1 the following Micro-RNA sequence into ox Fold and look at the results Using MFold MFold to predict RNA secondary structure http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAG CAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC

1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Download PPT Report

Upload
brent-oneal
View
222
Download
3

Embed Size (px)

Citation preview

Enter the following Micro-RNA sequence into the box

Run MFold and look at the results

Using MFoldMFold to predict RNA secondary structure

http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form

GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC

Page 2: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Constraint information

• Force bases 30-35 to be single stranded

• Is the result different?

Page 3: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

PSIPRED (Protein Structure Prediction Server)Secondary Structure Prediction

http://bioinf.cs.ucl.ac.uk/psipred/

1. Use the protein NP_360043.2. Paste the sequence without

the header line.3. Enter your UH email

address.4. Click the Predict button.5. View the results.

Page 4: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Coil Beta Strand

Helix

Page 5: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Coil

Beta StrandHelix

Page 6: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

3-D structures

Page 7: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Retrieving and displaying a 3-D structure from PDB http://www.rcsb.org/pdb/

1. Enter the protein's name and click search2. View the protein with KiNG viewer3. Examine the information and links to

other databases

Page 8: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Page 9: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Protein visualization with FirstGlance in Jmol http://molvis.sdsc.edu/fgij/

Page 10: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Secondary Structure Alpha Helices Beta strands Random coils

Page 11: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

MMDB

• NCBI's structure database is called MMDB (Molecular Modeling DataBase), and it is a subset of experimentally derived three-dimensional structures obtained from the Protein Data Bank (PDB) (excluding theoretical predictions)

• http://www.ncbi.nlm.nih.gov/Structure/MMDB/mmdb.shtml

Page 12: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

VAST

• NCBI creates and maintains a database of structure alignments, called VAST, for all pairs of proteins from MMDB whose structures have some similar core regions. They are called “Structural neighbors”.

• http://www.ncbi.nlm.nih.gov/Structure/VAST/vast.shtml

Page 13: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Example

• Type "1D5R" in the query box and hit "Get." This brings up the MMDB summary page.

Page 14: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Page 15: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

• The graphic is saying that the protein is composed of a single chain (A) that NCBI has parsed into two domains: the N-terminal domain 1, and C-terminal 2. Clicking on the top bar marked "Chain A" will bring up VAST neighbors based on the whole chain, while clicking on the colored regions marked "1" or "2" will show neighbors of these individual domains.

Page 16: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Page 17: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Click on the “1” domain to get proteins that consists of a similar structure like the PTPc domain

Page 18: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Lets view the "3D Alignment” of 1D5R:A with 2BZL:A using the CE tool http://cl.sdsc.edu/ce.html

Crystal Structure Of The Human Protein Tyrosine Phosphatase N14 At 1.65 A Resolution

Page 19: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Page 20: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

Page 21: 1 Enter the following Micro-RNA sequence into the box Run MFold and look at the results MFold Using MFold to predict RNA secondary structure

The two sequences have a 20.7% sequence similarity. The root mean square deviation (RMSD) in terms of structural distance is 2.47. Now lets compare hemoglobin A (4HHB:A) and B (4HHB:B)?