1 Molecular investigation and phylogeny of Anaplasma spp. in

1

Molecular investigation and phylogeny of Anaplasma spp. in Mediterranean ruminants reveal the 1

presence of neutrophil-tropic strains closely related to A. platys 2

3

4

Rosanna Zobba, Antonio G. Anfossi, Maria Luisa Pinna Parpaglia, Gian Mario Dore, Bernardo 5

Chessa, Antonio Spezzigu, Stefano Rocca, Stefano Visco, Marco Pittau, Alberto Alberti # 6

7

8

Dipartimento di Medicina Veterinaria, Università degli Studi di Sassari, Italy 9

10

Running head: Anaplasma spp. in domestic ruminants 11

12

#Address correspondence to Alberto Alberti, [email protected]. 13

14

AEM Accepts, published online ahead of print on 25 October 2013Appl. Environ. Microbiol. doi:10.1128/AEM.03129-13Copyright © 2013, American Society for Microbiology. All Rights Reserved.

on April 5, 2018 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

Abstract 1

Few data are available on the prevalence and molecular typing of species belonging to the 2

genus Anaplasma in Mediterranean ruminants. In this study PCR and sequencing of both the 16S 3

rRNA and groEL genes were combined to investigate the presence, the prevalence, and the 4

molecular traits of Anaplasma spp. in ruminants sampled on the Island of Sardinia, chosen as a 5

subtropical representative area. Results demonstrate a high prevalence of Anaplasma spp. in 6

ruminants, with animals infected by at least 4 out of 6 Anaplasma species (A. marginale, A. bovis, 7

A.ovis, A. phagocytophilum). Moreover, ruminants host a number of neutrophil-tropic strains 8

genetically closely related to the canine pathogen A. platys. The high Anaplasma spp. prevalence 9

and the identification of so far not classified neutrophil-tropic strains bring about concerns about the 10

specificity of serological tests routinely used in ruminants, and provide additional background for 11

reconstructing the evolutionary history of species genetically related to A. phagocytophilum. 12

13


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

Introduction 1

Tick-borne rickettsial diseases bring about considerable economic constraints to livestock 2

management throughout the world (1, 2). Furthermore, over the last decades, bacteria within the 3

order Rickettsiales have emerged as zoonotic agents, particularly in Europe but also in Africa and in 4

the Americas (3, 4). Consequently, surveillance on rickettsial species circulating among animals 5

and human has increased appreciably, this resulting in the proliferation of studies aimed to detect 6

and molecularly characterize strains in different regions of the world (5). 7

Among Rickettsiales, the genus Anaplasma has been especially studied for its pathogenicity 8

in farm animals, and also to a lesser extent, in people. Anaplasmosis, caused by various species of 9

Anaplasma, is an important issue for animal breeders. Indeed infection by Anaplasma spp. 10

generates additional costs to veterinary care by causing reduction of animal’s body weight, a 11

decrease of milk production, abortion, and frequently death (6, 7, 8, 9). 12

The 6 species included in the genus Anaplasma show different preferential host and cell 13

tropism (10, 11,12). Three species infect red blood cells of small ruminants (A. ovis), of cattle (A. 14

marginale, A. centrale) and of wild ruminants (A. marginale, A. centrale). A. bovis causes 15

anaplasmosis in ruminants and small mammals, and infects monocytes. A. phagocytophilum is the 16

agent of human and animal granulocytic anaplasmosis and preferentially infects neutrophil 17

granulocytes of ruminants, dogs, horse, and human. Finally, A. platys shows unique tropism for 18

platelets of dogs, being the etiological agent of the infectious canine cyclic thrombocytopenia. 19

According to what stated above, ruminants can be infected by 5 out of 6 species belonging to the 20

genus Anaplasma. Infections are commonly recorded in wild and domestic ruminants, worldwide 21

(11, 13). 22

In Europe, wild and domestic ruminants play an active role as Anaplasma spp. carriers 23

acting as infection reservoirs potentially able to indirectly transmit strains to other host species in 24

which the same strains are pathogenic. For instance, Anaplasma phagocytophilum infections are 25

commonly reported in asymptomatic wild ruminants in several Mediterranean Countries, whether in 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

the same area infected dogs and human develop serious symptoms (14, 15, 16). Other Anaplasma 1

species are scarcely reported in Mediterranean Countries, and the molecular characterization of 2

most of strains circulating in this area has yet to be uncovered. 3

Our group previously reported A. phagocytophilum infections in Sardinian symptomatic 4

horses and dogs. Additionally, we detected A. platys in a symptomatic dog living in the same area 5

(14, 15, 17). To date, there is a lack of data about the presence of A. phagocytophilum and of other 6

Anaplasma species in Sardinian ruminants, and in general in the Mediterranean Countries. 7

Here we show that Sardinian domestic ruminants are commonly infected by distinct 8

Anaplasma species, and we report the presence of novel Anaplasma spp. strains genetically closely 9

related to the canine species A. platys. Preferential cellular tropism and phylogeny of these latter 10

strains are also investigated by confocal laser scanning microscopy and network analyses, 11

respectively. 12

13


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

Materials and methods 1

2

Samples and DNA extraction 3

During 2010-2012, EDTA blood samples were obtained from 99 asymptomatic domestic ruminants 4

(43 calves, 22 sheep and 34 goats) farmed in different areas of the Island of Sardinia, Italy (Table 1, 5

Figure S1). Additionally, a blood sample was collected from a Sardinian red deer (Cervus elaphus 6

corsicanum) kept in captivity in a wildlife recovery facility (Monastir, Sardegna). DNA was 7

extracted from all the samples by using the DNeasy Blood and Tissue kit (Qiagen, Italy), following 8

vendor’s recommendations for blood extraction. Anaplasma phagocytophilum genomic DNA was 9

extracted from FA substrate slides (Fuller laboratories Fullerton, California), and used as a positive 10

control in Anaplasma spp. – specific PCRs. A DNA preparation of an A. platys strain isolated in 11

Southern Italy (17) was also used as a positive control (in A. platys-specific PCRs). Sampling was 12

approved by the Ethical Committee of the University of Sassari. 13

14

Anaplasma PCR strategies and profiles 15

In order to investigate the presence of Anaplasma spp. in Sardinian domestic ruminants, 53 16

out of the 99 blood DNA extractions were initially tested with two primers (AnaplsppF, 5’-17

AGAAGAAGTCCCGGCAAACT-3’; AnaplR3, 5’-GAGACGACTTTTACGGATTAGCTC-3’) 18

targeting about 800 base pairs of the 16S rRNA gene of species belonging to the genus Anaplasma. 19

Briefly, 100-150 ng of DNA extractions were used in a 50 µl PCR reaction containing 200 µM 20

dNTPs, 0.3 µM of each of the 2 primers, and 1.25 U of Taq DNA polymerase (Qiagen, Italy). PCR 21

amplifications were performed with an initial denaturation at 94 °C for 3 min; 30 cycles of 22

denaturation at 94 °C (30 sec), annealing at 50 °C (30 sec) and extension at 72 °C (1 min); final 23

extension at 72 °C for 10 min. Based on the 16S rRNA gene PCR results, in order to mine deeper 24

into the presence of selected Anaplasma species in ruminants, we tested the 99 DNA extractions 25

with a set of 4 primers combined in 2 hemi-nested PCRs designed for the molecular identification 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

and characterization of the A. phagocytophilum and A. platys groEL genes (14, 15,17). In order to 1

target the corresponding groEL region of A. centrale, A. marginale, and A. ovis, 3 new primers 2

(AmaceovgroELF: 5’-acggtatgcagtttgaccgc-3’; AmaceovgroELR1: 5’-tcaaccctatccttacgctc-3; 3

AmaceovgroELR2: 5’-gtcgtagtcagaagaagaaac-3’) were designed and combined in a heminested 4

PCR to detect about 518 bp of this gene. In the first PCR round 100-150 ng of DNA extractions 5

were used in a 50 µl PCR reaction containing 200 µM dNTPs, 0.3 µM of each of the 6

AmaceovgroELF and AmaceovgroELR1 primers, and 1.25 U of Taq DNA polymerase (Qiagen, 7

Italy). One µl of the first PCR product was subjected to a second PCR round with primers 8

AmaceovgroELF and AmaceovgroELR2. Both amplifications were performed with an initial 9

denaturation at 94 °C for 3 min; 30 cycles of denaturation (30 sec) at 94 °C, annealing (30 sec) 10

alternatively at 55 °C (first PCR round) or 60 °C (second PCR round) and extension (1 min) at 72 11

°C; final extension at 72 °C for 10 min. Since the groEL gene sequence of A. bovis is still not 12

available in the Genbank database, a groEL specific PCR could not be designed for this bacterium 13

and A.bovis was excluded from this analysis. 14

15

Cloning, sequencing and Phylogenetic analyses 16

An ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Life 17

Technologies, Italy) was used for direct cycle sequencing of 14 PCR products obtained with the 18

16S rRNA gene primers, and representative of host species and geographic location, according to 19

the manufacturer’s protocol. Ambiguous nucleotide positions were resolved by cloning amplicons 20

into the vector pCR2.1-TOPO, and by universal M13 primers sequencing. Similarly, 37 PCR 21

products obtained with the groEL specific primers were sequenced either directly or after cloning 22

into pCR2.1-TOPO. The generated sequences were edited with Chromas 2.2 (Technelysium, 23

Helensvale, Australia) and aligned with ClustalW (18) in order to assign them to unique sequence 24

types. Sequence types, named after the host species and sequentially ordered, were checked against 25

the GenBank database with nucleotide blast BLASTN (19). The 16S rRNA gene sequence types 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

obtained in this study were aligned among them and with a set of 14 sequences representative of the 1

16S rRNA gene variability of the 6 different species belonging to the genus Anaplasma. In 2

particular the set was composed by: 3 A. marginale sequences (CP001079, JQ839012, AF414873); 3

2 A. centrale sequences (EF520690, JQ839010); 3 A. ovis sequences (JQ917905, JQ917880, 4

JQ917902); 3 A. bovis sequences (JN558825, JN558819, AB196475); 1 A. platys sequence 5

(EU439943); and 2 A. phagocytophilum sequences (AB196721, JX173652). Also, the groEL 6

sequence types generated in this study were aligned among them and with a set of 16 sequences 7

representative of the groEL variability of the 6 different species belonging to the genus Anaplasma. 8

groEL reference sequences were as follow: A. marginale (JQ839015, CP001079, JQ839003); A. 9

centrale (AF414866, EF520695, CP001059); A. ovis (FJ460441, AF441131); A. platys (EF201806, 10

FJ460441); A. phagocytophilum (HM057225, CP000235, AY848749, AY848752); A. bovis 11

(JX092099, JX092095). Rickettsia rickettsii (CP003318) and Ehrlichia canis (EU439944) were 12

included as outgroups in both of the 16S rRNA and groEL sequences alignments. 13

Pairwise/multiple sequence alignments and sequences similarities were calculated using the 14

ClustalW and the identity matrix options of Bioedit (20), respectively. Genetic distances among the 15

operational taxonomic units (OTUs) were computed by Maximum Composite Likelihood Method 16

(21) or by the Kimura 2-parameters method using MEGA version 2.1 (22), and were used to 17

construct neighbor-joining (NJ) trees (23). Statistical support for internal branches of the trees was 18

evaluated by bootstrapping with 1000 iteractions (24). Maximum parsimony (MP) trees and 19

consensus values were generated using the same software. MEGA was also used to investigate the 20

variability of the nucleotide positions in the groEL and 16S rRNA sequences alignments. In order to 21

reduce systematic error, to investigate more deeply into taxa evolutionary relationship, and to tests 22

robustness of the phylogenetic analyses, groEL sequence clusters were also detected by the analysis 23

of phylogenetic networks inferred from uncorrected p-distances with the Neighbor-Net method in 24

SplitsTree4 (25), not considering invariable sites. 25

26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

Blood fractionation and thin layer slides preparation 1

One set of EDTA blood samples (5 ml) was collected from 2 goats (M2, 324) that tested 2

positive by three independent A. platys groEL heminested PCRs and negative by the analogue PCR 3

specifically designed for detecting the A. marginale - A. centrale - A. ovis groEL gene. Three ml of 4

samples were layered onto 3 ml HISTOPAQUE® - 1077 (SIGMA ALDRICH, Italy), and 5

centrifuged at 400xg for 30 minutes at room temperature in order to isolate buffy coat, according to 6

vendor instructions. Both buffy coat and erythrocytes were opportunely diluted in PBS and 7

centrifuged for 6 min at 127xg with a Thermo Shandon Cytospin 4 Cytocentrifuge (Thermo 8

Scientific, Italy) to obtain thin layer cell slide preparations. In order to obtain slide preparations of 9

platelets, Sodium Citrate bloods samples (5 ml) were also collected from the same goats, and 10

centrifuged (827xg for 30 minutes) at room temperature. Platelet enriched plasma fractions were 11

collected and centrifuged at 1146xg for 10 minutes. Pellets were resuspended in 500 µl of plasma 12

and cytocentrifuged as described ahead. Blood smears were also prepared from the same goats by 13

standard procedures. Platelets, red blood cells, buffy coats, and blood smears were always layered 14

on Superfrost positively charged glass slides (Fisher Scientific, Italy). 15

16

PCR synthesis of digoxigenin-, fluorescein-, and rodhamine- labeled DNA probes. 17

The PCR DIG Probe Synthesis Kit (Roche, Italy) was used to generate a 107 bp 18

digoxigenin-labeled DNA probe specific for A. platys by polymerase chain reaction. Fifty 19

microliters PCR reactions were set up by mixing 5 μl of PCR DIG Probe Synthesis Mix (containing 20

200 μM of each dNTP and 70 μM DIGdUTP) with 5 μl of 10× PCR buffer containing MgCl2, 0.75 21

μl of enzyme mix, 29.25 μl water, 100 pg of an amplicon obtained by A. platys groEL heminested 22

PCR from a bovine (N194), and 5μl of each of the primers aplgroELdigprobF (5’ 23

TAGAAGGGGAAGCTTTAAGCA 3’), and aplgroELdigprobR (5’ 24

ACTGCGATATCACCAAGCATA 3’). An unlabeled probe was generated by using the same 25

protocol, without incorporation of digoxigenin in the PCR mix. PCR profiles were designed 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

following the manufacturer's instructions for probe synthesis. Both digoxigenin labeled and 1

unlabeled probes were used (independently) for in situ hybridization (ISH) experiments. Similarly, 2

fluorescein- and rodhamine- labeled versions of the 107 bp A. platys groEL specific probe were also 3

originated by using a PCR fluorescein labeling mix (Roche) and a Tetramethyl-Rhodamine-5-dUTP 4

(Roche), respectively. PCR protocols were adjusted to vendor recommendation. A rodhamine- 5

labelled 98 bp DNA probe was designed targeting the groEL gene of A. marginale, A. centrale, and 6

A. ovis. This probe was synthesized starting from an amplicon obtained by A. marginale-, A. 7

centrale-, A, ovis- specific groEL heminested PCR and by using primers Amacenov_probe_F (5’ 8

GGTCAGGAAGGCCATTGCTG 3’) and Amacenov_probe_R (5’ 9

TGCAACCTGCAAGCCTCCGC 3’). PCR was performed by following the same protocols used 10

for generating probes specific for the groEL region of A. platys. 11

12

Combined In Situ Hybridization (ISH) and Immunofluorescence 13

Buffy coat, red blood cells, plateles, and blood smears layered on positively charged glass 14

slides were fixed in 4% paraformaldehyde (PFA) for 10 minutes, digested with 10 µg/ml proteinase 15

K for 10 min, dehydrated by passing through 25%, 50%, 75%, 100% methanol in PBS (1-2 min in 16

each solution), and air dried. Slide were stored at -20 °C for later use. 17

Prior to hybridization, slide were rehydrated in 2 x SSC for 15 min and then prehybridized 18

in prehybridization solution at 42 °C for 1 hour (50% molecular grade Fluka hybridization solution 19

II, 43% formamide, 7% mQ water) in a programmable temperature-controlled slide processing 20

system (StatSpin® ThermoBrite, Italy). 21

After removing the pre-hybridization solution, slides were covered with a cover glass, 22

treated with 200 μl of hybridization solution (obtained by adding 1.5 µg of a denatured molecular 23

probe to 1 ml hybridization solution), placed at 95 °C for 8 min, and incubated overnight. 24

Hybridization solution varied depending on the type of sample analyzed (Buffy coat, red 25

blood cells, platelets, or blood smear). 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

Slides obtained from blood smears were treated with hybridization solution containing the 1

A. platys digoxigenated groEL specific probe, or alternatively an unlabeled version of the same 2

probe. After hybridization, unhybridized probes were removed by washing slides twice with TBS (5 3

minutes per wash). Slides were treated with decreasing concentrations of Sigma-Aldrich (Italy) 4

molecular biology grade SSPE (5 minutes washes at 25 °C with 2×, 1×, 0.5× SSPE, 30 min wash at 5

50 °C with SSPE 0.1× and BSA 0.2%, 5 min wash at 25 °C with SSPE 0.1× and BSA 0.2%). 6

Preparations were then washed for five minutes with buffer I (0.1 M Tris, 0.15 M NaCl; pH 7.6). 7

Non-specific endogenous alkaline phosphatase was blocked with 200 μl of blocking solution (20 μl 8

normal rabbit serum, 3.1 μl of 0.3% Triton X100; 980 μl buffer I) at room temperature for 45 min. 9

For detection of the digoxigenin-labeled hybrids, slides were incubated for 2 h with 1:25 diluted 10

anti-digoxigenin-AP Fab fragments (Sigma-Aldrich, Italy) at room temperature. Slides were rinsed 11

twice and incubated for 50 min at 37 °C in the dark with 5-bromo-4-chloro-3-indolyl phosphate 12

(BCIP) and 4-nitro blue tetrazolium chloride (NBT). Colour development was stopped with TE 13

buffer (pH 8.0). Slides were mounted with Top-Water mount (W. Pabisch SpA, Italy), and 14

photographed with a Nikon Eclipse 80i microscope equipped with a Nikon DS-L2 camera control 15

unit. 16

Buffy coats and platelets slides were mounted and probed either with rhodamine- or 17

fluorescein- labelled DNA probes synthesized by A. platys groEL heminested PCR. Similarly, the 18

same samples were hybridized with probes synthesized by A. marginale - A. centrale - A. ovis 19

groEL heminested PCR. 20

Buffy coats and platelets slides were incubated in a programmable temperature-controlled slide 21

processing system (StatSpin® ThermoBrite) at 42 °C for 12-14 hours (overnight), in hybridization 22

solution containing 5 ng of the opportune DNA probe (in 70 µl of prehybridization solution). 23

The following day, coverslips were removed and slides were washed in decreasing concentration of 24

SSC at 48°C, with a final rinse in PBS. 25


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

In order to label neutrophils, buffy coat slides were incubated overnight at 4 °C with 1:100 1

biotinylated monoclonal Rat anti-Mouse neutrophil antibodies (Caltag Laboratories). Before 2

incubation with the primary antibody, non - specific binding was blocked with 2% BSA in PBS. 3

Buffy coat slides were then incubated for 1 hr at r.t. with Histostain-Plus (Life Technologies, Italy) 4

and subsequently treated with Alexa Fluor® 555 streptavidin (Invitrogen) for 1 h. Slides were 5

counterstained with Hoechst blue, and then cover-slipped in ProLong® Gold antifade reagent 6

(Invitrogen). 7

Platelets and erythrocytes slides were incubated overnight at 4 °C with 1:100 Mouse 8

monoclonal anti-Platelets antibody labeled with fluorescein isothiocyanate (antibodies-online Inc.) 9

and 1:100 rabbit fluorescein isothiocyanate conjugate anti- goat RBC antibody (Fitzgerald, USA), 10

respectively. Slides were then washed once with PBS, once with water, counterstained with 11

Hoechst blue, and eventually cover-slipped in ProLong® Gold antifade reagent (Invitrogen). 12

13

Confocal laser scanning microscopy 14

Buffy coats, red blood cells, and platelet slides were analyzed by confocal laser scanning 15

microscopy using a Leica® DMI4000 B automated inverted research microscope. Images were 16

acquired using the LEICA LAS AF lite software in combination with a 40X oil immersion objective 17

and a numerical aperture of 1.25. Excitation wavelengths used were 488 nm (green) and 568 nm 18

(red). All images were edited using Adobe Photoshop CS4. Manipulations did not change the data 19

content. In each experiment unlabeled probes were used as a negative control. Also, experiments 20

were repeated by omitting the first antibody or the DNA probe. All experiments were run at least in 21

triplicate. 22

23

Nucleotide sequence accession numbers 24

The 16S rRNA and groEL nucleotide sequences determined in this study have been submitted to 25

GenBank under the accession numbers noted in Tables 2 and 3. 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

1

2


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

Results 1

Anaplasma spp. 16S rRNA PCR and phylogenetic analysis. 2

Forty-eight out of 55 tested ruminants (87.3%) were positive by Anaplasma spp. 16S rRNA 3

PCR. In particular, 17 out of 19 sheep (89.5%), 15 out of 20 bovines (75%), 16 out of 16 goats 4

(100%), homogeneously distributed in the study area, showed the expected 800 bp band on agarose 5

electrophoresis (Table 1, Figure S1). Controls (mQ water samples) were always negative. Upon 6

sequencing and ClustalW alignment, 14 PCR products chosen as representative of different hosts 7

and geographic locations resulted in 8 different 16S rRNA sequences types (Table 2). The 8 8

sequence types were named after the host species in which they were isolated, and were identified 9

by a progressive number. Sequence types BovineCaprine2 and Bovine1, identified in 3 calves and 1 10

goat shared 100% homology with A. marginale strains isolated worldwide. Two sequence types 11

(Ovine3 and OvineCaprine1), derived from 2 sheep and 1 goat were 99 to 100% similar to A. ovis 12

sequences isolated in Africa, Asia, Europe, and USA. One sequence type (Ovine2) containing 13

sequences exclusively derived from sheep shared 99 to 100% homology with Asiatic and USA A. 14

bovis sequences. Sequence type Ovine1, derived from a sheep, was 99% similar to A. 15

phagocytophilum sequences isolated worldwide. Notably, two sequence types (BovineCaprine1, 16

Bovine2) shared 99% identity with the invariable 16S rRNA gene sequence of A. platys. Table S1 17

reports the variability among the ClustalW alignment of the 8 identified sequence types with the 18

most similar sequences representative of the six species belonging to the genus Anaplasma. Forty-19

eight phylogenetic informative sites out of 55 variable sites are present, with 47 substitutions and a 20

single deletion of one nucleotide. Transitions (40/48) are greatly prevalent over transversions 21

(5/48). Three positions are hyper-variable, with three or four nucleotides alternatively present. 22

These observations are congruent with the evolutionary model of the bacterial 16S rRNA locus, and 23

indicate that this genetic variability is suitable for phylogenetic analyses. Coinciding character- and 24

distance-based trees (Figure 1) obtained from the same alignment indicates that the 16S rRNA 25

sequence types generated in our study group into two major clades strongly supported by bootstrap 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

statistics. A first clade defined by the reference sequences of A. marginale, A. centrale, and A. ovis 1

contains 4 sequence types derived from ovine, caprine and bovine hosts. In particular, the sequence 2

types Bovine1 and BovineCaprine2 group in separated sub-clades with A. marginale, which appears 3

polyphyletic in the trees. Sequence types Ovine3 and OvineCaprine1 also group in two sub-clades 4

with A. ovis, which similarly appears as polyphyletic. The second major clade is composed by two 5

sub-clades. One sub-clade contains the 16S sequences of A. bovis, and both in accordance with blast 6

analyses and with the alignment shown in Table S1, the sequence type Ovine2. The second sub- 7

clade contains the sequence types Bovine2, BovineCaprine1, and the 16S sequences of A. platys. 8

The sequences of A. phagocytophilum group in the 2 different sub-clades and with the sequence 9

type Ovine1. 10

11

groEL PCR and phylogenetic analysis. 12

In order to further investigate the genetic variability of the Anaplasma spp. in Sardinian 13

domestic ruminants, 99 animals (Table 1) were tested by 3 heminested PCRs specifically designed 14

to amplify the same groEL gene of A. phagocytophilum, A. platys, and of A. marginale- centrale- 15

ovis, respectively (see materials and methods). 16

Only 9 out of 99 (9.1%) animals were Anaplasma-free as they were simultaneously negative 17

to the 3 groEL PCRs. Ninety ruminants (90.9%) were positive to at least one test, and this is 18

consistent with observations based on 16S. More specifically (Table 1), one out of 22 sheep (4.5%), 19

27 out of 43 calves (62.8%), and 27 out of 34 goats (79.4%) were positive when tested with the 20

PCR test specific for the groEL gene of A. platys. When the same 99 samples were tested by PCR 21

for the presence of A. marginale- centrale- ovis, 18 out of 22 sheep (81.8%), 39 out of 43 calves 22

(90.7%), and 29 out of 34 goats (85.3%) generated the expected band as revealed by agarose 23

electrophoresis and gel imaging. Coinfections with at least 2 different Anaplasma species were 24

observed in 51 (56.7%) out of 90 infected domestic ruminants, as they tested simultaneously 25

positive to the 2 PCRs designed to amplify the groEL gene of A. platys and A. marginale- centrale- 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

ovis. Four animals were exclusively positive to A. platys (4.4%), while 35 of them (38.9%) were 1

infected with A. marginale- centrale- ovis only. All the 99 bovine, caprine, and ovine samples were 2

negative when tested for the presence of A. phagocytophilum. Also, a blood sample obtained from a 3

red deer was found to be positive to the A. platys groEL specific PCR. 4

Upon cloning and sequencing of 35 groEL amplicons (19 obtained by A. platys specific PCR and 16 5

by A. marginale/A. ovis/A. centrale PCR) representative of different hosts and geographic locations, 6

39 sequences were obtained. Alignment with ClustalW allowed grouping the 39 sequences in 25 7

different sequence types (Table 3). On BLAST analyses (Table 3), 9 sequence types of both ovine 8

and bovine origin shared the highest level of similarity with strains of A. marginale isolated 9

worldwide (98-100%). Three ovine and bovine sequences showed the same levels of similarity 10

(99%) with a number of A. marginale and A. centrale strains associated to a large geographical 11

distribution. Three caprine sequence types were 99% similar to an A. ovis strain isolated in South 12

Africa. Ten sequence types obtained from ovine, caprine, and bovine samples shared 92 to 93% 13

similarity with the groEL gene of A. platys (e value 0.0). Sequence alignment of these last 10 14

sequences with the groEL sequence of A. platys allowed scoring 44 variable nucleotide positions 15

(Table 4S). Remarkably 32 positions contained nucleotide substitutions shared by all the sequences 16

obtained in this study, and represent therefore nucleotide signatures of the groEL region of the 17

corresponding Anaplasma strains infecting ruminants. Thirty out of 44 variable positions were 18

transitions and 14 were transversions. No variation other than nucleotide substitution was observed 19

along the alignment. Genetic variability was not related to the host species from which the sequence 20

types were derived. Neighbour Joining and Maximum parsimony analyses generated coinciding 21

trees in which 22 out of 25 sequence types group with reference sequences in statistically supported 22

clusters (Figure 2). In particular 10 sequence types derived from sheep and calves group with A. 23

marginale. Three sequence types derived from goats group with A. ovis, while 2 sequence types 24

cluster with A. marginale, A. centrale, and A. ovis but can not be unambiguously assigned to one of 25

these three species. Similarly to what observed with 16S phylogeny, 10 sequence types derived 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

from sheep, goats, calves, and a red deer generate a distinct clade with A. platys, and group in a 1

separate sub-clade. None of the groEL sequence types appear to be related to A. phagocytophilum. 2

Network analysis of the same groEL sequences (see discussion and Figure 4) confirms what was 3

observed with traditional trees, and allows assigning the sequences Bovine2 and Bovine3, 4

unresolved in the groEL trees, to A. marginale. Notably, 10 sequences group with A. platys in a 5

separate subclade, according to results graphically represented by phylogenetic trees based on 6

the16S rRNA and groEL genes (Figures 1, 2). 7

8

In situ hybridization and confocal laser scanning microscopy 9

To investigate the cellular tropism of the Anaplasma sp. closely related but distinct from A. 10

platys, an A. platys-specific digoxigenin-labeled (dig-labeled) DNA probe was successfully 11

generated by PCR. When blood smears obtained from 2 goats positive to A. platys specific PCR 12

were treated with the A. platys specific DNA probe no reaction of the probe could be observed with 13

platelets (Figure S2, lower panels). Interestingly the dig-labeled probe reacted with 14

polymorphonucleated cells morphologically resembling neutrophils (Figure S2 upper panels). To 15

confirm a neutrophil tropism for this Anaplasma strains, fluorescein- and rodhamine- labelled 16

versions of the A. platys specific probe were produced and tested against buffy coat, red blood cells, 17

and platelet enriched blood fractions obtained from the same animals. Reactivity of the probes with 18

these blood components, analyzed by confocal laser scanning microscopy, confirmed what already 19

observed with the dig-labeled probe. No reactivity of the fluorescent probes could be observed 20

either with platelet preparations or red blood cells (figure S3 lower and middle panels) while 21

neutrophil shaped cells strongly reacted with the same probes (figure S3 upper panels). Unlabeled 22

probes used as controls never reacted with buffy coat, red blood cells, and platelet enriched blood 23

preparations. Similarly no signal was detected when probes specific for A. marginale - A. centrale - 24

A. ovis were tested on the same samples. Experiments were repeated by probing neutrophils with 25

anti-neutrophil antibodies (figure 3 upper panel). Confocal laser scanner microscopy confirmed that 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

only neutrophils showing a positive reaction to the specific antibodies reacted at the same time with 1

the A. platys specific probe. Again, preparations of platelets obtained from the same animals only 2

reacted with specific anti-platelets antibodies, confirming the absence of a specific signal generated 3

by the A. platys-specific DNA probe. Notably, the DNA probe signal in neutrophils did not co-4

localise with the anti-neutrophil specific signal, but was homogeneously spread in the neutrophils 5

cytoplasm (Figure 4). 6

7


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

Discussion 1

With the exception of A. platys, all the bacterial species belonging to the genus Anaplasma 2

infect domestic and wild ruminants with worldwide geographical distributions mirroring that of tick 3

vectors. Ruminants represent therefore key species in the epidemiology of the genus Anaplasma by 4

either acting as definitive hosts or as infection reservoirs. In this study the presence and 5

molecular traits of the six species belonging to the genus Anaplasma were investigated in 6

ruminants of a typical Mediterranean environment. Several factors make the island of Sardinia 7

a natural laboratory for the study of Anaplasma incidence and prevalence: (a) its geographical 8

location in the middle of the Mediterranean Sea; (b) being a hotspot for tick-transmitted diseases; 9

(3) its climate favoring severe tick seasonal infestations caused by at least 6 tick genera 10

(Rhipicephalus, Haemaphysalis, Hyalomma, Boophilus, Dermacentor, Ixodes), present in the Island 11

at different relative abundances (15, 26, 27). In this paper we report a comprehensive study focused 12

on the genetic characterization of the Anaplasma strains circulating in Mediterranean domestic 13

ruminants. Indeed, although several studies evaluating the incidence and the economic impact of 14

ruminant anaplasmosis in Africa and in the Americas are available (28, 29, 30) similar studies are 15

still lacking in the Mediterranean area, in which the investigation of the genus Anaplasma is still 16

suffering and it is mainly limited to the detection of species impacting humans and pets, such as the 17

zoonotic A. phagocytophilum and the canine species A. platys. Here we demonstrated that Sardinian 18

ruminants are commonly infected by different Anaplasma species (Table 1). Indeed, levels of 19

Anaplasma prevalence, that is the percentage of animals positive to at least one Anaplasma species, 20

were high and comparable in Sardinian ruminants when independently calculated by groEL and 16S 21

rRNA PCRs (about 87 and 91 %, respectively). High Anaplasma prevalence could also be 22

individually observed in sheep (82 % 16S vs 89 % groEL), in bovines (75 % 16S vs 93 % groEL), 23

and in goats (100 % 16S vs 94 % groEL), with about 50% of ruminants coinfected by at least two 24

Anaplasma species (data based on the groEL gene, not shown). 25


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

These data confirm the relevance of ruminants as important hosts and reservoirs of different 1

Anaplasma species in the subtropical Mediterranean areas. Furthermore, the contemporary presence 2

of more than one Anaplasma species in the same animal suggests carefully reinterpreting and 3

reconsidering previous studies in which prevalence was investigated by serology, and brings about 4

new concerns for the development of diagnostic serological and molecular tools. This is of 5

particular importance if one considers that several studies reported high degrees of cross-reactivity 6

among species of the genus Anaplasma in serological tests, for instance between A. 7

phagocytophilum and A. marginale (31); A. marginale and A. centrale, as well as cross-reactivity 8

among A, phagocytophilum, Ehrlichia spp., and A. platys (15, 17, 31, 32). 9

BlastN analysis (Table 2), alignment (Table S1), and phylogenies (Figure 1) of the 16S 10

rRNA sequence types obtained in this study confirmed that Sardinian ruminants are infected by 11

different Anaplasma species. Some of these species were relatively frequent, such as A. ovis in 12

sheep and goats, A. marginale in calves and goats, and A. bovis in sheep. On the contrary, A. 13

phagocytophilum was only detected in a single sheep. This last result was unexpected, since this 14

species was previously detected in Sardinian symptomatic horses, dogs, ticks, and human (14, 27). 15

Therefore, it can be postulated that in this geographic area ruminants are not relevant reservoirs for 16

granulocytic anaplasmosis, but alternative vertebrate species can act as maintenance hosts. This 17

could be also related to the scarce presence of Ixodes ticks in the Island, representing only 0.3 % of 18

total ticks population. Two 16S rRNA sequence types detected in calves and in a goat shared 99% 19

homology with the 16S rRNA sequence of the canine A. platys. Upon phylogenetic analyses, the 20

two A. platys-like sequence types grouped with A. platys in a distinct subcluster closely related to a 21

second subcluster composed by A. phagocytophilum and A. bovis (figure 1). Similar strains were 22

already reported in central and southern China (33) but they were never included in phylogenetic 23

analyses. BlastN analysis (Table 3), and phylogenies (Figure 2) of the 25 unique groEL sequence 24

types obtained in this study confirmed the presence of distinct strains of A. marginale in sheep and 25

calves, and of A. ovis in goats. None of the 99 ruminants tested positive for A. phagocytophilum. 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

These results confirm what was observed with the 16S rRNA gene, and allow pointing out that 1

unlike previous observations in other European countries, implications of ruminants in the 2

epidemiology of A. phagocytophilum are weak in this geographic area. Notably, a great proportion 3

(10/25) of the groEL gene sequence types (tables 3, S2) identified in ruminants clustered with A. 4

platys in phylogenetic trees, as already observed with 16S rRNA phylogenetic analyses. These 5

results were also confirmed by network analyses (Figure 4), and indicate that ruminants harbour a 6

number of Anaplasma strains closely related to the canine, platelet-infecting A. platys species. 7

In situ hybridization experiments conducted on peripheral blood fractions (platelets, buffy 8

coat, and erythrocytes) of goats PCR positive to A. platys with DNA probes labeled either with 9

digoxigenin or fluorochromes, unexpectedly resulted in the absence of a specific signal in the 10

platelet fraction, but in a clear signal in neutrophil granulocytes (Figures S2, S3, 3). Confocal 11

microscopy experiments pointed out that the signal was homogeneously distributed into the 12

ganulocyte neutrophils cytoplasm (Figure 4). The genetic similarity of these new strains identified 13

in ruminants with A. platys (92-93 % groEL identity, 99% 16S rRNA identity), and their weaker 14

relation to A. phagocytophilum (79-80 % groEL identity) would indicate that ruminants host a 15

number of strains belonging to the species A. platys. However their peculiar host and cell tropism, 16

reminding that of A. phagocytophilum, would suggest the assignment of the A. platys - like strains 17

to a separated taxon. The presence of A. platys-like strains opens new concerns about the specificity 18

of the direct and indirect diagnostic tests routinely used to detect different Anaplasma species in 19

ruminants, which should be reconsidered on the basis of potential cross reactivity, especially when 20

coinfection is present. Also the identification of A. platys-like strains provides additional 21

background helpful for reconstructing the evolutionary history of the A. phagocytophilum cluster. 22

Considering that the groEL sequence of A. platys is invariable in strains isolated in different region 23

of the world, one could postulate that this Anaplasma species originated recently. Most probably the 24

ancestor of A. platys had host and cellular tropism more similar to the one of A. phagocytophilum, 25

which is able to infect both ruminant and carnivore neutrophil granulocytes. A. platys could have 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

21

originated form A. phagocytophilum–like strains through host range specialization (from mixed host 1

tropism to exclusively canine tropism) and through a shift in cellular tropism (from granulocytes 2

neutrophils to platelets). Under this evolutionary scenario the A. platys-like strains found in 3

ruminants could represent ancestral A. platys strains in which the original host and cellular tropism 4

has been maintained. An open question that cannot be answered based on our data is the 5

identification of factors that acted (and still act) as barriers generating and maintaining a genetic 6

separation between A. phagocytophilum and the A plays-like strains (79/80 % groEL identity) in 7

ruminants, since they share the same host and cell type. Possible causes could be related to the 8

different tick vectors transmitting the two species (Ixodes ticks for A. phagocytophilum, 9

Rhipicephalus for A. platys). Concluding, considering their high prevalence, more investigations are 10

welcomed to assess the economic impact of the different Anaplasma species in Mediterranean 11

ruminants, and to develop more specific direct and indirect tools for Anaplasma spp. diagnosis in 12

wild and domestic species. 13

14

Acknowledgements 15

Rosanna Zobba was supported by “Regione Autonoma della Sardegna” through program 16

“Promozione della Ricerca Scientifica e dell’Innovazione Tecnologica in Sardegna, LR 7/2007, PO 17

Sardegna FSE 2007-2013”. 18

19


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

22

Table 1. Origin of ruminants investigated in this study and summary of PCR results 1 2

Host Speciesa

Geographic Location

N° of sampled animals

16S rRNA groEL A. phagocytophilum

groEL A. platys

groEL A. marginale

A. ovis A. centrale

groEL Total

Sheep Villacidro 13 12/13 0/13 0/13 12/13 12/13 Sheep Perfugas 1 1/1 0/1 0/1 1/1 1/1 Sheep Bulzi 4 1/1 0/4 1/4 4/4 4/4 Sheep S. M. Coghinas 2 1/2 0/2 0/2 1/2 1/2 Sheep Ittiri 2 2/2 0/2 0/2 0/2 0/2 Sheep 22 17/19 0/22 1/22 18/22 18/22

Bovine Sedini 1 0/1 0/1 0/1 1/1 1/1 Bovine Bortigiadas 14 2/3 0/14 12/14 14/14 14/14 Bovine Badesi 5 4/4 0/5 4/5 5/5 5/5 Bovine Tula 1 0/1 0/1 0/1 0/1 0/1 Bovine Perfugas 9 6/7 0/9 3/9 7/9 8/9 Bovine Erula 4 0/1 0/4 3/4 4/4 4/4 Bovine Samugheo 3 - 0/3 3/3 3/3 3/3 Bovine Lanusei 6 3/3 0/6 2/6 5/6 5/6 Bovine 43 15/20 0/43 27/43 39/43 40/43

Goat Perfugas 5 4/4 0/5 5/5 4/5 5/5 Goat Tisiennari 21 12/12 0/21 17/21 21/21 21/21 Goat Sassari 8 - 0/8 5/8 4/8 6/8 Goat 34 16/16 0/34 27/34 29/34 32/34

Total 99 48/55 0/99 55/99 86/99 90/99 a the red deer sample is not included in this table 3 4


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

23

Table 2. Designation of the eight 16S rRNA sequence types identified in this study 1 2

Sequence types Hosts Geographical locations Genbank # Blast analyses

BovineCaprine1 Bos taurus 204934

Capra hircus 50 Perfugas (Northern Sardinia) Perfugas (Northern Sardinia)

KC335221 KC335222

99% A. platys (Invariable)

BovineCaprine2 Bos taurus 197 Capra hircus 71

Badesi (Northern Sardinia) Perfugas (Northern Sardinia)

KC335223 KC335224

100% A. marginale (Worldwide)

Bovine1 Bos taurus 199 Bos taurus 204927

Badesi (Northern Sardinia) Perfugas (Northern Sardinia)

KC335218 KC335219

100% A. marginale (Asia, USA)

Bovine2 Bos taurus 194 Samugheo (Central Sardinia) KC335220 99% A. platys (Invariable)

Ovine1 Ovis aries 230 Villacidro (South Western Sardinia) KC335227 99% A. phagocytophilum (worldwide)

Ovine2 Ovis aries 725

Ovis aries C3 Ovis aries A1

S.M. Coghinas (Northern Sardinia) Ittiri (North Western Sardinia) Ittiri (North Western Sardinia)

KC335228 KC335229 KC335230

99 to 100% A. bovis (Asia, USA)

Ovine3 Ovis aries 208 Bulzi (Northern Sardinia) KC335231 99 to 100% A. ovis (Asia, Africa, USA)

OvineCaprine1 Capra hircus 70 Ovis aries 235

Perfugas (Northern Sardinia) Villacidro (South Western Sardinia)

KC335225 KC335226

99 to 100% A. ovis (Asia, Africa, Europe)

3

4


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

24

Table 3. Designation of the 25 groEL sequence types identified in this study 1 2 Sequence types Hosts Geographical locations Genbank Blast analyses

Ovine1 Ovis aries 228 Villacidro (SW Sardinia) KC335242 99% A. marginale, A centrale (Worldwide)

Bovine1 Bos taurus 125554 Bos taurus 199 Bos taurus 195

Lanusei (CE Sardinia) Badesi (N Sardinia) Badesi (NSardinia)

KC335245 KC335244 KC335243

99 to 100% A. marginale (Worldwide)

Bovine2 Bos taurus 199 Badesi (NSardinia) KC335241 99% A. marginale, A centrale (Worldwide)

Ovine2 Ovis aries 232 Villacidro (SW Sardinia) KC335266 99% A. marginale (Philippines)

OvineBovine1 Ovis aries 230 Bos taurus 032 Bos taurus 204934

Villacidro (SW Sardinia) Lanusei (CE Sardinia) Perfugas (N Sardinia)

KC335238 KC335237 KC335236

99% A. marginale (Philippines)

Ovine3 Ovis aries 208 Bulzi (NSardinia) KC335240 98 to 99% A. marginale (Worldwide)

Ovine4 Ovis aries 208 Bulzi (N Sardinia) KC335239 99% A. marginale (Philippines)

Bovine4 Bos taurus 204927 Perfugas (N Sardinia) KC335235 99% A. marginale (Philippines)

Bovine5 Bos taurus 032 Lanusei (CE Sardinia) KC335232 99% A. marginale (Philippines)



Caprine1 Capra hircus 322 Sassari (NW Sardinia) KC335267 99% A. ovis (South Africa)

Caprine2 Capra hircus G Bortigiadas (N Sardinia) KC335268 99% A. ovis (South Africa)

Caprine3 Capra hircus 50 Perfugas (N Sardinia) KC335269 99% A. ovis (South Africa)

Bovine6 Bos taurus 306 Samugheo (C Sardinia) KC335256 93% A. platys (Invariable)

CaprineCervus1 Capra hircus 50 Capra hircus 71 Cervus elaphus 1

Perfugas (N Sardinia) Perfugas (N Sardinia) Monastir (S Sardinia)

KC335249 KC335248 KC335247


Bovine3 Bos taurus 194 Badesi (N Sardinia) KC335270 99% A. marginale, A centrale (Worldwide)

Bovine7 Bos taurus 194 Bos taurus 303 Bos taurus 195 Bos taurus 199 Bos taurus 204

Badesi (N Sardinia) Samugheo (C Sardinia) Badesi (N Sardinia) Badesi (N Sardinia) Bulzi (N Sardinia)

KC335265 KC335264 KC335263 KC335262 KC335261


Caprine4 Capra hircus 324 Sassari (NW Sardinia) KC335260 92% A. platys (Invariable)

Caprine5 Capra hircus 84 Capra hircus C Capra hircus E

Bortigiadas (N Sardinia) Bortigiadas (N Sardinia) Bortigiadas (N Sardinia)

KC335259 KC335258 KC335257


Cervus1 Cervus elaphus 1 Monastir (S Sardinia) KC335246 93% A. platys (Invariable)

Bovine8 Bos taurus 304 Samugheo (C Sardinia) KC335255 93% A. platys (Invariable)

Caprine6 Capra hircus M2 Capra hircus 332 Capra hircus 334

Sassari (NW Sardinia) Sassari (NW Sardinia) Sassari (NW Sardinia)

KC335254 KC335253 KC335252


Bovine9 Bos taurus 204927 Perfugas (N Sardinia) KC335251 93% A. platys (Invariable)

Ovine7 Ovis aries 208 Bulzi (N Sardinia) KC335250 92% A. platys (Invariable)

3 4


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

25

Figure legends 1

2

Figure 1. 16S rRNA-based phylogenetic analyses of the strains identified in this study and of 8 3

sequences representative of the different species of the genus Anaplasma. Despite both character 4

based and distance based evolutionary analyses generated coinciding trees, only the evolutionary 5

history inferred using the Neighbour-Joining method is shown, with sum of branch length = 0. 6

32723954. The percentages of replicate trees in which the associated taxa clustered together in the 7

bootstrap test (1000 replicates) are shown next to the branches. All positions containing gaps and 8

missing data were eliminated. There were a total of 760 positions in the final dataset. E. canis and 9

R. rickettsii were used as outgroups. 10

11

Figure 2. groEL-based phylogenetic analyses of the strains identified in this study and of 16 12

sequences representative of the different species of the genus Anaplasma. As in the case of 16S 13

rRNA-based analyses, both character based and distance based evolutionary analyses generated 14

coinciding trees but only the evolutionary history inferred using the Neighbour-Joining method is 15

shown, with sum of branch length = 0.82216554. The evolutionary distances were computed using 16

the Kimura 2-parameter method and are in the units of the number of transitional substitution per 17

site. The percentages of replicate trees in which the associated taxa clustered together in the 18

bootstrap test (1000 replicates) are shown next to the branches. All positions containing gaps and 19

missing data were eliminated. There were a total of 470 positions in the final dataset. E. canis and 20

R. rickettsii were used as outgroups. 21

22

Figure 3. Detection of A. platys-like strains in goat neutrophil granulocytes. Buffy coats obtained 23

from PCR-positive goats were layered in slides by centrifugation, and probed with TRITC-labeled 24

A. platys DNA- probes alternatively combined with FITC-labeled anti-neutrophils antibodies (upper 25

raw) or FITC-labeled anti platelets antibodies (lower raw). DAPI was used to counterstain PBMCs 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

26

nuclei. 1

2

Figure 4. Identification of A. platys-like strains by network analyses (right), and cellular 3

distribution in neutrophil granulocytes (lower left). Neutrophil granulocytes were contemporarily 4

probed with a FITC-labeled A. platys DNA-probe and with TRITC-labeled anti-neutrophils 5

antibodies. 6

7

8


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

27

References 1

1. Uilenberg G. General review of tick-borne diseases of sheep and goats world-wide. 2

Parasitologia 1997; 39: 161–165. 3

2. Bekker CP, de Vos S, Taoufik A, Sparagano OA, Jongejan F. Simultaneous detection of 4

Anaplasma and Ehrlichia species in ruminants and detection of Ehrlichia ruminantium in 5

Amblyomma variegatum ticks by reverse line blot hybridization. Vet Microbiol 2002; 89: 6

223-238. 7

3. Parola P, Davoust B, Raoult D. Tick- and flea-borne rickettsial emerging zoonoses. Vet Res 8

2005; 36: 469-492. 9

4. Parola P, Paddock CD, Raoult D. Tick-borne rickettsioses around the world: emerging 10

diseases challenging old concepts. Clin Microbiol Rev 2005; 18: 719-756. 11

5. Nicholson WL, Allen KE, McQuiston JH, Breitschwerdt EB, Little SE. The increasing 12

recognition of rickettsial pathogens in dogs and people. Trends Parasitol 2010; 26: 205-212. 13

6. Sainz A, Amusategui I, Tesouro MA. Ehrlichia platys infection and disease in dogs in 14

Spain. J Vet Diagn Invest 1999; 11: 382–384. 15

7. Melendez RD. Future perspective on veterinary hemoparasite research in the tropic at the 16

start of this century. Ann N Y Acad Sci 2000; 916: 253–258. 17

8. Stuen S, Bergstrom K, Palmer E. Reduced weight gain due to subclinical Anaplasma 18

phagocytophilum (formerly Ehrlichia phagocytophila) infection. Exp Appl Acarol 2002; 28: 19

209–215. 20

9. Stuen S, Nevland S, Moum T. Fatal cases of tick-borne fever (TBF) in sheep caused by 21

several 16S rRNA gene variants of Anaplasma phagocytophilum. Ann N Y Acad Sci 2003; 22

990: 433–434. 23

10. Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH, Ray SC, Rikihisa Y, Rurangirwa 24

FR. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the 25

order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

28

Ehrlichia and Ehrlichia with Neorickettsia, description of six new species combinations and 1

designation of Ehrlichia equi and HGE agent as subjective synonyms of Ehrlichia 2

phagocytophila. Int J Syst Evol Microbiol 2001; 51: 2145-2165. 3

11. Inokuma, H. Vectors and reservoir hosts of Anaplasmataceae. In: Raoult D, Parola P, eds. 4

Rickettsial Diseases. New York: Taylor & Grancis Group LLC, 2007: 199–212. 5

12. Rar V, Golovljova I. Anaplasma, Ehrlichia, and "Candidatus Neoehrlichia" bacteria: 6

pathogenicity, biodiversity, and molecular genetic characteristics, a review. Infect Genet 7

Evol 2011; 11: 1842-1861. 8

13. Kawahara M, Rikihisa Y, Lin Q, Isogai E, Tahara K, Itagaki A, Hiramitsu Y, Tajima T. 9

Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma 10

centrale, and a novel Ehrlichia sp. in wild deer and ticks on two major islands in Japan. 11

Appl Environ Microbiol 2006; 72: 1102-1109. 12

14. Alberti A, Zobba R, Chessa B, Addis MF, Sparagano O, Pinna Parpaglia ML, Cubeddu T, 13

Pintori G, Pittau M. Equine and canine Anaplasma phagocytophilum strains isolated on the 14

island of Sardinia (Italy) are phylogenetically related to pathogenic strains from the United 15

States. Appl Environ Microbiol 2005; 71: 6418-6422. 16

15. Alberti A, Addis MF, Sparagano O, Zobba R, Chessa B, Cubeddu T, Parpaglia ML, Ardu 17

M, Pittau M. Anaplasma phagocytophilum, Sardinia, Italy. Emerg Infect Dis 2005; 11: 18

1322-1324. 19

16. Woldehiwet Z. Anaplasma phagocytophilum in ruminants in Europe. Ann N Y Acad Sci 20

2006; 1078: 446-460. 21

17. Alberti A, Sparagano OA. Molecular diagnosis of granulocytic anaplasmosis and infectious 22

cyclic thrombocytopenia by PCR-RFLP. Ann N Y Acad Sci 2006; 1081: 371-378. 23

18. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of 24

progressive multiple sequence alignment through sequence weighting, positions-specific gap 25

penalties and weight matrix choice. Nucl Acids Res 1994; 22: 4673–4680. 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

29

19. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J 1

Mol Biol 1990; 215: 403-410. 2

20. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program 3

for Windows 95/98/NT. Nucl Acids Symp Ser 1999; 41: 95–98. 4

21. Tamura K, Nei M, Kumar S. Prospects for inferring very large phylogenies by using the 5

neighbor-joining method. Proc Natl Acad Sci U S A 2004; 101: 11030-11035. 6

22. Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA2: Molecular Evolutionary Genetics 7

Analysis Software. Bioinformatics 2001; 17: 1244–1245. 8

23. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing 9

phylogenetic trees. Mol Biol Evol 1987; 4: 406–425. 10

24. Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 11

1985; 39: 783–791. 12

25. Huson DH, Bryant D. Application of phylogenetic networks in evolutionary studies. Mol 13

Biol Evol 2006; 23: 254–267. 14

26. Di Todaro N, Piazza C, Otranto D, Giangaspero A. Ticks infesting domestic animals in 15

Italy: current acarological studies carried out in Sardinia and Basilicata regions. 16

Parassitologia 1999; 41 (suppl): 39-40. 17

27. Satta G, Chisu V, Cabras P, Fois F, Masala G. Pathogens and symbionts in ticks: a survey 18

on tick species distribution and presence of tick-transmitted micro-organisms in Sardinia, 19

Italy. J Med Microbiol 2011; 60 : 63-68. 20

28. Kocan KM. Antigens and Alternatives for Control of Anaplasma marginale Infection in 21

Cattle: USA e south America. Clin Microbiol Rev 2003; 16: 698–712. 22

29. Kivaria FM. Estimated direct economic costs associated with tick-borne diseases on cattle in 23

Tanzania. Trop Anim Health Prod. 2006; 38: 291-299. 24

30. Minjauw B and McLeod A. 2003. Tick-borne diseases and poverty. The impact of ticks and 25

tick- borne diseases on the livelihood of small-scale and marginal livestock owners in India 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

30

and eastern and southern Africa. Research report, DFID Animal Health Programme, Centre 1

for Tropical Veterinary Medicine, University of Edinburgh, UK. 2

http://www.dfid.gov.uk/r4d/PDF/Outputs/RLAHTickBorn_Book.pdf:. 3

31. Dreher UM, de la Fuente J, Hofmann-Lehmann R, Meli ML, Pusterla N, Kocan KM, 4

Woldehiwet Z, Braun U, Regula G, Staerk KDC, Lutz H. Serologic Cross-Reactivity 5

between Anaplasma marginale and Anaplasma phagocytophilum. Clin Diagn Lab Immunol. 6

2005; 12: 1177–1183 7

32. Al-Adhami B, Scandrett WB, Lobanov VA, Gajadhar AA. Serological cross-reactivity 8

between Anaplasma marginale and an Ehrlichia species in naturally and experimentally 9

infected cattle. J Vet Diagn Invest. 2011; 23: 1181-1188. 10

33. Liu Z, Ma M, Wang Z, Wang J, Peng Y, Li Y, Guan G, Luo J, Yin H. Molecular survey and 11

genetic identification of anaplasma species in goats from central and southern china. Appl 12

Environ Microbiol. 2012; 78: 464-470. 13

14 on April 5, 2018 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Documents

1 Molecular investigation and phylogeny of Anaplasma spp. in