to put toilet seat down (BIDET)
Selective hearing loss (MUM)
Inability to ask directions (LST)
Ability to write name with urine (CMeP)
31
Y Chromosome Data
Study
Total Base Pairs
95% CI
MeanPop. SizeLower Upper
Dorit, et al.
27,702 0 800,000 270,000 7,500
Hammer 39,000 51,000 411,000 188,000 5,000
Whitfield, et al.
91,500 37,000 49,000 43,000 N/A
CI (Confidence Interval)A statistical measure of the certainty of a value. 95% CI means that there is a 95% probability that the result lies between the CI values.
CI (Confidence Interval)A statistical measure of the certainty of a value. 95% CI means that there is a 95% probability that the result lies between the CI values.
32
Male vs. Female Divergence
Age of Coalescence
Y
(Male)
mtDNA
(Female)
Minimum 37,000 120,000
Maximum 49,000 474,000
Whitfield, L.S., J.E. Suston, and P.N. Goodfellow. 1995. Sequence variation of the human Y chromosome. Nature 378: 379-380.
33
Y Chromosome Summary• Humanity
originated less than 50,000 ya
• Small population of men
• Single location (Africa)
34
Linkage Disequilibrium• Humanity
originated less than 50,000 ya
35
Origin of the Malaria Parasite• Originated less
than 120,000 ya
• Resistance alleles appeared 3,000-12,000 ya
36
Scientific Data
Sudden appearance of modern humans in the fossil record
500
1000
1500
0 1 2 3Time (MYA)
Australopithecines
Homo
Cra
nia
l Cap
aci
ty (
cc)
37
Scientific Data
• Sophisticated tool kit
• Socioeconomic organization
• Art work
• Spiritual expression
Sudden appearance of human culture:
38
Sophisticated Tool Kit• A shift from predominantly “rake” to
“blade” stone tool technology• Increased variety and complexity of
stone tools involving a higher degree of “imposed form”
• Complex and extensively shaped bone, antler, and ivory artifacts
• Increased regional diversification of tool forms
39
Socioeconomic Organization• Specialized patterns of animal
exploitation, based on systematic hunting
• A sharp increase in the overall density of human population
• An increase in the maximum size of local residential groups
• Appearance of highly “structured” sites, including hearths, pits, huts, tents, and other habitations
40
Appearance of Modern Art
41
Body Ornaments
• Dated at 40,000 years ago
• No food value
• Unusual designs and color
42
Spiritual Expression• Religious relics and altars date to
24,000 ya
• Artwork containing spiritual content dates to 5,000 ya
43
Deleterious Mutations
"The deleterious mutation rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if mutational effects on fitness were to combine in a multiplicative way."
Mutations Overall Deleterious
Conservative 4.2 1.6
Realistic 6.7 3.1
Eyre-Walker, A. & Keightley, P. D. 1999. High genomic deleterious mutation rates in hominids. Nature 397, 344-347.
44
• Pseudogenes present in great apes and humans
PseudogenesRegions of non-coding DNA (DNA that does not code for functional protein) that have been apparently duplicated from functional genes.
PseudogenesRegions of non-coding DNA (DNA that does not code for functional protein) that have been apparently duplicated from functional genes.
• Beta globin
• Enolase
• Vitamin C
• Assumes that God would never reuse previous designs
Evidence Against the Design of Humans?
45
Summary - Scientific Data
• Humans originated from a small population of males and females
• Recent origin of modern humans
• ~ 50,000 years ago
• Humans originated suddenly and dramatically
46
Origin of Man “Out-of-Africa” Hypothesis
H. ergaster
AfricanHumans
EuropeanHumans Asian
Humans
Neandertals
H. antecessor ?
?
?
47
Who were the Neandertals?
48
•Lived ~150,000 to ~30,000 Lived ~150,000 to ~30,000 years agoyears ago
•Inhabited Europe and western Inhabited Europe and western AsiaAsia
•Lived ~150,000 to ~30,000 Lived ~150,000 to ~30,000 years agoyears ago
•Inhabited Europe and western Inhabited Europe and western AsiaAsia
Who Were the Neandertals?
49
Who Were the Neandertals?
• Bipedal
Physical similarities with modern humans
Bipedal (bipedalism)Ability to walk upright on two legs.Bipedal (bipedalism)Ability to walk upright on two legs.
• Large brain capacity
50
Physical Differences Between Neandertals and Humans
Largefrontteeth
Brow ridge
Receding forehead
Modern HumanModern HumanNeandertalNeandertal
Brain shape
Occipital bun
Retromolar gap
Large eyesockets
Chinreceding
Modern HumanModern HumanNeandertalNeandertal
51
Physical Differences Between Neandertals and Humans
• Elongated foramen magnum
Pterygoid tubercleA small rounded nodule on the Pterygoid bone in the roof of the mouth connecting the palatine in front and the quadrate behind.
Pterygoid tubercleA small rounded nodule on the Pterygoid bone in the roof of the mouth connecting the palatine in front and the quadrate behind.
Foramen magnumThe area where the spine joins the skull
Foramen magnumThe area where the spine joins the skull
• Medial pterygoid tubercle• Flatter skull base
52
Physical Differences Between Neandertals and Humans
• Large nose
• Large sinuses
• Structure of the inner ear
Chimp
Neander.
Human• Higher larynx
53
Physical Differences Between Neandertals and Humans
• Thicker bones
• Barrel chests
• Shorter limbs
• Asymmetrical humerus
MetacarpalsThe bones that connect the wrist bones (carpals) with the finger bones (phalanges).
MetacarpalsThe bones that connect the wrist bones (carpals) with the finger bones (phalanges).
• Thicker metacarpals
54
Neandertal Development
• Craniodental development of Neandertals and humans differs from before birth
CraniodentalA fancy word referring to the skull and teeth
CraniodentalA fancy word referring to the skull and teeth
• Differences occur from the time Neandertals first appear
55
Molecular Paleontology: Neandertal mtDNA
40,000 YA40,000 YANeander, GermanyNeander, Germany
40,000 YA40,000 YAVindija Cave,CroatiaVindija Cave,Croatia 29,000 YA29,000 YA
NorthernCaucasus NorthernCaucasus
56
DNA 101• DNA language:
• 4 “letters” in the alphabetA – Adenine T – ThymineC – Cytosine G – Guanine
• 20 3-letter “words” (codons)Each codon codes for one amino acid
• Unlimited number of “sentences” (proteins)
• Unlimited number of “novels” (organism)
57
Neandertal mtDNA
mtDNA Sample(HVR-1)
Sequence Number (Read Down)11111111111111111111111111111111
166666666666666666666666666666666
600001111111111111222222222223333
437890011234556888023345566791257
178637812998469239930446823891042
0
Mod. HumanAATTCCCCGACTGCAATTCACGCAC-CATCCTC
Chimpanzee ......T.ATT.....ACTGAAA....G....
Neander.#1GG.CTTTTATTC.T.CCCTGTAAGTATGCT.CT
Neander.#2 .C.....ATT.ATCCCCTGTAA.TATGCTTC
Neander.#3 GG......ATTC.TCCCCTGTAAGTATGCT.C
Neander.#4 GG......ATTC.TCCCCTGTAA.TATGCT.C
58
Neandertals – Limited Genetic Diversity
Population
#
Individuals
mtDNA differences
Mean Min. Max.
Neandertals 3 3.73 - -
Humans 5,530 3.43 0.00 10.16
Chimpanzees 359 14.81 0.00 29.06
Gorillas 28 18.57 0.40 28.79
59
Ancient Modern Human mtDNAmtDNA Sample(HVR-1)
Age(ka)
Sequence Number (Read Down)001111111111111112222222222222222222222222222333333333333337900112234566888900122334444455556667788889990111234555668883781269984393499198340413479368923448467803911780715672817
Modern Human
0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA
Aboriginal 0 ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...
Chimp 0 ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..
Neander #1
30+ GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...
Ancient Aussie
62 ....................T.G...........CT.T....T..T......TC....G
60
Neandertal mtDNA Summary
• Neandertals have no genetic (nor evolutionary) connection to humans
• Neandertals displayed limited genetic diversity
61
Origin of Man Classic Hypothesis
Neandertals
H. antecessor
H. ergaster
EuropeanHumans
AfricanHumans Asian
Humans
62
Origin of Man Multi-regional Hypothesis
H. ergaster
AsianHumans
?
AfricanHumans
?H. erectus
H. antecessor
Neandertals
?
EuropeanHumans
?
63
Multiregional Hypothesis Requires
• Large breeding populations over the entire planet
• Frequent interbreeding of those populations
• Genetic roots traceable to millions of years bp
64
Genetic Data Contradicts Multiregional Hypothesis
Study 1• African and Asian and oceanic
peoples originated from same population group 35-89 kya
Study 2• 90% of founding population must
come from Africa and this population must be small
65
Genetic Data Contradicts Multiregional Hypothesis
Study 3 (small population size)• Nuclear DNA sequences• Alu insertions• HLA exons• mtDNA mismatch distributions• frequency spectra (mtDNA, Y-chr)• allele size vs. homozygosity at tandem
repeat loci
66
Homo erectus Development
• Homo erectus developed in a fashion similar to great apes – not modern humans
• Homo erectus developed from infanthood to adulthood rapidly
67
Descent of Modern Humans
“Most of the familiar specimens of Homo erectus and of archaic
humans known from the Pleistocene were not members of populations ancestral to us”
Harpending, H.C., et al. 1998. Genetic traces of ancient demography. Proc. Natl. Acad. Sci. USA 95: 1961-1967.
68
Origin of Man Multi-regional Hypothesis
H. ergaster
AsianHumans
?
AfricanHumans
?H. erectus
H. antecessor?
? Neandertals
EuropeanHumans
69
Scientific Data
• Anatomical – overall structure and body plan
• Physiological – how the body systems work and interact
• Biochemical – basic chemical pathways
Similarities with other animals
70
Scientific Data
Human – Chimpanzee genetics• ~95-99% Genetic
Similarity• Base substitutions –
1.4%• Insertions/Deletions –
3.4%• Common Descent (?)
71
Humans and Chimpanzees• Chromosome number
• Human (46)• Chimp (48)
• Chromosome sizes• Chromosomal
banding• #2 equivalent to two
smaller chimp chromosomes
• #4 and #17 different
72
Chromosome 21Human-Chimp Comparison
• Chromosome 21 fully sequenced and annotated
• Two clusters with significant differences
PCR ResultChimp-
Chimp and other primates-
HS21 Clone Gaps
73
How Different From Chimpanzees?
• Human problem – anthropomorphizing
• The counting dog
• What do chimpanzees really understand?
74
Human Distinctives
• Large brain size
• Bipedalism
• Advanced culture
• Decreased size of back teeth
75
Emergence of Bipedalism
Driven by habitat change from wood-land to open savanna?
76
Bipedalism TheoriesTheory ProblemsEcology (Woodland to Savanna) Occurred later1
Hunting and tools Occurred later1
Thermoregulation2 Occurred later1
Enhanced vision Wrong environment
Male provider3hominids were reproductively disadvantaged4
Scarce dietary resources
Not fully supported by the data
77
Advantages of Bipedalism
• Travel for food
• Transport food
• Feed in stationary position
• Avoid predatory attacks• Thermoregulatory advantages• Tool use
78
Anatomy of Bipedalism• Shorter/broader
pelvis
Human Great Ape
Valgus angleThe angle the femur (leg bone) makes relative to the knee. About 90 degrees in apes, less in bipeds
Valgus angleThe angle the femur (leg bone) makes relative to the knee. About 90 degrees in apes, less in bipeds
• Valgus angle• Knee
• Lengthened lower limbs
• Enlarged joint surfaces
79
Anatomy of Bipedalism• Restructuring of
ear bones • Platform foot
Human Great Ape
• Foot arches• Relocation of
hallux (big toe)
80
Anatomy of Bipedalism• Relocation of
foramen magnum
Human Great Ape
• Lower/upper spine curvature
• Restructuring of rib cage
• Rearrangement of musculature
81
Ecology of Bipedalism
Early australopithecines lived in mixed woodland and savanna
• A. ramidus (5.8 and 4.5 mya)
• A. anamensis (4.2 mya)
• A. afarensis (3.9 mya)
• A. bahrelghazari (3.5 mya)
82
Natural History of Bipedalism
Facultative bipeds• A. ramidus (5.8 mya)• A. anamensis (4.2 mya)• A. habilis (2.5 mya)
83
Natural History of Bipedalism
Obligatory bipeds (type I)• H. erectus
(2 million years ago)• H. neandertalensis
(150,000 years ago)
84
Natural History of Bipedalism
Obligatory bipeds (type II)• Homo sapiens sapiens
(modern humans) (50,000 years ago)
85
Bipedalism in Hominins
Time (MYA)
Small brain, small teeth, quadruped
Chimpanzee (Pan)
Large brain, small teeth, obligate bipedMan (Homo sapiens)H. neandertalensis
H. heidelbergensis
H. erectusH. ergaster
Small brain, very large teeth, facultative biped
P. boisei
P. robusts
0 1 2 3 4 5 6 7 8
Insufficient evidenceH. antecessor
H. rudolfemsis
A. garbi
K. platyops
P. aethiopicusO. tugenesis
S. tchadensis
A. bahreighazali
A. ramidus
Small brain, large teeth, facultative biped
A. habilis
A. afarensisA. africanus
A. anamensis
HomininsSuperfamily including the hominids (Genus Homo and Australopithecus) along with the bipedal apes and chimpanzees.
HomininsSuperfamily including the hominids (Genus Homo and Australopithecus) along with the bipedal apes and chimpanzees.
86
Emergence of Bipedalism• Minimal driving force/selective
pressure• Appears suddenly in the fossil
record• Requires major anatomical
rearrangement• Rapid change followed by period of
no change
87
Origin of Man Creation Model
All Humans
ADAM & EVE
All other bipedal primate species are a special creation of God
88
Origin of the Human Races
Biblical and Scientific Explanations
89
Origin of the Races
God’s original command:
And God blessed them; and God said to them, "Be fruitful and multiply, and fill the earth..." (Genesis 1:28)
90
Origin of the Races
God reissued his command:
"and as for you, be fruitful and multiply; Populate the earth abundantly and multiply in it." (Genesis 9:7)
91
World Peace and Unity?
Human pride and greed result in oppression of people
• Media-Persia
• Greece
• Rome
92
God’s Peace and Unity• “Do you suppose that I came to
grant peace on earth? I tell you, no, but rather division;” (Luke 12:51)
• “Peace I leave with you; My peace I give you. I do not give to you as the world gives.” (John 14:27)
93
Early Post-Flood Civilization
• Rapid repopulation of Mesopotamia
• Nimrod built 8 large cities, including Nineveh
Biblical data
94
Scattering of the World’s People
• At the city of Babel, the people began building a huge tower
• God confused their language and scattered them over the face of the earth
Biblical data
95
Scattering of the World’s People
• Geographic barriers • Bering Strait – Americas and
Asia• Strait of Malaca – Indonesia and
Asia• Torres Strait – Australia and
Asia• Land bridges established by the
ice age
96
Dividing the Earth
• Biblical data
• Two sons were born to Eber: One was named Peleg, because in his time the earth was divided… (Genesis 10:25)
• Scientific Data
• Land bridges covered by rising oceans ~11,000 ya
97
Origin of the Races
What the Bible says
• Moses married a Cushite woman) (Numbers 12:1)
• Solomon married a black woman (Song of Songs 1:5)
• Ethiopians described as dark-skinned (Jeremiah 13:23)
98
Origin of the RacesWhat the Bible doesn’t say
• When and how did the races begin?
• No biblical data – Not important enough to mention?
• Mark of Cain?
• Ham’s penalty?
• Part of the scattering at the Tower of Babel?
99
Origin of the RacesRace facts:• Single biological species - Homo
sapiens sapiens. • Race described on the basis of
skin color, hair form, facial morphology, body proportions, and other, less obvious traits – not based upon genetics
100
Origin of the RacesScientific classification
• African (groups indigenous to Africa)
• Caucasian (European populations)
• Greater Asian (Mongols, Polynesians, Micronesians)
• Amerindian (North & South American Indians, Eskimos)
• Australoid (Australia, Papua)
101
Biological Basis for Race• No specific “race genes”• Skin color – melanin (phenomelanin
and eumelanin)• Melanin expression – controlled by
the enzyme tyrosinase• All people have enough tyrosinase to
be very black in skin color• Regulation of the tyrosinase
determines skin color
102
Origin of the Races
Protein polymorphisms
• 84% of all variation is found within each racial group
• 10% of variation is found among racial groups
• More genetic variation within races than between them
103
Skin Color Distribution Vs. Blood Type
Type A Type B
Relative Skin Color
equator
104
“Racial” Diversity Among Chimpanzees Compared to Humans
Measure Chimps Humans
X-chromosome 0.13% 0.037%
mtDNA (MPSD) 14.8 3.4
Fst values >2.0 0.08
Substitution rate >0.05 0.029
Heterozygosity 3.9% 1.8%
105
Scientific Theories on the Origin of Human Races
• Dark skin protects against ultraviolet radiation and cancer
• Light skin allows enhanced formation of vitamin D3
• Exception – Inuit (Eskimos)
• Selective breeding
106
Origin of Races – Conclusions• The origin of the races was not
thought to be important enough to put in the Bible
• Biological changes required to produce human races are well within those possible through microevolutionary processes
107
Modern Humans – Comparison of Models
Appearance Creation Darwinism
Fossils Suddenly Gradual
Culture Rapid Gradual
Location Single site Many sites?
Descent NoneUnknown ancestor
108
Summary• Modern humans originated recently
from a small population at a single geographic location
• Modern culture and religious expression appeared suddenly and dramatically
• Modern humans are not descended from Neandertal, H. erectus or any other identifiable bipedal hominid
109
Conclusions• Naturalistic explanations fail to explain
the origin of modern man• Supernatural creation is a superior
model for understanding man’s origin• The races of man likely originated
from selective breeding and not a supernatural act, although they may have been the indirect result of the scattering at the tower of Babel