1

The plasma membrane transregulator of polyamine uptake Agp2p regulates the antifungal activity 1

of the plant defensin NaD1 and other cationic peptides. 2

Mark R Bleackley1#, Jennifer L Wiltshire1, Francine Perrine-Walker1, Shaily Vasa1, Rhiannon L Burns1, 3

Nicole L van der Weerden1, Marilyn A Anderson1# 4

1 La Trobe Institute for Molecular Science, Melbourne 3086 5

Victoria, Australia 6

# Address correspondence to: Mark R Bleackley (m.bleackley@latrobe.edu.au, +61 3 7

94792353) or Marilyn A Anderson (m.anderson@latrobe.edu.au, +61 3 9479 1255) 8

Running Title: Agp2 and NaD1 activity 9

AAC Accepts, published online ahead of print on 24 February 2014Antimicrob. Agents Chemother. doi:10.1128/AAC.02087-13Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

2

Abstract 10

Cationic antifungal peptides (AFPs) act through a variety of mechanisms but share the common 11

feature of interaction with the fungal cell surface. NaD1, a defensin from Nicotiana alata, has 12

potent antifungal activity against a variety of fungi of both hyphal and yeast morphologies. The 13

mechanism of action of NaD1 occurs via three steps; binding to the fungal cell surface, 14

permeabilization of the plasma membrane, internalization and interaction with intracellular targets 15

to induce fungal cell death. The targets at each of these three stages have yet to be defined. In this 16

study, screening of a Saccharomyces cerevisiae deletion collection led to identification of Agp2p as a 17

regulator of the potency of NaD1. Agp2p is a plasma membrane protein that regulates transport of 18

polyamines and other molecules, many of which carry a positive charge. Cells lacking the agp2 gene 19

were more resistant to NaD1 and this resistance was accompanied by decreased uptake of defensin. 20

Competitive inhibition of the antifungal activity of NaD1 by the polyamine spermidine, one of the 21

molecules that Agp2p senses and regulates the uptake of, was observed in both S. cerevisiae and the 22

plant pathogen Fusarium oxysporum. Resistance of agp2Δ to other cationic antifungal peptides and 23

decreased binding to the cationic protein cytochrome c to agp2Δ compared to wildtype have led to a 24

proposed mechanism of resistance whereby deletion of agp2 leads to an increase of positively 25

charged molecules at the cell surface that repels cationic antifungal peptides. 26

27

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

3

Introduction 28

Fungal pathogens infect plant and animal species and are being increasingly recognised as a threat 29

to human health, biodiversity and agriculture [1]. Present day infections of major crops including 30

wheat, soy bean, corn and banana lead to significant yield losses [1, 2]. Thus development of novel 31

systems for prevention of fungal infection in plants has been identified as a key point in protecting 32

global food security [3]. One way to combat the damaging effects of fungal pathogens is to identify 33

the most potent antifungal molecules that have evolved in nature. Elucidation of the mechanisms 34

by which they inhibit infection can in turn be used to facilitate their development as tools to combat 35

fungal pathogens. Of particular interest are gene encoded innate immunity peptides that are 36

produced by a wide range of organisms including animals, plants, insects, fungi and bacteria [4]. 37

Plants lack an adaptive immune system and have therefore evolved a variety of innate immune 38

responses to protect against infection [5]. A major component of the plant innate immune system is 39

the production of antimicrobial peptides [6], many of which are active against a variety of fungi [4]. 40

Gene encoded peptides are of particular interest as once the sequence is known the encoding DNA 41

can be used to produce the peptides recombinantly for characterization and as well as for 42

construction of transgenic plants with increased antifungal resistance. Gaining an understanding of 43

the mechanisms by which these proteins act against fungal pathogens is crucial for the design of 44

improved antifungal molecules and treatment regimens. 45

One of the largest families of plant antimicrobial peptides is the defensins [7-9]. Plant defensins are 46

small (45-54 amino acid) basic proteins with four to five disulphide bonds [7]. Although there is 47

structural conservation among plant defensins, there is substantial variability in the amino acid 48

sequences which leads to a variety of biological functions and mechanisms of action [4, 9]. The 49

mechanisms of antifungal activity also vary between defensins and although not well defined include 50

features such as sphingolipid binding, generation of reactive oxygen species (ROS), cell wall stress, 51

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

4

septin mislocalization, programmed cell death, blocking of calcium channels and cell cycle arrest [10-52

16]. 53

NaD1 is a defensin from the ornamental tobacco Nicotiana alata [17] that kills filamentous fungi 54

such as Fusarium graminearum and F. oxysporum [18], the human fungal pathogens Candida 55

albicans and Cryptococcus neoformans and the model yeast Saccharomyces cerevisiae [19]. 56

Transgenic cotton plants expressing NaD1 are resistant to F. oxysporum and Verticillium dahlia in the 57

field [20]. Killing of the fungal cell is proposed to occur via a three step process dependent on the 58

presence of the fungal cell wall. Exposure of fungi to NaD1 results in ROS and nitric oxide (NO) 59

production as well as permeabilization of the fungal membrane [18, 19, 21] and has been proposed 60

to involve dimerization of the defensin [22]. Studies on the activity of NaD1 in C. albicans have 61

revealed that the Hog1 pathway plays a role in protecting the cell from the damaging effects of 62

NaD1 and S. cerevisiae studies have provided evidence for the involvement of active mitochondria in 63

ROS production [19]. However, the cell surface receptor and intracellular targets of NaD1 have yet to 64

be elucidated. With the aim of identifying these components, we screened the non-essential S. 65

cerevisiae deletion collection for strains that are resistant to NaD1. This led to the identification of a 66

set of genes involved in polyamine transport as having a role in the antifungal activity of NaD1. Of 67

particular interest was the cell membrane regulator of polyamine and carnitine transport Agp2p. 68

Deletion of the agp2 gene imparted resistance to NaD1 via a mechanism that includes diminished 69

uptake of the defensin. Further analysis of antifungal peptide sensitivity in agp2Δ revealed a link 70

between polyamine uptake and the activity of cationic antifungal peptides as a whole. 71

Materials and Methods 72

Yeast strains and media 73

The S. cerevisiae non-essential deletion collection was purchased from Thermo Scientific and is in a 74

BY4741 (MATa his3∆0 leu2∆0 met15∆0 ura3∆0) background. Mutant strains were retrieved from the 75

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

5

deletion collection and compared to BY4741. Double mutants were made by amplifying the URA3 76

gene from the pRS426 plasmid using primers containing 40bp regions corresponding to the 5’ and 3’ 77

ends of the coding region upstream of the pRS426 binding sequence (italics). The sequences of these 78

primer pairs were Dur3F 79

ATGGGAGAATTTAAACCTCCGCTACCTCAAGGCGCTGGGTCTGTGCGGTATTTCACACCG and Dur3R 80

TTAAATTATTTCATCAACTTGTCCGAAATGTGATGATTGTCGATTGTACTGAGAGTGCAC, Sam3F 81

ATGGATATACTCAAGAGGGGAAATGAATCGGACAAGTTTACTGTGCGGTATTTCACACCG and Sam3R 82

TAACACCAAAATCTGTAGATTTTGTAATAGAATGGCTTAGGATTGTACTGAGAGTGCAC. PCR products were 83

purified using a Wizard PCR clean-up kit (Promega) and transformed into yeast cells via 84

electroporation. Mutants were colonies selected on SD-URA (0.67% yeast nitrogen base without 85

amino acids (Sigma), 0.077% -URA DO supplement (Clontech) agar plates. Overnight cultures for all 86

S. cerevisiae experiments were grown in YPD (1% yeast extract, 2% peptone, 2% dextrose). All 87

mutants were confirmed by genotyping. 88

Fusarium oxysporum f. sp. vasinfectum (Australian isolate VCG01111 isolated from cotton; Farming 89

Systems Institute, DPI, Queensland, Australia, a gift from Wayne O’Neill) overnight cultures were 90

grown in ½ strength Potato Dextrose Broth (1/2 PDB) (BD Difco). All experiments were conducted in 91

1/2 PDB except where otherwise noted. All chemicals were purchased from Sigma unless otherwise 92

noted. NaD1 was purified from Nicotiana alata flowers as outlined in [18]. HBD2 was expressed in 93

Pichia pink (Life Technologies) using the protocol outlined in [19]. Other antifungal peptides were 94

purchased from GenScript (Hong Kong) or GL Biochem (Shanghai). 95

Yeast deletion screen 96

The non-essential S. cerevisiae deletion collection (ThermoScientific) [23, 24] was grown overnight at 97

30⁰C in 96 well plates in YPD supplemented with G418 (200µg/mL) (Amresco). Each strain was 98

diluted 1:100 with ½ PDB and diluted culture (5 µL) was added to 95µL of ½ PDB containing 4µM 99

NaD1. This concentration of NaD1 was chosen as it was the lowest concentration where >90% 100

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

6

inhibition was regularly observed in preliminary experiments on wild type yeast conducted under 101

the same conditions as the screen (data not shown). Half-strength PDB with no added protein was 102

used as a control. Liquid handling was performed with a Bravo Automated liquid handling platform 103

(Agilent technologies). Growth was measured as the increase in absorbance at 595 nm after 104

incubation for 20 h at 30⁰C. Absorbance at 595 nm was measured using a SpectraMax M5e plate 105

reader (Molecular Devices). Percent growth inhibition [(growth in control media - growth in NaD1 106

media)/growth in control media x 100] was calculated for each strain and resistant strains were 107

defined as those with a percentage growth inhibition that was more than two standard deviations 108

below the mean. Strains that did not grow in ½ PDB were eliminated from the analysis and the 109

remaining resistant strains were rescreened in triplicate in 4µM NaD1 to ensure reproducibility. 110

Strains exhibiting less than 60% growth inhibition in the triplicate screen were then considered the 111

NaD1 resistant subset. P-values were calculated using the embedded function in Microsoft Excel. 112

Antifungal assays 113

Antifungal protein stock solutions were prepared at 10x the desired final concentration in sterile 114

milliQ water. Ten microliters of these solutions were added to the wells of a 96 well microtitre plate 115

along with 90 µL of overnight culture that had been diluted to OD 600=0.01 in ½ PDB. Growth was 116

measured as the increase in absorbance at 595 nm after incubation for 20 h at 30⁰C. Absorbance at 117

595 nm was measured using a SpectraMax M5e plate reader (Molecular Devices). Percent growth 118

inhibition was calculated as above. All experiments were replicated at least three times. 119

Survival assays 120

Antifungal protein stocks were prepared as above and added to 90µL aliquots of overnight cultures 121

that had been diluted to OD600=0.2. For experiments on the effect of spermidine, spermidine was 122

prepared at 100x the final concentration and 1µL was added to diluted cells together with 10µL of 123

the antifungal protein. Cells were incubated for 1h at 30⁰C. After incubation the cells were serially 124

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

7

diluted 3x and each dilution was plated (4µL) on a YPD plate and incubated at 30⁰C for 48h. All 125

experiments were repeated a minimum of three times and results were consistent across replicates. 126

Membrane permeabilization assays 127

Membrane permeabilization assays were performed using a protocol modified from [21]. Briefly, 128

antifungal protein solutions were prepared as 10x concentrates in milliQ water as described for the 129

antifungal assays except for experiments also involving polyamines. In these experiments NaD1 was 130

made up at 20x the final concentration and the polyamine (putrescine or spermidine) was made up 131

at 10x the final concentration. The NaD1 solution (5µL) and the polyamine solution (10µL) were 132

transferred to the wells of a black 96 well plate (Nunc). S. cerevisiae overnight cultures (85µL) that 133

had been diluted to OD 600=0.1 in ½ PDB with 1µM SYTOX green (Molecular Probes) were then 134

added to the wells prior to analysis. SYTOX green uptake was measured using a SpectraMax M5e 135

plate reader (Molecular Devices) with excitation and emission wavelengths of 488nm and 538nm 136

respectively. All data presented was consistent across at least three independent replicates. 137

Microscopy 138

Yeast cells were grown overnight in YPD liquid medium and diluted to an OD600nm of 0.5-0.6 139

(Biophotometer, Eppendorf) in 1/2 PBD. The yeast cell suspension (300µL) was then placed in µ-slide 140

8 wells (Ibidi) for live cell imaging. All live cell imaging experiments were maintained at 30⁰C within a 141

Zeiss Clear Perspex Incubator equipped with a heater and temperature controller (Temp Control 37-142

2 digital). NaD1 was labelled with the fluorophore BODIPY-FL-EDA (Molecular probes) as outlined in 143

[21]. Samples were treated with 0 or 25µL of 2.5mg/mL BODIPY labelled-NaD1 peptide stock 144

solution. The yeast cells were then visualized by confocal microscopy using a Zeiss LSM 510 laser 145

scanning Axiovert 200M inverted confocal microscope with a Plan Apochromat 100X/1.4 Oil DIC 146

objective. For live cell imaging, the cells were excited at the 488nm with an Argon laser using band 147

pass filters BP505-530 or BP505-550 for detection of BODIPY fluorescence (green). Time series 148

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

8

images at 30 and 60 second intervals over 36 minutes were acquired using the Zen 2009 image 149

acquisition software (Carl Zeiss MicroImaing GmbH 1997-2011). Control experiments were 150

performed using the same parameters. Experiments were conducted in triplicate. Images were 151

further analyzed using Fiji software (Image J 1.47h version) (Rasband,W.S., ImageJ , U.S. National 152

Institutes of Health, Bethesda, Maryland, USA, 1997-2012) and Zeiss LSM Image Browser Version 153

4.2.0.121 (Carl Zeiss MicroImaging GmbH 1997-2006) and were processed in Illustrator CS6 (Adobe). 154

Flow cytometry 155

S. cerevisiae strains were grown overnight in YPD then diluted to OD 600=0.1 in ½ PDB before 100µL 156

aliquots were treated with a given concentration (0, 5, 10, 20µM) of BODIPY labelled NaD1 for 30 157

min or 3 h in the absence of light. Cells were then washed two times with 100µL of phosphate 158

buffered saline (PBS, 137mM NaCl, 2.7mM KCl, 10mM Na2HPO4, 2mM KH2PO4, pH 7.4) before they 159

were resuspended in 100µL PBS. Samples were then transferred to a U-bottom 96 well plate 160

(Greiner) and analysed using the FITC channel on a FACS Canto II fitted with an HTS sampler (BD 161

Biosciences). FACS analysis was performed using Weasel (Walter and Elisa Hall Institute for Medical 162

Research). 163

NaD1 pull down and Western blot. 164

BY4741, sam3/dur3 and agp2Δ cells were grown overnight at 30⁰C in liquid YPD. One mL of cell 165

culture was pelleted and cells washed 2X with 1mL of MilliQ H2O in 1.5 mL microfuge tubes. Cells 166

were then resuspended in ½ PDB at an OD600nm=0.5. BY4741 cells were resuspended with and 167

without the addition of 100µM spermidine. NaD1 was added to a final concentration of 20µM in a 168

final volume of 100µL. Each treatment was then rotated at room temperature on a Ratek RSM6 169

wheel for 30 min. Cells were then pelleted at max speed in a microfuge, washed with 100µL of MilliQ 170

water, resuspended in 20µL of 0.01% SDS. NuPAGE LDS sample buffer (Life Technologies) and Bond-171

Breaker TCEP solution (Thermo) (5µL total of a 9:1 solution of NuPAGE LDS buffer:Bondbreaker) was 172

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

9

added to each sample and incubated at 90⁰C for 20min. Total cell suspensions were run on SDS-173

PAGE. Proteins were transferred to nitrocellulose using a Trans-Blot Turbo (Biorad). NaD1 levels 174

were determined by Western blot using an anti-NaD1 primary antibody [18] and donkey anti-rabbit 175

(GE healthcare) secondary antibody. Immunoreactive NaD1 was visualized using the GE Healthcare 176

ECL Western Blotting Detection Reagents kit and densitometry of resulting bands was performed 177

using the Image Lab software package (Biorad). 178

Cytochrome c binding assay. 179

The cyctochrome c binding assay was modified from the protocol outlined in [25]. Yeast cells were 180

grown overnight at 30⁰C in liquid YPD and cells were pelleted and resuspended at an OD600=13. 181

Cells in a 1 mL aliquot of each strain were washed 2x with PBS and resuspended in 1mL of PBS. Cells 182

(100µL) were then added to 300 µL of a cytochrome c solution (0.5mg/mL of equine cytochrome c 183

(Sigma) in PBS) and incubated at room temperature on a a Ratek RSM6 wheel for 20 min. Cells were 184

then pelleted and the supernatant (3x100µL) was transferred to the wells of a 96 well microtitre 185

plate. Cytochrome c remaining in the supernatant was quantified spectrophotometrically at 530nm, 186

the absorption maximum of the protein resulting from the heme prosthetic group. 187

Results 188

Yeast deletion screen 189

Screening of the S. cerevisiae haploid non-essential deletion collection for strains resistant to 4µM 190

NaD1 revealed the expected normal distribution of phenotypes across the collection (Figure 1A). 191

Strains were selected as resistant if the percent growth inhibition was more than two standard 192

deviations below the mean (<89%). Eighty one strains were resistant to NaD1 and these strains were 193

re-arrayed in a microtitre plate and rescreened against 4µM NaD1 in triplicate. Strains that exhibited 194

an average percent growth inhibition of less than 60 percent were then considered the set of 195

resistant deletion strains (Table 1 and Figure 1B). No growth was observed for BY4741 in the 196

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

10

triplicate re-screen. Functional cluster analysis of the resistant strains was performed using FunSpec 197

[26]. Minimal clustering was observed for any GO or MIPS classifications. However, there was some 198

indication of enrichment for genes with functions in the mitochondria and in polyamine transport. 199

Manual examination of the annotated locations and functions of the genes deleted in the NaD1 200

resistant set using the Saccharomyces genome database (www.yeastgenome.org) further supported 201

a role for mitochondria (cbp1, ccs1, tuf1, mrp7) and polyamine transport (agp2, brp1, ptk2, sky1) 202

[27] in the antifungal activity of NaD1. A link between functional mitochondria and NaD1 activity has 203

been reported previously [19] so we chose to pursue the role of polyamine transport in NaD1 204

activity as the focus for subsequent experiments. 205

Resistant strains with deletions in genes with known functions in polyamine transport (agp2, brp1, 206

ptk2, sky1) [27], all of which had a p-value for resistance less than 1x10-4 from the triplicate rescreen, 207

were retrieved from the deletion collection and reassessed across a range of NaD1 concentrations to 208

determine the IC50 of NaD1 against these strains. All four strains showed significant resistance to 209

NaD1 with IC50s of between 2.75 and 4 µM (relative to 2 µM for wild type) (Figure 2A). The most 210

resistant strain was agp2Δ which encodes a regulator of high affinity polyamine transport [28]. It is 211

important to note that the antifungal assays were performed at a lower cell density (OD600=0.01) 212

than the experiments outlined in the following sections (OD600=0.1-0.5). Higher concentrations of 213

NaD1 are required to achieve the same level of growth inhibition when higher cell densities are 214

used. 215

A link between polyamine transport and NaD1 induced membrane permeabilization 216

To further investigate NaD1 resistance in yeast strains with deletions of genes that function in 217

polyamine uptake, the kinetics of membrane permeabilization were monitored using a SYTOX green 218

mediated assay. Membrane permeabilization is likely downstream effect of the activity of NaD1 and 219

as such membrane permeabilization is delayed compared to other antifungal peptides for which 220

membrane disruption is the primary mode of action[21]. Consistent with the growth assays, the set 221

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

11

of NaD1 resistant strains were permeabilized more slowly by NaD1 than the wild type (Figure 2B) 222

with agp2Δ exhibiting a lower (around 20% wild type) level of SYTOX green uptake than the other 223

mutants (60-90% wild type). Agp2p is a plasma membrane protein that senses the polycation 224

spermidine and regulates the expression of proteins that transport spermidine into the cell [28]. 225

Since NaD1 is a positively charged protein, we considered whether it binds to the cell by exploiting 226

polyamine binding molecules on the surface of the cell. This was investigated by measuring NaD1 227

mediated membrane permeabilization in the presence of increasing concentrations of spermidine or 228

putrescine. Spermidine protected S. cerevisiae from membrane permeabilization by NaD1 in a 229

concentration dependent manner (Figure 3A). In contrast, putrescine had little effect on NaD1-230

induced membrane permeabilization (Figure 3B). The effect of spermidine on NaD1-induced cell 231

death was also measured (Figure 4). The addition of spermidine enhanced survival of BY4741 cells. 232

Cells treated with 100µM spermdine showed a similar level of survival as agp2Δ cells without added 233

spermidine. As with the membrane permeabilization assay, spermidine protected cells against the 234

activity of NaD1 in a concentration dependent manner. Addition of exogenous putrescine had no 235

observable effect on cell survival (data not shown). To confirm that the link between polyamines and 236

NaD1 is conserved from the model yeast to plant pathogens, membrane permeabilization assays in 237

the presence of polyamines were repeated using Fusarium oxysporum f.sp. vasinfectum. Consistent 238

with the results in S. cerevisiae, spermidine inhibited NaD1-induced membrane permeabilization in a 239

concentration dependent manner and putrescine was less effective than spermidine (Figure 3C). 240

Cells lacking Agp2p have reduced uptake of NaD1 241

In previous studies with F. oxysporum and C. albicans we demonstrated that NaD1 is transported 242

into the fungal cytoplasm as part of the mechanism for fungal cell killing [18, 19]. Confocal 243

microscopy using NaD1 labelled with the fluorophore BODIPY-FL-EDA revealed that uptake of the 244

defensin was lower in agp2Δ compared to the wildtype over a time course of 30min (Figure 5A). 245

Uptake of BODIPY-NaD1 was also measured by flow cytometry. As observed in the fluorescence 246

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

12

microscopy, uptake of BODIPY-NaD1 over 30min was lower in agp2Δ compared to the wildtype 247

BY4741 cells at all NaD1 concentrations tested (Figure 5B,C). Uptake of BODIPY-NaD1 was 248

concentration dependent in both strains and was not fully dependent on the presence of Agp2p. As 249

spermidine decreased the membrane permeabilizing activity of NaD1 the effect of spermidine on 250

NaD1 binding and uptake was assayed using a whole cell pull down followed by Western blotting to 251

detect levels of NaD1 associated with the yeast cells. Cells treated with 100 µM spermidine pulled 252

down 47.3% of the amount of NaD1 that was pulled down by untreated wild type cells. Similarly the 253

agp2Δ cells pulled down only 29.7% of the NaD1 that was associated with the untreated wild type 254

cells (Figure 5D,E,F). 255

Analysis of other polyamine transport mutants 256

To determine whether the resistance observed in agp2Δ was specific to the lack of Agp2 protein in 257

the membrane or a defect in cellular polyamine transport, the phenotype of yeast strains lacking 258

two other polyamine transport proteins, dur3Δ and sam3Δ [29], as well as the double mutants 259

dur3Δ/agp2Δ and sam3Δ/agp2Δ was investigated. The single mutants exhibited the same sensitivity 260

to NaD1 as the wild type and the double mutants had the same resistance as agp2Δ (Figure 6). That 261

is, deletion of other polyamine transporters did not enhance resistance to NaD1 in a wild type or 262

agp2Δ background. To further this line of investigation the phenotype of a sam3Δ/dur3Δ double 263

mutant was also examined. No resistance to NaD1 was observed in the sam3Δ/dur3Δ double 264

mutant compared to wild-type (Figure 8b). Interestingly, the double mutant bound less NaD1 in the 265

whole cell pull down assay despite the lack of phenotype (Figure 5 E,F). 266

Resistance of agp2Δ to other antifungal peptides 267

We hypothesized that the mechanism for the involvement of Agp2p in the activity of NaD1 was in 268

providing a binding partner through a cation binding site normally utilized for the polyamine 269

spermidine. To determine whether the interaction was specific for NaD1 we assayed agp2Δ for 270

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

13

resistance to other positively charged antifungal proteins: CP29, a cecropin–bee melittin hybrid 271

peptide variant that permeabilizes microbial membranes [30], BMAP28 a cathelcidin variant with 272

membrane permeabilizing activity [31], Bac2a a bactenicin variant that enters the cytoplasm of 273

microbial cells [32] and HBD2 a human beta defensin [33], in addition to hydrogen peroxide as a 274

control. The agp2Δ mutant was more resistant than BY4741 for every antifungal peptide tested 275

(Figure 7) but not hydrogen peroxide implicating Agp2p in the general sensitivity of S. cerevisiae to 276

cationic antifungal peptides. The lack of resistance to hydrogen peroxide indicates that this 277

resistance is specific to cationic antifungal proteins and is not merely due to an increase in general 278

fitness in the agp2Δ mutant. As we had already constructed the sam3Δ/dur3Δ double mutants we 279

also tested other AFPs against the double mutant. No resistance was observed in the double mutant 280

compared to wildtype for the panel of AFPs we tested (Figure 8). In fact the double mutant was 281

slightly more sensitive to cationic AFPs than the wildtype. 282

Cytochrome c binding in agp2Δ. 283

As agp2Δ was resistant to a range of cationic AFPs we hypothesized that the mechanism of 284

resistance was an increase in positive charge on the cell surface of the mutant cells which decreased 285

binding of cationic proteins to the cell surface. To test this hypothesis of an increase in positive 286

charge we measured binding of cytochrome c. Cytochrome c is a cationic protein (pI 10-10.5) with a 287

heme prosthetic group that absorbs at 530nm. Thus levels of cytochrome c remaining in the 288

supernatant were measured after cells were incubated with cytochrome c by measuring the 289

absorbance at 530nm. Wildtype (BY4741) cells bound to a most of the added cytochrome c whereas 290

a negligible amount of cytochrome c bound to the agp2Δ cells over the 20 min time course (Figure 291

9). 292

Discussion 293

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

14

In this paper we describe a genetic approach to identify the target molecules of the antifungal 294

defensin NaD1. The S. cerevisiae non-essential deletion collection was screened to identify strains 295

that were resistant to NaD1. An enrichment of mitochondrial genes, many of which yield a petite 296

phenotype when deleted, was found in the set of NaD1 resistant deletions. This is in agreement with 297

a previous study whereby a role for respiratory competent mitochondria and reactive oxygen 298

species in the antifungal activity of NaD1 was described [19]. In this study, a role for the plasma 299

membrane regulator of spermidine transport Agp2p was also identified and confirmed via growth 300

assays, membrane permeabilization assays, microscopy and flow cytometry. Cells lacking Agp2 were 301

resistant to NaD1 and showed decreased uptake of the labelled defensin. This decreased uptake led 302

to the conclusion that the moiety that NaD1 binds to on the cell surface is absent, down regulated or 303

modified in the absence of Agp2p or that the lack of Agp2p caused an increase in the concentration 304

of molecules that interfere with NaD1 binding to the cell surface. Resistance of agp2Δ to NaD1 was 305

more robust at earlier time points which indicates that the defensin was able to partially overcome 306

the resistance mechanism upon prolonged exposure to the fungus. Application of exogenous 307

spermidine, one of the key molecules Agp2p senses, provided protection against the antifungal 308

activity of NaD1 and decreased uptake of the defensin into yeast cells, further linking Agp2p to the 309

activity of NaD1. Spermidine also protected F. oxysporum against NaD1 which indicates that this 310

mechanism may be conserved in pathogenic fungi. Resistance of agp2Δ to other cationic antifungal 311

peptides was also observed. These observations have led us to the conclusion that polyamine 312

uptake and metabolism is linked to susceptibility of fungi to cationic antifungal proteins. 313

Spermidine is a polycationic molecule belonging to a family called polyamines that have a number of 314

biological functions including roles as plant growth factors and stress response molecules in a range 315

of organisms [34] as well as the induction of mycotoxin production in Fusarium graminearum [35]. 316

The positive charge allows polyamines to associate with polyanions such as nucleic acids and lipids 317

as well as proteins. Furthermore interactions with cellular components allow polyamines to mediate 318

a variety of intracellular processes by modulating gene expression [36]. An example of polyamine 319

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

15

mediated gene expression has been well described in Pseudomonas aeruginosa PAO1. In this system 320

exogenous spermidine induces the oprH-phoPQ operon, which encodes a membrane porin and a 321

two component regulatory system. It also induces the PA3552-PA3559 operon which functions in 322

lipopolysaccharide (LPS) modification. The end result of this altered gene expression is resistance to 323

cationic peptide antibiotics such as polymyxin B as well as aminoglycosides and quinolone antibiotics 324

[37]. As this mechanism centres on LPS, which is not present in fungi, it was eliminated as a possible 325

mechanism of resistance to NaD1 as reported here. Interestingly, polyamines are reported to have 326

the opposite effect on other antibiotics including beta-lactams where the application of exogenous 327

polyamine increases sensitivity of the bacteria [38]. 328

Three hypotheses for the role of Agp2 and polyamines in the activity of NaD1 were initially 329

considered. First, as Agp2p is a plasma membrane protein, we considered that it may be the cell 330

surface receptor for NaD1. The implication of plasma membrane polyamine binding proteins in the 331

mechanism of antifungal proteins is not unique. Histatin 5, an antifungal peptide from human saliva, 332

kills Candida albicans cells via a mechanism that involves binding to Dur3p and Dur31p which are 333

both polyamine transporters [39]. In addition, histatin 5 resistant C. glabrata strains can be made 334

sensitive to Histatin 5 by expressing the C. albicans DUR3 and DUR31 proteins [40]. Thus the first 335

hypothesis was based on similar rational as proposed for Histatin 5, that is, polyamines are positively 336

charged molecules and the proteins that bind them would possess a cation binding region. NaD1 337

also carries a positive charge and thus could bind to Agp2p on the cell surface by exploiting the 338

cation binding sites in the protein. This model fits the decreased activity of NaD1 in the presence of 339

increased spermidine as spermidine would compete with NaD1 for binding to Agp2p in the plasma 340

membrane. However, when we also considered the broad spectrum resistance of agp2Δ to cationic 341

antifungal peptides this model did not seem applicable. The sequences and structures of the other 342

AFPs tested vary significantly from each other and NaD1. NaD1 acts through a complex mechanism 343

that involves binding to the cell wall and translocation into the fungal cytoplasm. CP29 and BMAP28 344

are short, membrane permeabilizing peptides with little secondary structure. Bac2a is a short linear 345

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

16

peptide that enters the cytoplasm and kills fungal cells through a yet to be described mechanism. 346

HBD2 adopts the characteristic defensin fold and also acts through a complex mechanism. It is 347

unlikely that a group of proteins as diverse as the ones tested here would have a common binding 348

partner on the cell surface. 349

Agp2p was recently shown to regulate the expression of a large number of genes, many of which 350

encode plasma membrane transporters including those for polyamine uptake [28]. This formed the 351

basis of our second model for the role of Agp2p in the activity of cationic antimicrobial peptides. 352

Here we hypothesized that different cationic AFPs bind to different plasma membrane proteins, all 353

of which are regulated by Agp2p. This fits with the agp2Δ phenotype as in the absence of Agp2p 354

these genes are not expressed as highly. That is a decreased level of receptor protein on the cell 355

surface would underlie the resistance to cationic AFPs observed in agp2Δ. Along the same lines, 356

application of exogenous spermidine to wildtype BY4741 would cause Agp2p to signal that there was 357

adequate polyamine availability and decrease expression of the membrane binding partners. Sam3p 358

and Dur3p are the plasma membrane proteins responsible for polyamine uptake in S. cerevisiae [29] 359

and are known to be regulated by Agp2p [28] and polyamine concentration [29]. As a link between 360

polyamines and the activity of cationic AFPs had been established we examined whether the 361

resistant phenotype was observed in sam3Δ and dur3Δ mutants as these proteins are potential 362

membrane binding partners. Single sam3Δ and dur3Δ exhibited the same sensitivity to NaD1 as wild 363

type and double mutants sam3Δ/agp2Δ and dur3Δ/agp2Δ had the same level of resistance as the 364

agp2Δ single mutant. As Sam3p and Dur3p have a redundant function in polyamine transport we 365

also looked at the sam3Δ/dur3Δ double mutant and found the same NaD1 sensitivity as observed for 366

the wild type BY4741. This extended to the other cationic AFPs we tested. Sam3p and Dur3p were 367

eliminated as potential membrane binding targets of NaD1 and other cationic AFPs. However, it is 368

possible that one or more of the other membrane proteins with levels regulated by Agp2p on the 369

fungal cell surface could have functions in binding to cationic AFPs. 370

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

17

An agp2Δ strain has been previously reported to have decreased levels of spermidine uptake [27] 371

resulting from decreased expression of polyamine transporters [28]. Thus we propose a third, 372

alternate model whereby spermidine competes with cationic AFPs for negatively charged binding 373

sites on the cell surface. In the case of the agp2Δ mutant, lack of spermidine transport could lead to 374

an accumulation of spermidine on the cell surface, effectively increasing the localized concentration 375

and occupying the binding sites as would occur with the application of exogenous spermidine. 376

Polyamines have long been known to associate with negatively charged moieties in membranes and 377

shield surface charges and in some cases provide stability to the membrane [41]. This shielding of 378

binding sites by spermidine fits with the observation that agp2Δ is resistant to cationic AFPs which 379

bind to negatively charged sites on the cell surface but not hydrogen peroxide which does not need 380

to bind to charged surfaces to exert its cell killing activity. The observation that most of the other 381

AFPs tested are still active at higher concentrations suggests that there is competitive binding for the 382

cell surface sites and higher AFP concentrations out compete spermidine for these binding sites. 383

This model is also supported by the decreased binding of cytochrome c to agp2Δ. The observation 384

that decreased binding extends beyond AFPs to other cationic peptides indicates that the 385

mechanism of resistance does not relate to a characteristic specific to AFPs but is due to an increase 386

in positive charge on the cell surface that repels cationic proteins. Further investigation into the 387

mechanism by which Agp2p and polyamines influence the activities of cationic AFPs is required to 388

fully understand the biological phenomena involved. Perhaps fungal cells have evolved to maintain 389

a prophylactic shield made up of polyamines and other positively charged molecules to protect 390

against the effects of cationic antifungal peptides and lack of expression of genes controlled by 391

Agp2p leads to increased thickness and/or stability of this layer. 392

Current methods for control of fungal pathogens have encountered hurdles associated with 393

emerging resistance in fungi as well as undesirable off target toxicity. Identification of novel agents 394

for the control of pathogenic fungi is necessary to minimize the potentially catastrophic effect these 395

microorganisms could have on the world. One particularly attractive class of molecules for the 396

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

18

control of fungal pathogens is the plant defensins. The results from this study are encouraging for 397

the development of antifungal proteins such as NaD1 as molecules for combatting fungal pathogens 398

in agriculture and the clinic. Although we did identify a set of resistant strains, the level of resistance 399

was not insurmountable as full inhibition of all strains analysed was achieved by increasing the 400

concentration of protein less than 3 fold. In addition, polyamine uptake and metabolism is essential 401

for the viability of yeast and other fungi. Strains in nature that may develop mutations that mimic 402

those investigated here would be considerably less fit, as evidenced by the decreased competitive 403

fitness observed in an agp2Δ strain [42]. The likelihood of mutations causing resistance via the 404

mechanisms discussed here arising in a natural population is low. 405

Using the model yeast S. cerevisiae a link between polyamine uptake and the antifungal mechanism 406

of the plant defensin NaD1 and other cationic antifungal peptides has been established. We 407

anticipate that this also operates in other fungal pathogens and further investigation is required to 408

confirm this prediction. Elucidation of the interplay between polyamines and antifungal peptides 409

will provide information that will be crucial for the design of novel antifungal molecules. 410

411

Acknowledgements 412

This work was supported by a Discovery Project from the Australian Research Council (ARC, 413

DP120102694) to MAA and NLV and a La Trobe University Early Career Research Grant to MRB. 414

415

References 416

1. Fisher, M.C., D.A. Henk, C.J. Briggs, J.S. Brownstein, L.C. Madoff, S.L. McCraw, and S.J. Gurr, 417 Emerging fungal threats to animal, plant and ecosystem health. Nature, 2012. 484(7393): p. 418 186-94. 419

2. Pennisi, E., Armed and dangerous. Science, 2010. 327(5967): p. 804-5. 420 3. Strange, R.N. and P.R. Scott, Plant disease: a threat to global food security. Annual review of 421

phytopathology, 2005. 43: p. 83-116. 422

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

19

4. van der Weerden, N.L., M.R. Bleackley, and M.A. Anderson, Properties and mechanisms of 423 action of naturally occurring antifungal peptides. Cell Mol Life Sci, 2013. 424

5. Jones, J.D. and J.L. Dangl, The plant immune system. Nature, 2006. 444(7117): p. 323-9. 425 6. Castro, M.S. and W. Fontes, Plant defense and antimicrobial peptides. Protein and peptide 426

letters, 2005. 12(1): p. 13-8. 427 7. Thomma, B.P., B.P. Cammue, and K. Thevissen, Plant defensins. Planta, 2002. 216(2): p. 193-428

202. 429 8. Lay, F.T. and M.A. Anderson, Defensins--components of the innate immune system in plants. 430

Current protein & peptide science, 2005. 6(1): p. 85-101. 431 9. van der Weerden, N.L. and M.A. Anderson, Plant defensins: Common fold, multiple 432

functions. Fungal Biology Reviews, (0). 433 10. Aerts, A.M., I.E. Francois, E.M. Meert, Q.T. Li, B.P. Cammue, and K. Thevissen, The antifungal 434

activity of RsAFP2, a plant defensin from raphanus sativus, involves the induction of reactive 435 oxygen species in Candida albicans. Journal of molecular microbiology and biotechnology, 436 2007. 13(4): p. 243-7. 437

11. Aerts, A.M., D. Carmona-Gutierrez, S. Lefevre, G. Govaert, I.E. Francois, F. Madeo, R. Santos, 438 B.P. Cammue, and K. Thevissen, The antifungal plant defensin RsAFP2 from radish induces 439 apoptosis in a metacaspase independent way in Candida albicans. FEBS letters, 2009. 440 583(15): p. 2513-6. 441

12. Thevissen, K., P. de Mello Tavares, D. Xu, J. Blankenship, D. Vandenbosch, J. Idkowiak-Baldys, 442 G. Govaert, A. Bink, S. Rozental, P.W. de Groot, T.R. Davis, C.A. Kumamoto, G. Vargas, L. 443 Nimrichter, T. Coenye, A. Mitchell, T. Roemer, Y.A. Hannun, and B.P. Cammue, The plant 444 defensin RsAFP2 induces cell wall stress, septin mislocalization and accumulation of 445 ceramides in Candida albicans. Molecular microbiology, 2012. 446

13. Aerts, A.M., L. Bammens, G. Govaert, D. Carmona-Gutierrez, F. Madeo, B.P. Cammue, and K. 447 Thevissen, The Antifungal Plant Defensin HsAFP1 from Heuchera sanguinea Induces 448 Apoptosis in Candida albicans. Frontiers in microbiology, 2011. 2: p. 47. 449

14. Thevissen, K., I.E. Francois, J.Y. Takemoto, K.K. Ferket, E.M. Meert, and B.P. Cammue, 450 DmAMP1, an antifungal plant defensin from dahlia (Dahlia merckii), interacts with 451 sphingolipids from Saccharomyces cerevisiae. FEMS microbiology letters, 2003. 226(1): p. 452 169-73. 453

15. Spelbrink, R.G., N. Dilmac, A. Allen, T.J. Smith, D.M. Shah, and G.H. Hockerman, Differential 454 antifungal and calcium channel-blocking activity among structurally related plant defensins. 455 Plant physiology, 2004. 135(4): p. 2055-67. 456

16. Lobo, D.S., I.B. Pereira, L. Fragel-Madeira, L.N. Medeiros, L.M. Cabral, J. Faria, M. Bellio, R.C. 457 Campos, R. Linden, and E. Kurtenbach, Antifungal Pisum sativum defensin 1 interacts with 458 Neurospora crassa cyclin F related to the cell cycle. Biochemistry, 2007. 46(4): p. 987-96. 459

17. Lay, F.T., F. Brugliera, and M.A. Anderson, Isolation and properties of floral defensins from 460 ornamental tobacco and petunia. Plant physiology, 2003. 131(3): p. 1283-93. 461

18. van der Weerden, N.L., F.T. Lay, and M.A. Anderson, The plant defensin, NaD1, enters the 462 cytoplasm of Fusarium oxysporum hyphae. The Journal of biological chemistry, 2008. 463 283(21): p. 14445-52. 464

19. Hayes, B.M., M.R. Bleackley, J.L. Wiltshire, M.A. Anderson, A. Traven, and N.L. van der 465 Weerden, Identification and mechanism of action of the plant defensin NaD1 as a new 466 member of the antifungal drug arsenal against Candida albicans. Antimicrob Agents 467 Chemother, 2013. 468

20. Gaspar, Y.M., J.A. McKenna, B.S. McGinness, J. Hinch, S. Poon, A.A. Connelly, M.A. Anderson, 469 and R.L. Heath, Field resistance to Fusarium oxysporum and Verticillium dahliae in transgenic 470 cotton expressing the plant defensin NaD1. J Exp Bot, 2014. 471

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

20

21. van der Weerden, N.L., R.E. Hancock, and M.A. Anderson, Permeabilization of fungal hyphae 472 by the plant defensin NaD1 occurs through a cell wall-dependent process. The Journal of 473 biological chemistry, 2010. 285(48): p. 37513-20. 474

22. Lay, F.T., G.D. Mills, I.K. Poon, N.P. Cowieson, N. Kirby, A.A. Baxter, N.L. van der Weerden, C. 475 Dogovski, M.A. Perugini, M.A. Anderson, M. Kvansakul, and M.D. Hulett, Dimerization of 476 plant defensin NaD1 enhances its antifungal activity. J Biol Chem, 2012. 287(24): p. 19961-477 72. 478

23. Winzeler, E.A., D.D. Shoemaker, A. Astromoff, H. Liang, K. Anderson, B. Andre, R. Bangham, 479 R. Benito, J.D. Boeke, H. Bussey, A.M. Chu, C. Connelly, K. Davis, F. Dietrich, S.W. Dow, M. El 480 Bakkoury, F. Foury, S.H. Friend, E. Gentalen, G. Giaever, J.H. Hegemann, T. Jones, M. Laub, H. 481 Liao, N. Liebundguth, D.J. Lockhart, A. Lucau-Danila, M. Lussier, N. M'Rabet, P. Menard, M. 482 Mittmann, C. Pai, C. Rebischung, J.L. Revuelta, L. Riles, C.J. Roberts, P. Ross-MacDonald, B. 483 Scherens, M. Snyder, S. Sookhai-Mahadeo, R.K. Storms, S. Veronneau, M. Voet, G. Volckaert, 484 T.R. Ward, R. Wysocki, G.S. Yen, K. Yu, K. Zimmermann, P. Philippsen, M. Johnston, and R.W. 485 Davis, Functional characterization of the S. cerevisiae genome by gene deletion and parallel 486 analysis. Science, 1999. 285(5429): p. 901-6. 487

24. Giaever, G., A.M. Chu, L. Ni, C. Connelly, L. Riles, S. Veronneau, S. Dow, A. Lucau-Danila, K. 488 Anderson, B. Andre, A.P. Arkin, A. Astromoff, M. El-Bakkoury, R. Bangham, R. Benito, S. 489 Brachat, S. Campanaro, M. Curtiss, K. Davis, A. Deutschbauer, K.D. Entian, P. Flaherty, F. 490 Foury, D.J. Garfinkel, M. Gerstein, D. Gotte, U. Guldener, J.H. Hegemann, S. Hempel, Z. 491 Herman, D.F. Jaramillo, D.E. Kelly, S.L. Kelly, P. Kotter, D. LaBonte, D.C. Lamb, N. Lan, H. 492 Liang, H. Liao, L. Liu, C. Luo, M. Lussier, R. Mao, P. Menard, S.L. Ooi, J.L. Revuelta, C.J. 493 Roberts, M. Rose, P. Ross-Macdonald, B. Scherens, G. Schimmack, B. Shafer, D.D. 494 Shoemaker, S. Sookhai-Mahadeo, R.K. Storms, J.N. Strathern, G. Valle, M. Voet, G. Volckaert, 495 C.Y. Wang, T.R. Ward, J. Wilhelmy, E.A. Winzeler, Y. Yang, G. Yen, E. Youngman, K. Yu, H. 496 Bussey, J.D. Boeke, M. Snyder, P. Philippsen, R.W. Davis, and M. Johnston, Functional 497 profiling of the Saccharomyces cerevisiae genome. Nature, 2002. 418(6896): p. 387-91. 498

25. Peschel, A., M. Otto, R.W. Jack, H. Kalbacher, G. Jung, and F. Gotz, Inactivation of the dlt 499 operon in Staphylococcus aureus confers sensitivity to defensins, protegrins, and other 500 antimicrobial peptides. J Biol Chem, 1999. 274(13): p. 8405-10. 501

26. Robinson, M.D., J. Grigull, N. Mohammad, and T.R. Hughes, FunSpec: a web-based cluster 502 interpreter for yeast. BMC Bioinformatics, 2002. 3: p. 35. 503

27. Aouida, M., A. Leduc, R. Poulin, and D. Ramotar, AGP2 encodes the major permease for high 504 affinity polyamine import in Saccharomyces cerevisiae. J Biol Chem, 2005. 280(25): p. 24267-505 76. 506

28. Aouida, M., M.R. Texeira, J.M. Thevelein, R. Poulin, and D. Ramotar, Agp2, a member of the 507 yeast amino Acid permease family, positively regulates polyamine transport at the 508 transcriptional level. PLoS One, 2013. 8(6): p. e65717. 509

29. Uemura, T., K. Kashiwagi, and K. Igarashi, Polyamine uptake by DUR3 and SAM3 in 510 Saccharomyces cerevisiae. J Biol Chem, 2007. 282(10): p. 7733-41. 511

30. Friedrich, C., M.G. Scott, N. Karunaratne, H. Yan, and R.E. Hancock, Salt-resistant alpha-512 helical cationic antimicrobial peptides. Antimicrobial agents and chemotherapy, 1999. 43(7): 513 p. 1542-8. 514

31. Skerlavaj, B., R. Gennaro, L. Bagella, L. Merluzzi, A. Risso, and M. Zanetti, Biological 515 characterization of two novel cathelicidin-derived peptides and identification of structural 516 requirements for their antimicrobial and cell lytic activities. The Journal of biological 517 chemistry, 1996. 271(45): p. 28375-81. 518

32. Wu, M. and R.E. Hancock, Improved derivatives of bactenecin, a cyclic dodecameric 519 antimicrobial cationic peptide. Antimicrobial agents and chemotherapy, 1999. 43(5): p. 520 1274-6. 521

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

21

33. Schröder, J.-M. and J. Harder, Human beta-defensin-2. The International Journal of 522 Biochemistry & Cell Biology, 1999. 31(6): p. 645-651. 523

34. Takahashi, T. and J. Kakehi, Polyamines: ubiquitous polycations with unique roles in growth 524 and stress responses. Ann Bot, 2010. 105(1): p. 1-6. 525

35. Gardiner, D.M., K. Kazan, S. Praud, F.J. Torney, A. Rusu, and J.M. Manners, Early activation of 526 wheat polyamine biosynthesis during Fusarium head blight implicates putrescine as an 527 inducer of trichothecene mycotoxin production. BMC Plant Biol, 2010. 10: p. 289. 528

36. Childs, A.C., D.J. Mehta, and E.W. Gerner, Polyamine-dependent gene expression. Cell Mol 529 Life Sci, 2003. 60(7): p. 1394-406. 530

37. Kwon, D.H. and C.D. Lu, Polyamines induce resistance to cationic peptide, aminoglycoside, 531 and quinolone antibiotics in Pseudomonas aeruginosa PAO1. Antimicrob Agents Chemother, 532 2006. 50(5): p. 1615-22. 533

38. Kwon, D.H. and C.D. Lu, Polyamine effects on antibiotic susceptibility in bacteria. Antimicrob 534 Agents Chemother, 2007. 51(6): p. 2070-7. 535

39. Kumar, R., S. Chadha, D. Saraswat, J.S. Bajwa, R.A. Li, H.R. Conti, and M. Edgerton, Histatin 5 536 uptake by Candida albicans utilizes polyamine transporters Dur3 and Dur31 proteins. J Biol 537 Chem, 2011. 286(51): p. 43748-58. 538

40. Tati, S., W.S. Jang, R. Li, R. Kumar, S. Puri, and M. Edgerton, Histatin 5 Resistance of Candida 539 glabrata Can Be Reversed by Insertion of Candida albicans Polyamine Transporter-Encoding 540 Genes DUR3 and DUR31. PLoS One, 2013. 8(4): p. e61480. 541

41. Schuber, F., Influence of polyamines on membrane functions. Biochem J, 1989. 260(1): p. 1-542 10. 543

42. Breslow, D.K., D.M. Cameron, S.R. Collins, M. Schuldiner, J. Stewart-Ornstein, H.W. Newman, 544 S. Braun, H.D. Madhani, N.J. Krogan, and J.S. Weissman, A comprehensive strategy enabling 545 high-resolution functional analysis of the yeast genome. Nat Methods, 2008. 5(8): p. 711-8. 546

547

548

Percent growth inhibition Genes deleted <20 PAC10, SLS1, LPX1, ORM2, EMC6, PET494, TVP18, PTK2, YDL034W,

TRP2, YNL109W, VMA11, SPO7, MSN5, YSA1, SKY1, TUF1, KEX1, YJL120W, UPF3, MTH1, YOR200W, FUN19, AAT2 , YGP1, UBP14, TCO89, YOR379C, SUR2, YBL028C, OPI9, YGL214W, IRC21

20-40 CCS1, SEM1, FAR7, AGP2, PTC3, RPL26B, YGR269W, LDB19, RAS1, NCL1, RXT2, URE2, BRP1, RIB4, YFR012W, CBP1, RSM27, SAP185, YDL062W, FMP48, YPL182C, CTI6, YGR069W, YVC1, ARP8, YHR039C-B, DOA1, HSV2, YGL149W, MAP1, EMI2, RTK1, MRPL6, YDR290W, NAP1, CPR7, GZF3, CUE3, NAM7

40-60 YJL027C, TDH3, HIS7, YOR199W, MTC7, RGD2, UBC4, YDL063C, MRPS35

Table 1. Genes deleted in strains that were found to be resistant when screened in triplicate against 549 4µM NaD1. Only strains where all three replicates had less than 60% growth inhibition were 550 included in the resistant set. 551

552

Figure legends 553

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

22

Figure 1. Screening of the non-essential S. cerevisiae deletion collection for resistance to 4µM 554 NaD1. A. Distribution of percent growth inhibition phenotypes across the collection. Extreme 555 outliers were removed from this graph. B. Growth phenotypes of the 81 strains initially identified as 556 sensitive when re-screened in triplicate against 4µM NaD1. No growth was observed for wild type 557 (BY4741) at this concentration. Strains with growth inhibition less than 60% were considered 558 resistant. Error bars are standard deviation for each set of triplicates. 559

Figure 2. . NaD1 resistance in strains lacking components of the high affinity spermidine pathway. 560 A. Growth of deletion strains across a range of NaD1 concentrations. Less growth inhibition occurred 561 in strains lacking a component of the polyamine uptake system, sky1Δ (dotted black), brp1Δ (dotted 562 grey), ptk2Δ (dashed black) and agp2Δ (solid grey), than wild type (solid black). B. NaD1 (20µM) 563 induced membrane permeabilization of agp2Δ(solid grey) was dramatically decreased compared to 564 wildtype (solid black), membrane permeabilization kinetics of sky1Δ (dotted black), brp1Δ (dotted 565 grey) and ptk2Δ (dashed black) are intermediate compared to agp2Δ and wildtype. Error bars are 566 standard deviation of three biological replicates. The trend was consistent over a minimum of three 567 independent experiments. 568

Figure 3. Exogenous spermidine protects against membrane permeabilization by NaD1 in S. 569 cerevisiae. A. Treatment with increasing concentrations of spermidine, the preferential substrate for 570 Agp2p, decreases membrane permeabilization by 20µM NaD1 in a concentration dependent 571 manner; spermidine concentrations 100µM (solid grey), 25µM (dotted grey), 12.5µM (dotted black), 572 0µM (solid black). B. Treatment with putrescine, does not provide the same level of protection 573 against membrane permeabilization by NaD1; putrescine concentrations 100µM (solid grey), 25µM 574 (dotted grey), 12.5µM (dotted black), 0µM (solid black). C. Permeabilization of the F. oxysporum 575 plasma membrane by 20µM NaD1 in the presence of 100µM spermidine (solid grey), 12.5 µM 576 spermidine (dotted grey), 100µM putresceine (dashed black), 12.5µM putrescine (dotted black) and 577 no added polyamine (solid black). As with S. cerevisiae, permeabilization of the F. oxysporum 578 membrane by NaD1 was inhibited better by spermidine than putrescine. Data is representative and 579 consistent over a minimum of three independent replicates. 580

Figure 4. Spermidine protects S. cerevisiae against the antifungal activity of NaD1. BY4741 cells 581 were treated with 20µM NaD1 in the presence of 2 fold serial dilutions of spermidine from a top 582 concentration of 100µM. Spermidine protected BY4741 cells against the activity of NaD1 in a 583 concentration dependent manner. The activity of NaD1 on BY4741 in the presence of 100µM 584 spermidine is similar to the activity on agp2Δ. 585

Figure 5. Cells lacking the polyamine transporter Agp2p have reduced uptake of NaD1 compared 586 to wildtype. A. Time course confocal microscopy of 40µM BODIPY-NaD1 on the wildtype and agp2Δ. 587 Images are overlays of the green and DIC channel. Time points in seconds are in the top left of each 588 panel. Scale bar is 20µm. Uptake of labelled defensin was retarded in agp2Δ compared to wildtype 589 at each time point up to 36 min (2160s). B. Representative FACS histogram of BODIPY-NaD1 uptake 590 after 30min BODIPY-NaD1 concentrations are 0µM (grey), 5µM (red), 10µM (green), 20µM (blue). 591 Less defensin was taken up by agp2Δ compared to wildtype at all concentrations. C. Relative uptake 592 of BODIPY-NaD1 in wildtype and agp2Δ cells from FACS histograms; BY4741 (grey), agp2Δ (black). 593 Labelled defensin uptake was concentration dependent. Data is averaged across three independent 594 replicates and the difference between BY4741 and agp2Δ has a p-value<0.05 at all concentrations. 595 D. Anti-NaD1 Western blot of pull down experiments comparing binding of NaD1 to BY4741 in the 596 presence of 100µM spermidine(SPD), 100µM putrescine (PUT) and with no added polyamine. E. . 597 Anti-NaD1 Western blot of pull down experiments comparing binding of NaD1 to agp2Δ and 598 sam3Δ/dur3Δ to the wildtype BY4741. F. Densitometry of bands from western blot pull down. Less 599 NaD1 was pulled down by agp2Δ and the spermidine treated cells than wildtype, the double 600 mutants or the putrescine treated cells. Data is averaged across three independent experiments. 601

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

23

Figure 6. Phenotypes of polyamine transporter double mutants. Growth inhibition of single and 602 double mutants across a range of NaD1 concentrations. Single mutants dur3Δ (square) and sam3Δ 603 (triangle) have similar growth phenotypes to wild type BY4741 (diamond). Double mutants 604 dur3Δ/agp2Δ (asterisk) and sam3Δ/agp2Δ (circle) have similar growth phenotypes to agp2Δ (X). This 605 indicates that Dur3 and Sam3 do not play a role in the antifungal activity of NaD1. Error bars are 606 standard deviation of three biological replicates. The trend was consistent over a minimum of three 607 independent experiments. 608

Figure 7. Resistance of agp2Δto other cationic antifungal proteins. Growth inhibition of wildtype 609 BY4741 (black) and agp2Δ (grey) when incubated with increasing concentrations of H2O2 (A), NaD1 610 (B), Bac2a (C), BMAP28 (D), CP29 (E) and HBD2 (F). Resistance in agp2Δ is observed for all cationic 611 peptides but not for H2O2. 612

Figure 8. Susceptibility of sam3Δ/dur3Δ to cationic antifungal peptides. Growth inhibition of 613 wildtype BY4741 (black) and sam3Δ/dur3Δ (grey) when incubated with increasing concentrations of 614 H2O2 (A), NaD1 (B), BMAP28 (C) and CP29 (D). The double mutant is slightly sensitive to NaD1, 615 CP29and H2O2 and there is no difference in susceptibility to BMAP28. 616

Figure 9. Cytochrome c binding to BY4741 and agp2Δ. Cytochrome c is a cationic protein with an 617 absorption maximum at 530 nm. Cells were incubated with 0.5mg/mL cytochrome c for 20min and 618 pelleted. Levels of cytochrome c remaining in the supernatant were estimated 619 spectrophotometrically at 530nm. The supernatant from BY4741 cells contained less cytochrome c 620 than the supernatant from agp2Δ cells which were not found to bind much more cytochrome c than 621 the buffer control with no cells. 622

623

624

625

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on February 20, 2018 by guest

http://aac.asm.org/

Dow

nloaded from