1 Origin of Man and the Races Richard Deem, M.S. Reasons To Believe

1

Origin of Man and the Races

Richard Deem, M.S.

Reasons To Believe

2

General Outline• Biblical data and scientific data

• Origin of man

• Molecular and genetic data – mtDNA and Y chromosome

mtDNAMitochondrial DNA – A small piece of DNA that codes for a small number of proteins within the energy-producing sub-cellular organelle known as the mitochondrion

mtDNAMitochondrial DNA – A small piece of DNA that codes for a small number of proteins within the energy-producing sub-cellular organelle known as the mitochondrion

• Neandertals and humans

• Bipedal primates and chimpanzees

• Origin of the races

3

Why All the Biology?And to the Jews I became as a Jew, that I might win Jews; to those who are under the Law, as under the Law, though not being myself under the Law, that I might win those who are under the Law; to those who are without law, as without law, though not being without the law of God but under the law of Christ, that I might win those who are without law. To the weak I became weak, that I might win the weak; I have become all things to all men, that I may by all means save some. (1 Corinthians 9:20-22)

4

Origin of Man Classic Hypothesis

Neandertals

H. antecessor

H. ergaster

EuropeanHumans

AfricanHumans Asian

Humans

5

Origins of Mammals• Soulish (nephesh) creatures

created on days 5 and 6• Creation of specific mammals

(cattle, rodents, and carnivores) described for day 6.

• Though not specifically mentioned, probably included the creation of bipedal primates

NepheshThe Hebrew word most often translated “soul,” referring to both man and animals, including mind, will, and emotion

NepheshThe Hebrew word most often translated “soul,” referring to both man and animals, including mind, will, and emotion

6

Origin of Man – Biblical Data

Genesis 1:26

Then God said, “Let us make (asah) man in our image, in our likeness…

7


Genesis 1:27So God created (bara) man

in his own image, in the image of God he created (bara) him: male and female he created (bara) them.

8


Genesis 2:7Then the LORD God formed

(yatsar) man of dust from the ground, and breathed into his nostrils the breath of life; and man became a living being. (Genesis 2:7)

9

Man – Part New, Part Old

• Bara – created new, probably refers to the spiritual qualities, self-awareness, moral understanding

• Asa, yatsar – made or formed from pre-existing material, probably refers to body and soul

10

Genesis 2:10, 14Now a river flowed out of Eden to water the garden; and from there it divided and became four rivers.

Biblical Data – Garden of Eden

And the name of the third river is Tigris; it flows east of Assyria. And the fourth river is the Euphrates.

11


• Adequate, but incomplete genealogies

• Ben and ab

• ~10,000 - 50,000 years ago

Dating human origins:

12

Incomplete GenealogiesMatthew 1:8 1 Chronicles 3:10-12

and to Asa was born Jehoshaphat; and to Jehoshaphat, Joram; and to Joram, Uzziah;

Asa his son, Jehoshaphat his son, Jehoram his son, Ahaziah his son, Joash his son, Amaziah his son, Azariah [Uzziah] his son

13

Incomplete GenealogiesGenesis 5-11 Luke 3:34-36

(reversed order)And Lamech… father of a son… Noah, (Genesis 5:28-29)... became the father of Shem. (Genesis 5:32)... The sons of Shem: Elam, Asshur, Arphaxad, Lud and Aram. (Genesis 10:22)... Arphaxad was the father of Shelah, and Shelah the father of Eber. Two sons were born to Eber: One was named Peleg (Genesis 10:24-25)

the son of Serug, the son of Reu, the son of Peleg, the son of Heber, the son of Shelah, (Luke 3:35)the son of Cainan, the son of Arphaxad, the son of Shem, the son of Noah, the son of Lamech, (Luke 3:36)

14

Direct Descent?

• ben – son, grandson, etc.

• ab – father, grandfather

Harris, R.L., G.L. Archer, and B.K. Wilke. 1980. Theological Wordbook of the Old Testament, Vol. 1. Moody Press, Chicago, IL, pp. 5-6, 113-114.

15

Direct Descent?NASB Alternate

Translation

And Enosh lived ninety years, and became the father of Kenan. (Genesis 5:9)

And Enosh lived ninety years, and became the father of the family line that culminated with Kenan. (Genesis 5:9)

16

How Many Generations?

• Deuteronomy 7:9

• 1 Chronicles 16:15

• Psalms 105:8

He has remembered His covenant forever, The word which He commanded to a thousand generations, (Psalms 105:8)

1,000 gen x 40 yr/gen = 40,000 yr

17

Scientific Predictionsfor the

Origin of Humans

Creation Model

18

Scientific Predictions

• Anatomical – basic body plan

• Physiological – the way the body works

• Biochemical – the chemical pathways and machines that underlie everything

Similarities with Other Animals

19


Sudden appearance…

• Human fossils

• Human culture

• Spiritual activity

20


Origin of man:

• Traceable to a single man and a single woman

• Recent origin

21

Origin of man:


• All males directly related to Noah

• All females directly related to Eve

Females should be more genetically diverse

22

Scientific Data for Human Origins

23

Molecular Anthropology

• Similarities and differences

• Extent of differences

Compare DNA sequences among modern human groups

24

Gives


• Date of humanity’s origin

• Original population size

25


Gives• Pattern for

humanity’s spread

• Geographic location of humanity’s origin

26

Genetic Diversity

Evidence• Mitochondrial DNA• Y chromosomal DNA

• Linkage disequilibrium• Microsatellites

Mitochondrial DNA (mtDNA)Male sperm contribute only genetic material and no cellular organelles. Therefore, all mtDNA comes from the egg, being passed down exclusively by females.

Mitochondrial DNA (mtDNA)Male sperm contribute only genetic material and no cellular organelles. Therefore, all mtDNA comes from the egg, being passed down exclusively by females.

Y chromosomeA small chromosome that determines the sex of an individual. Embryos that posses a Y chromosome become male. Therefore, the genetic information on the Y chromosome is passed down only by males.

Y chromosomeA small chromosome that determines the sex of an individual. Embryos that posses a Y chromosome become male. Therefore, the genetic information on the Y chromosome is passed down only by males.

Linkage disequilibriumThe non-random association of alleles at different loci (or regions within DNA sequences), not expected from the law of independent assortment.

Linkage disequilibriumThe non-random association of alleles at different loci (or regions within DNA sequences), not expected from the law of independent assortment.

MicrosatellitesMicrosatellites" are loci where short sequences of DNA are repeated in tandem arrays (one right after the other).

MicrosatellitesMicrosatellites" are loci where short sequences of DNA are repeated in tandem arrays (one right after the other).

27

Genetic Diversity• Humanity had

a recent origin• African origin• Small

population that rapidly expanded recently

28

Human Chromosome 21Diversity

• Three haplotypes describe 80% of human population

HaplotypeA combination of alleles (alternate forms of the same gene) of closely linked loci that are found in a single chromosome and tend to be inherited together

HaplotypeA combination of alleles (alternate forms of the same gene) of closely linked loci that are found in a single chromosome and tend to be inherited together

• Far fewer haplotypes than expected

29

Mitochondrial DNA• Humanity

originated less than 150,000 ya

• Small population of women

• Single location (Africa)

30

Y Chromosome MappingTestis Determining Factor (TDF)

Channel Surfing (SRF)Addiction to death and destruction movies (T-2)

The need to always be right (TLD-U)

Spitting and hacking (P2E)

Inability to express affection (ME-2)

Finding humor in bodily noises (BLCH)

Inability to put toilet seat down (BIDET)

Selective hearing loss (MUM)

Inability to ask directions (LST)

Ability to write name with urine (CMeP)

31

Y Chromosome Data

Study

Total Base Pairs

95% CI

MeanPop. SizeLower Upper

Dorit, et al.

27,702 0 800,000 270,000 7,500

Hammer 39,000 51,000 411,000 188,000 5,000

Whitfield, et al.

91,500 37,000 49,000 43,000 N/A

CI (Confidence Interval)A statistical measure of the certainty of a value. 95% CI means that there is a 95% probability that the result lies between the CI values.

CI (Confidence Interval)A statistical measure of the certainty of a value. 95% CI means that there is a 95% probability that the result lies between the CI values.

32

Male vs. Female Divergence

Age of Coalescence

Y

(Male)

mtDNA

(Female)

Minimum 37,000 120,000

Maximum 49,000 474,000

Whitfield, L.S., J.E. Suston, and P.N. Goodfellow. 1995. Sequence variation of the human Y chromosome. Nature 378: 379-380.

33

Y Chromosome Summary• Humanity


• Small population of men

• Single location (Africa)

34

Linkage Disequilibrium• Humanity


35

Origin of the Malaria Parasite• Originated less

than 120,000 ya

• Resistance alleles appeared 3,000-12,000 ya

36

Scientific Data

Sudden appearance of modern humans in the fossil record

500

1000

1500

0 1 2 3Time (MYA)

Australopithecines

Homo

Cra

nia

l Cap

aci

ty (

cc)

37

Scientific Data

• Sophisticated tool kit

• Socioeconomic organization

• Art work

• Spiritual expression

Sudden appearance of human culture:

38

Sophisticated Tool Kit• A shift from predominantly “rake” to

“blade” stone tool technology• Increased variety and complexity of

stone tools involving a higher degree of “imposed form”

• Complex and extensively shaped bone, antler, and ivory artifacts

• Increased regional diversification of tool forms

39

Socioeconomic Organization• Specialized patterns of animal

exploitation, based on systematic hunting

• A sharp increase in the overall density of human population

• An increase in the maximum size of local residential groups

• Appearance of highly “structured” sites, including hearths, pits, huts, tents, and other habitations

40

Appearance of Modern Art

41

Body Ornaments

• Dated at 40,000 years ago

• No food value

• Unusual designs and color

42

Spiritual Expression• Religious relics and altars date to

24,000 ya

• Artwork containing spiritual content dates to 5,000 ya

43

Deleterious Mutations

"The deleterious mutation rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if mutational effects on fitness were to combine in a multiplicative way."

Mutations Overall Deleterious

Conservative 4.2 1.6

Realistic 6.7 3.1

Eyre-Walker, A. & Keightley, P. D. 1999. High genomic deleterious mutation rates in hominids. Nature 397, 344-347.

44

• Pseudogenes present in great apes and humans

PseudogenesRegions of non-coding DNA (DNA that does not code for functional protein) that have been apparently duplicated from functional genes.

PseudogenesRegions of non-coding DNA (DNA that does not code for functional protein) that have been apparently duplicated from functional genes.

• Beta globin

• Enolase

• Vitamin C

• Assumes that God would never reuse previous designs

Evidence Against the Design of Humans?

45

Summary - Scientific Data

• Humans originated from a small population of males and females

• Recent origin of modern humans

• ~ 50,000 years ago

• Humans originated suddenly and dramatically

46

Origin of Man “Out-of-Africa” Hypothesis

H. ergaster

AfricanHumans

EuropeanHumans Asian

Humans

Neandertals

H. antecessor ?

?

?

47

Who were the Neandertals?

48

•Lived ~150,000 to ~30,000 Lived ~150,000 to ~30,000 years agoyears ago

•Inhabited Europe and western Inhabited Europe and western AsiaAsia

•Lived ~150,000 to ~30,000 Lived ~150,000 to ~30,000 years agoyears ago

•Inhabited Europe and western Inhabited Europe and western AsiaAsia

Who Were the Neandertals?

49

Who Were the Neandertals?

• Bipedal

Physical similarities with modern humans

Bipedal (bipedalism)Ability to walk upright on two legs.Bipedal (bipedalism)Ability to walk upright on two legs.

• Large brain capacity

50

Physical Differences Between Neandertals and Humans

Largefrontteeth

Brow ridge

Receding forehead

Modern HumanModern HumanNeandertalNeandertal

Brain shape

Occipital bun

Retromolar gap

Large eyesockets

Chinreceding

Modern HumanModern HumanNeandertalNeandertal

51


• Elongated foramen magnum

Pterygoid tubercleA small rounded nodule on the Pterygoid bone in the roof of the mouth connecting the palatine in front and the quadrate behind.

Pterygoid tubercleA small rounded nodule on the Pterygoid bone in the roof of the mouth connecting the palatine in front and the quadrate behind.

Foramen magnumThe area where the spine joins the skull

Foramen magnumThe area where the spine joins the skull

• Medial pterygoid tubercle• Flatter skull base

52


• Large nose

• Large sinuses

• Structure of the inner ear

Chimp

Neander.

Human• Higher larynx

53


• Thicker bones

• Barrel chests

• Shorter limbs

• Asymmetrical humerus

MetacarpalsThe bones that connect the wrist bones (carpals) with the finger bones (phalanges).

MetacarpalsThe bones that connect the wrist bones (carpals) with the finger bones (phalanges).

• Thicker metacarpals

54

Neandertal Development

• Craniodental development of Neandertals and humans differs from before birth

CraniodentalA fancy word referring to the skull and teeth

CraniodentalA fancy word referring to the skull and teeth

• Differences occur from the time Neandertals first appear

55

Molecular Paleontology: Neandertal mtDNA

40,000 YA40,000 YANeander, GermanyNeander, Germany

40,000 YA40,000 YAVindija Cave,CroatiaVindija Cave,Croatia 29,000 YA29,000 YA

NorthernCaucasus NorthernCaucasus

56

DNA 101• DNA language:

• 4 “letters” in the alphabetA – Adenine T – ThymineC – Cytosine G – Guanine

• 20 3-letter “words” (codons)Each codon codes for one amino acid

• Unlimited number of “sentences” (proteins)

• Unlimited number of “novels” (organism)

57

Neandertal mtDNA

mtDNA Sample(HVR-1)

Sequence Number (Read Down)11111111111111111111111111111111

166666666666666666666666666666666

600001111111111111222222222223333

437890011234556888023345566791257

178637812998469239930446823891042

0

Mod. HumanAATTCCCCGACTGCAATTCACGCAC-CATCCTC

Chimpanzee ......T.ATT.....ACTGAAA....G....

Neander.#1GG.CTTTTATTC.T.CCCTGTAAGTATGCT.CT

Neander.#2 .C.....ATT.ATCCCCTGTAA.TATGCTTC

Neander.#3 GG......ATTC.TCCCCTGTAAGTATGCT.C

Neander.#4 GG......ATTC.TCCCCTGTAA.TATGCT.C

58

Neandertals – Limited Genetic Diversity

Population

#

Individuals

mtDNA differences

Mean Min. Max.

Neandertals 3 3.73 - -

Humans 5,530 3.43 0.00 10.16

Chimpanzees 359 14.81 0.00 29.06

Gorillas 28 18.57 0.40 28.79

59

Ancient Modern Human mtDNAmtDNA Sample(HVR-1)

Age(ka)

Sequence Number (Read Down)001111111111111112222222222222222222222222222333333333333337900112234566888900122334444455556667788889990111234555668883781269984393499198340413479368923448467803911780715672817

Modern Human

0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA

Aboriginal 0 ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...

Chimp 0 ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..

Neander #1

30+ GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...

Ancient Aussie

62 ....................T.G...........CT.T....T..T......TC....G

60

Neandertal mtDNA Summary

• Neandertals have no genetic (nor evolutionary) connection to humans

• Neandertals displayed limited genetic diversity

61

Origin of Man Classic Hypothesis

Neandertals

H. antecessor

H. ergaster

EuropeanHumans

AfricanHumans Asian

Humans

62

Origin of Man Multi-regional Hypothesis

H. ergaster

AsianHumans

?

AfricanHumans

?H. erectus

H. antecessor

Neandertals

?

EuropeanHumans

?

63

Multiregional Hypothesis Requires

• Large breeding populations over the entire planet

• Frequent interbreeding of those populations

• Genetic roots traceable to millions of years bp

64

Genetic Data Contradicts Multiregional Hypothesis

Study 1• African and Asian and oceanic

peoples originated from same population group 35-89 kya

Study 2• 90% of founding population must

come from Africa and this population must be small

65

Genetic Data Contradicts Multiregional Hypothesis

Study 3 (small population size)• Nuclear DNA sequences• Alu insertions• HLA exons• mtDNA mismatch distributions• frequency spectra (mtDNA, Y-chr)• allele size vs. homozygosity at tandem

repeat loci

66

Homo erectus Development

• Homo erectus developed in a fashion similar to great apes – not modern humans

• Homo erectus developed from infanthood to adulthood rapidly

67

Descent of Modern Humans

“Most of the familiar specimens of Homo erectus and of archaic

humans known from the Pleistocene were not members of populations ancestral to us”

Harpending, H.C., et al. 1998. Genetic traces of ancient demography. Proc. Natl. Acad. Sci. USA 95: 1961-1967.

68

Origin of Man Multi-regional Hypothesis

H. ergaster

AsianHumans

?

AfricanHumans

?H. erectus

H. antecessor?

? Neandertals

EuropeanHumans

69

Scientific Data

• Anatomical – overall structure and body plan

• Physiological – how the body systems work and interact

• Biochemical – basic chemical pathways

Similarities with other animals

70

Scientific Data

Human – Chimpanzee genetics• ~95-99% Genetic

Similarity• Base substitutions –

1.4%• Insertions/Deletions –

3.4%• Common Descent (?)

71

Humans and Chimpanzees• Chromosome number

• Human (46)• Chimp (48)

• Chromosome sizes• Chromosomal

banding• #2 equivalent to two

smaller chimp chromosomes

• #4 and #17 different

72

Chromosome 21Human-Chimp Comparison

• Chromosome 21 fully sequenced and annotated

• Two clusters with significant differences

PCR ResultChimp-

Chimp and other primates-

HS21 Clone Gaps

73

How Different From Chimpanzees?

• Human problem – anthropomorphizing

• The counting dog

• What do chimpanzees really understand?

74

Human Distinctives

• Large brain size

• Bipedalism

• Advanced culture

• Decreased size of back teeth

75

Emergence of Bipedalism

Driven by habitat change from wood-land to open savanna?

76

Bipedalism TheoriesTheory ProblemsEcology (Woodland to Savanna) Occurred later1

Hunting and tools Occurred later1

Thermoregulation2 Occurred later1

Enhanced vision Wrong environment

Male provider3hominids were reproductively disadvantaged4

Scarce dietary resources

Not fully supported by the data

77

Advantages of Bipedalism

• Travel for food

• Transport food

• Feed in stationary position

• Avoid predatory attacks• Thermoregulatory advantages• Tool use

78

Anatomy of Bipedalism• Shorter/broader

pelvis

Human Great Ape

Valgus angleThe angle the femur (leg bone) makes relative to the knee. About 90 degrees in apes, less in bipeds

Valgus angleThe angle the femur (leg bone) makes relative to the knee. About 90 degrees in apes, less in bipeds

• Valgus angle• Knee

• Lengthened lower limbs

• Enlarged joint surfaces

79

Anatomy of Bipedalism• Restructuring of

ear bones • Platform foot

Human Great Ape

• Foot arches• Relocation of

hallux (big toe)

80

Anatomy of Bipedalism• Relocation of

foramen magnum

Human Great Ape

• Lower/upper spine curvature

• Restructuring of rib cage

• Rearrangement of musculature

81

Ecology of Bipedalism

Early australopithecines lived in mixed woodland and savanna

• A. ramidus (5.8 and 4.5 mya)

• A. anamensis (4.2 mya)

• A. afarensis (3.9 mya)

• A. bahrelghazari (3.5 mya)

82

Natural History of Bipedalism

Facultative bipeds• A. ramidus (5.8 mya)• A. anamensis (4.2 mya)• A. habilis (2.5 mya)

83


Obligatory bipeds (type I)• H. erectus

(2 million years ago)• H. neandertalensis

(150,000 years ago)

84


Obligatory bipeds (type II)• Homo sapiens sapiens

(modern humans) (50,000 years ago)

85

Bipedalism in Hominins

Time (MYA)

Small brain, small teeth, quadruped

Chimpanzee (Pan)

Large brain, small teeth, obligate bipedMan (Homo sapiens)H. neandertalensis

H. heidelbergensis

H. erectusH. ergaster

Small brain, very large teeth, facultative biped

P. boisei

P. robusts

0 1 2 3 4 5 6 7 8

Insufficient evidenceH. antecessor

H. rudolfemsis

A. garbi

K. platyops

P. aethiopicusO. tugenesis

S. tchadensis

A. bahreighazali

A. ramidus

Small brain, large teeth, facultative biped

A. habilis

A. afarensisA. africanus

A. anamensis

HomininsSuperfamily including the hominids (Genus Homo and Australopithecus) along with the bipedal apes and chimpanzees.

HomininsSuperfamily including the hominids (Genus Homo and Australopithecus) along with the bipedal apes and chimpanzees.

86

Emergence of Bipedalism• Minimal driving force/selective

pressure• Appears suddenly in the fossil

record• Requires major anatomical

rearrangement• Rapid change followed by period of

no change

87

Origin of Man Creation Model

All Humans

ADAM & EVE

All other bipedal primate species are a special creation of God

88

Origin of the Human Races

Biblical and Scientific Explanations

89

Origin of the Races

God’s original command:

And God blessed them; and God said to them, "Be fruitful and multiply, and fill the earth..." (Genesis 1:28)

90

Origin of the Races

God reissued his command:

"and as for you, be fruitful and multiply; Populate the earth abundantly and multiply in it." (Genesis 9:7)

91

World Peace and Unity?

Human pride and greed result in oppression of people

• Media-Persia

• Greece

• Rome

92

God’s Peace and Unity• “Do you suppose that I came to

grant peace on earth? I tell you, no, but rather division;” (Luke 12:51)

• “Peace I leave with you; My peace I give you. I do not give to you as the world gives.” (John 14:27)

93

Early Post-Flood Civilization

• Rapid repopulation of Mesopotamia

• Nimrod built 8 large cities, including Nineveh

Biblical data

94

Scattering of the World’s People

• At the city of Babel, the people began building a huge tower

• God confused their language and scattered them over the face of the earth

Biblical data

95

Scattering of the World’s People

• Geographic barriers • Bering Strait – Americas and

Asia• Strait of Malaca – Indonesia and

Asia• Torres Strait – Australia and

Asia• Land bridges established by the

ice age

96

Dividing the Earth

• Biblical data

• Two sons were born to Eber: One was named Peleg, because in his time the earth was divided… (Genesis 10:25)

• Scientific Data

• Land bridges covered by rising oceans ~11,000 ya

97

Origin of the Races

What the Bible says

• Moses married a Cushite woman) (Numbers 12:1)

• Solomon married a black woman (Song of Songs 1:5)

• Ethiopians described as dark-skinned (Jeremiah 13:23)

98

Origin of the RacesWhat the Bible doesn’t say

• When and how did the races begin?

• No biblical data – Not important enough to mention?

• Mark of Cain?

• Ham’s penalty?

• Part of the scattering at the Tower of Babel?

99

Origin of the RacesRace facts:• Single biological species - Homo

sapiens sapiens. • Race described on the basis of

skin color, hair form, facial morphology, body proportions, and other, less obvious traits – not based upon genetics

100

Origin of the RacesScientific classification

• African (groups indigenous to Africa)

• Caucasian (European populations)

• Greater Asian (Mongols, Polynesians, Micronesians)

• Amerindian (North & South American Indians, Eskimos)

• Australoid (Australia, Papua)

101

Biological Basis for Race• No specific “race genes”• Skin color – melanin (phenomelanin

and eumelanin)• Melanin expression – controlled by

the enzyme tyrosinase• All people have enough tyrosinase to

be very black in skin color• Regulation of the tyrosinase

determines skin color

102

Origin of the Races

Protein polymorphisms

• 84% of all variation is found within each racial group

• 10% of variation is found among racial groups

• More genetic variation within races than between them

103

Skin Color Distribution Vs. Blood Type

Type A Type B

Relative Skin Color

equator

104

“Racial” Diversity Among Chimpanzees Compared to Humans

Measure Chimps Humans

X-chromosome 0.13% 0.037%

mtDNA (MPSD) 14.8 3.4

Fst values >2.0 0.08

Substitution rate >0.05 0.029

Heterozygosity 3.9% 1.8%

105

Scientific Theories on the Origin of Human Races

• Dark skin protects against ultraviolet radiation and cancer

• Light skin allows enhanced formation of vitamin D3

• Exception – Inuit (Eskimos)

• Selective breeding

106

Origin of Races – Conclusions• The origin of the races was not

thought to be important enough to put in the Bible

• Biological changes required to produce human races are well within those possible through microevolutionary processes

107

Modern Humans – Comparison of Models

Appearance Creation Darwinism

Fossils Suddenly Gradual

Culture Rapid Gradual

Location Single site Many sites?

Descent NoneUnknown ancestor

108

Summary• Modern humans originated recently

from a small population at a single geographic location

• Modern culture and religious expression appeared suddenly and dramatically

• Modern humans are not descended from Neandertal, H. erectus or any other identifiable bipedal hominid

109

Conclusions• Naturalistic explanations fail to explain

the origin of modern man• Supernatural creation is a superior

model for understanding man’s origin• The races of man likely originated

from selective breeding and not a supernatural act, although they may have been the indirect result of the scattering at the tower of Babel

Documents

1 Origin of Man and the Races Richard Deem, M.S. Reasons To Believe