46
1 DNA & Protein DNA & Protein Synthesis Synthesis From Gene to Protein From Gene to Protein

1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

Embed Size (px)

Citation preview

Page 1: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

1

DNA & Protein DNA & Protein SynthesisSynthesis

From Gene to ProteinFrom Gene to Protein

Page 2: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

2

Nucleic Acids and Protein Nucleic Acids and Protein SynthesisSynthesis

• All functions of a cell are All functions of a cell are directed from some central directed from some central form of information form of information (DNA).(DNA).

• This "biological program" is This "biological program" is called the called the Genetic CodeGenetic Code..

• This is the way cells This is the way cells store store informationinformation regarding their regarding their structure and function.structure and function.

Page 3: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

3

History of DNAHistory of DNA

Composition and Composition and StructureStructure

Page 4: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

4

HistoryHistory• For years the source of heredity For years the source of heredity

was unknown. This was resolved was unknown. This was resolved after numerous studies and after numerous studies and experimental research by the experimental research by the following researchers:following researchers:

• Fredrick GriffithFredrick Griffith– He was studying effects of He was studying effects of 22

strains of an infectious bacteriastrains of an infectious bacteria, , the "the "smoothsmooth" strain was found " strain was found to cause pneumonia & death in to cause pneumonia & death in mice. The "mice. The "roughrough" strain did " strain did not. He conducted the following not. He conducted the following experimentexperiment

Page 5: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

5

Griffith ExperimentGriffith ExperimentBacteria Strain Bacteria Strain injected into injected into

mousemouse

ResultResult

Smooth StrainSmooth Strain Mouse Mouse diesdies

Rough strainRough strain Mouse Mouse LivesLives

Heat-Killed Smooth Heat-Killed Smooth strainstrain

Mouse Mouse liveslives

Rough Strain & Heat Rough Strain & Heat killed smooth strainkilled smooth strain

*MOUSE *MOUSE DIES*DIES*•The The last condition was

unusual, as he predicted as he predicted that the mouse should livethat the mouse should live•Concluded that some Concluded that some unknown substance was unknown substance was

TransformingTransforming the rough the rough strain into the smooth onestrain into the smooth one

Page 6: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

6

Avery, McCarty & MacLeodAvery, McCarty & MacLeodWas it protein Was it protein or DNA?or DNA?

•They Degraded chromosomes with enzymes that destroyed proteins or DNA•The Samples with Proteins destroyed would still cause transformation in bacteria indicating genetic material was DNA

Tried to determine the nature of this transforming agent.

Page 7: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

7

Hershey-ChaseHershey-Chase • ONE virus was ONE virus was

radioactivelyradioactively "tagged" with "tagged" with 3232P on P on it's DNAit's DNA

• The OTHER was The OTHER was "tagged" "tagged" 3535S on it's S on it's protein coat.protein coat.

• Researchers found Researchers found the radioactive P in the radioactive P in the bacteria, the bacteria, indicating it is DNA, indicating it is DNA, not protein being not protein being injected into injected into bacteriabacteria. .

Page 8: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

8

Watson & CrickWatson & Crick• The constituents of DNA The constituents of DNA

had long been known. had long been known. Structure of DNA, Structure of DNA, however was nothowever was not..

• In In 1953, Watson & Crick1953, Watson & Crick published findings published findings based on based on X-ray analysis X-ray analysis (Rosalind Franklin(Rosalind Franklin) and ) and other data that DNA other data that DNA was in the form of a was in the form of a "Double Helix". "Double Helix".

• Their findings show us Their findings show us the basic structure of the basic structure of DNA which is as follows.DNA which is as follows.

Page 9: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

9

DNA StructureDNA Structure

The Double HelixThe Double Helix

Page 10: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

10

DNA StructureDNA Structure

DNA is Formed of in a "DNA is Formed of in a "Double HelixDouble Helix" - " - like a spiral staircase like a spiral staircase

Page 11: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

11

NucleotidesNucleotides• DNA is formed DNA is formed

by by NucleotidesNucleotides• These are made These are made

from three from three components:components:

1.1.5-Carbon or 5-Carbon or pentose Sugarpentose Sugar

2.2.Nitrogenous Nitrogenous basebase

3.3. PhosphatePhosphate group group

Page 12: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

12

Types of NucleotidesTypes of Nucleotides• For DNA There are 4 different Nucleotides

categorized as either Purines (Double rings) or Pyrimidines (Single ring). These are usually represented by a letter. They Are:1. Adenine (A)2. Cytosine (C)3. Guanine (G)4. Thymine (T)

Guanine

Page 13: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

13

Base PairingBase Pairing• Each Each "Rung""Rung" of the DNA "staircase" is formed by the linking of 2 of the DNA "staircase" is formed by the linking of 2

Nucleotides through Nucleotides through Hydrogen BondsHydrogen Bonds..• These Hydrogen bonds form only between specific Nucleotides. This is These Hydrogen bonds form only between specific Nucleotides. This is

known as known as Base PairingBase Pairing. The rules are as follows:. The rules are as follows:– Adenine (A) will ONLY bond to Thymine (T) (by 2 hydrogen Adenine (A) will ONLY bond to Thymine (T) (by 2 hydrogen

bonds)bonds)– Cytosine (C) will ONLY bond to Guanine (G) (by 3 hydrogen Cytosine (C) will ONLY bond to Guanine (G) (by 3 hydrogen

bonds)bonds)

Page 14: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

14

Central Dogma of Central Dogma of GeneticsGenetics

DNA to Protein DNA to Protein SynthesisSynthesis

Page 15: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

15

Central Dogma of GeneticsCentral Dogma of Genetics• Central DogmaCentral Dogma holds that genetic information is expressed holds that genetic information is expressed

in a specific order. This order is as followsin a specific order. This order is as follows

There are some apparent exceptions to this.There are some apparent exceptions to this.Retroviruses (eg. HIV) are able to synthesize Retroviruses (eg. HIV) are able to synthesize

DNA from RNADNA from RNA

Page 16: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

16

DNA ReplicationDNA Replication• DNA has unique DNA has unique ability to ability to

make copies of itselfmake copies of itself• The process is called The process is called DNA DNA

Replication.Replication.• First, the enzyme First, the enzyme HelicaseHelicase

unwinds the parental DNAunwinds the parental DNA• DNA DNA "Unzips itself""Unzips itself" by by

breaking the weak hydrogen breaking the weak hydrogen bonds between base pairs bonds between base pairs forming two forming two TEMPLATE TEMPLATE strands strands with exposed Nucleotideswith exposed Nucleotides

Page 17: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

17

DNA ReplicationDNA Replication• The place where helicase The place where helicase

attaches and opens DNA is attaches and opens DNA is called the called the Replication ForkReplication Fork

REPLICATION FORKREPLICATION FORK

Page 18: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

18

DNA ReplicationDNA Replication• Helicase enzymes may Helicase enzymes may attach attach

to multiple sites on the DNA to multiple sites on the DNA strandstrand forming forming Replication Replication BubblesBubbles which makes which makes replication fasterreplication faster

Page 19: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

19

DNA ReplicationDNA Replication

• Single-strand binding proteinsSingle-strand binding proteins attach & STABILIZE the 2 attach & STABILIZE the 2 parental strandsparental strands

• DNA polymeraseDNA polymerase attaches to attaches to the 3’ end of the 5’ to 3’ the 3’ end of the 5’ to 3’ parental strandparental strand

• DNA polymerase attaches DNA polymerase attaches FREE FREE nucleotides to the nucleotides to the complementary nucleotidecomplementary nucleotide on on the parental DNA the parental DNA

• This new strand is synthesized This new strand is synthesized continuously 5’ to 3’ continuously 5’ to 3’ (LEADING)(LEADING)

Page 20: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

20

Replication BubbleReplication Bubble

Origin of Replication

Origin of Replication

DNA is synthesized from the Origin of Replication within a replication bubble

•Towards fork – continuous replication

•Away from fork – discontinuous replication (fragments)

Page 21: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

21

DNA ReplicationDNA Replication

Since Since DNA DNA polymerase can polymerase can only add only add nucleotides to the nucleotides to the 3’3’ end of the end of the parental strand, parental strand, the parental 5’ to the parental 5’ to 3’ strand must be 3’ strand must be replicated in replicated in fragmentsfragments that that must later be must later be joined together joined together (LAGGING)(LAGGING)

Page 22: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

22

Page 23: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

23

DNA ReplicationDNA Replication

• Transcription proceeds Transcription proceeds continuouslycontinuously along the 5' along the 5'3' 3' direction (This is called the direction (This is called the leading strand)leading strand)

• Proceeds in Proceeds in fragmentsfragments in the in the other direction (called the other direction (called the lagging strandlagging strand) in the ) in the following wayfollowing way

• RNA primer is attached to a RNA primer is attached to a segment of the strand by the segment of the strand by the enzyme enzyme primaseprimase..

Page 24: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

24

DNA ReplicationDNA Replication

• Transcription now continues Transcription now continues in the 5'in the 5'3' direction forming 3' direction forming an an okazakiokazaki fragmentfragment. Until it . Until it reaches the next fragment.reaches the next fragment.

• The two fragments are joined The two fragments are joined by the enzyme by the enzyme DNA ligaseDNA ligase

• Two, new, identical Two, new, identical DNA DNA strands are now formedstrands are now formed

Page 25: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

25

DNA ReplicationDNA Replication

Page 26: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

26

Protein SynthesisProtein Synthesis

Transcription and Transcription and TranslationTranslation

Page 27: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

27

RNA TranscriptionRNA Transcription• The The cell does not directly use cell does not directly use

DNA to control the function DNA to control the function of the cell.of the cell.

• DNA is too precious and must be DNA is too precious and must be kept protected within the kept protected within the nucleus.nucleus.

• The The Cell makes a working Cell makes a working "Photocopy" of itself"Photocopy" of itself to do the to do the actual work of making proteins.actual work of making proteins.

• This copy is called This copy is called Ribonucleic Ribonucleic Acid or RNAAcid or RNA..

• RNA differs from DNARNA differs from DNA in in several important ways.several important ways.1.1. It is much It is much smallersmaller2.2. It is It is single-strandedsingle-stranded3.3. It does NOT contain It does NOT contain

ThymineThymine, but rather a new , but rather a new nucleotide called nucleotide called UracilUracil which will bind to Adeninewhich will bind to Adenine

4.4. Contains Contains riboseribose, not , not deoxyribose sugardeoxyribose sugar

Page 28: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

28

RNA TranscriptionRNA Transcription• RNA is produced through a process called RNA is produced through a process called RNA RNA

TranscriptionTranscription..• Similar to DNA Replication.Similar to DNA Replication.• Small area of DNA "Unzips"Small area of DNA "Unzips" exposing Nucleotides exposing Nucleotides• This area is acted on by an enzyme called This area is acted on by an enzyme called RNA RNA

PolymerasePolymerase, which binds nucleotides (using uracil) to , which binds nucleotides (using uracil) to their complementary base pair.their complementary base pair.

• This releases a long strand of This releases a long strand of Messenger RNA (mRNAMessenger RNA (mRNA)) which is an important component ofwhich is an important component of protein synthesis.protein synthesis.

Page 29: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

29

RNA TranscriptionRNA Transcription

Page 30: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

30

Protein Synthesis & The Protein Synthesis & The Genetic CodeGenetic Code

• The The Sequence of nucleotides in Sequence of nucleotides in an mRNAan mRNA strand determine the strand determine the sequence of amino acids in a sequence of amino acids in a proteinprotein

• Process requires Process requires mRNA, tRNA & mRNA, tRNA & ribosomes ribosomes

• Polypeptide chainsPolypeptide chains are are synthesized by linking synthesized by linking amino acidsamino acids together with together with peptide bondspeptide bonds

Page 31: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

31

mRNAmRNA• Each three Each three Nucleotide Nucleotide sequence in an sequence in an mRNA strand is mRNA strand is called a "called a "CodonCodon““

• Each Codon Each Codon codes for a codes for a particular amino particular amino acid.acid.

• The codon The codon sequence codes sequence codes for an amino for an amino acid using acid using specific rules. specific rules. These specific These specific codon/amino codon/amino acid pairings is acid pairings is called the called the Genetic CodeGenetic Code. .

Page 32: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

32

tRNAtRNA

•There is a special form There is a special form of RNA called of RNA called Transfer Transfer RNA or tRNA.RNA or tRNA.•Each tRNA has a 3 Each tRNA has a 3 Nucleotide sequence on Nucleotide sequence on one end which is known one end which is known as the "as the "AnitcodoAnitcodonn""•This Anticodon This Anticodon sequence sequence is is complimentary to the complimentary to the Codon sequence found Codon sequence found on theon the strand of mRNAstrand of mRNA•Each tRNA can bind Each tRNA can bind specifically with a specifically with a particular amino acid.particular amino acid.

Page 33: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

33

RibosomeRibosome• Consists of two Consists of two

subunits made of subunits made of protein & rRNAprotein & rRNA– Large subunitLarge subunit– Small subunitSmall subunit

• Serves as a Serves as a template or template or "work station""work station" where protein where protein synthesis can synthesis can occur.occur.

Page 34: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

34

Protein SynthesisProtein Synthesis• First, an First, an mRNA strand binds to the large & mRNA strand binds to the large &

small subunits of a ribosomesmall subunits of a ribosome in the cytosol in the cytosol of the cellof the cell

• This occurs at the This occurs at the AUG (initiation) codonAUG (initiation) codon of of the strand.the strand.

• The ribosome has The ribosome has 3 binding sites3 binding sites for codons for codons --- --- EE (exit site), (exit site), PP, and , and AA (entry site for new (entry site for new tRNA)tRNA)

• The ribosome moves along the mRNA strandThe ribosome moves along the mRNA strand

Page 35: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

35

Protein SynthesisProtein Synthesis• An An anticodon on tRNA binds to a anticodon on tRNA binds to a

complementary codon on mRNA.complementary codon on mRNA.• The tRNA carrying an amino acid The tRNA carrying an amino acid enters the enters the

A site on the ribosomeA site on the ribosome• The ribosome moves down the mRNA so the The ribosome moves down the mRNA so the

tRNA is now in the P sitetRNA is now in the P site and another tRNA and another tRNA enters the A siteenters the A site

• A A peptide bondpeptide bond is formed between the amino is formed between the amino acids and the ribosome moves down againacids and the ribosome moves down again

• The The first tRNA is releasedfirst tRNA is released, and another tRNA , and another tRNA binds next to the second, another peptide binds next to the second, another peptide bond is formed.bond is formed.

• This process continues until a stop codon This process continues until a stop codon (UAG…) is reached.(UAG…) is reached.

• The completed polypeptide is thenThe completed polypeptide is then released.released.

Page 36: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

36

Protein SynthesisProtein Synthesis

Page 37: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

37

Page 38: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

38

Replication ProblemReplication Problem

• Given a DNA strand with the Given a DNA strand with the following nucleotide sequence, following nucleotide sequence, what is the sequence of its what is the sequence of its complimentary strand?complimentary strand?

• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’5’

Page 39: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

39

AnswerAnswer

• Given a DNA strand with the Given a DNA strand with the following nucleotide sequence, following nucleotide sequence, what is the sequence of its what is the sequence of its complimentary strand?complimentary strand?

• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’5’

• 5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT 5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3’-3’

Page 40: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

40

RNA Transcription ProblemRNA Transcription Problem

• Given a DNA strand with the Given a DNA strand with the following nucleotide sequence, following nucleotide sequence, what is the sequence of its what is the sequence of its complimentary mRNA strand?complimentary mRNA strand?

• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’5’

Page 41: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

41

ANSWERANSWER

• Given a DNA strand with the Given a DNA strand with the following nucleotide sequence, following nucleotide sequence, what is the sequence of its what is the sequence of its complimentary mRNA strand?complimentary mRNA strand?

• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’• 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

Page 42: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

42

Codon / AnticodonCodon / Anticodon

• Given a mRNa strand with the Given a mRNa strand with the following nucleotide sequence, what following nucleotide sequence, what are the sequence (anticodons) of its are the sequence (anticodons) of its complimentary tRNA strands?complimentary tRNA strands?

• 3’- 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’5’

Page 43: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

43

AnswerAnswer

Given a mRNA strand with the following Given a mRNA strand with the following nucleotide sequence, what are the sequence nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands?(anticodons) of its complimentary tRNA strands?

• 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’• 3’ – UACCACGUGGAUGAGGACUCCUCUUCAGA -5’3’ – UACCACGUGGAUGAGGACUCCUCUUCAGA -5’

Page 44: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

44

Protein TranslationProtein Translation

• Given the Given the following following sequence of sequence of mRNA, what is mRNA, what is the amino acid the amino acid sequence of the sequence of the resultant resultant polypeptide?polypeptide?

• AUGGUGCACCUGAUGGUGCACCUGACUCCUGAGGAGACUCCUGAGGAGAAGUCUAAGUCU

Page 45: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

45

Protein Translation / AnswerProtein Translation / Answer

• Given the Given the following following sequence of sequence of mRNA, what is mRNA, what is the amino acid the amino acid sequence of the sequence of the resultant resultant polypeptide?polypeptide?

• AUGGUGCACCUGAUGGUGCACCUGACUCCUGAGGAGACUCCUGAGGAGAAGUCUAAGUCU

Met-val-his-leu-thr-pro-glu-glu-lys-serMet-val-his-leu-thr-pro-glu-glu-lys-ser

Page 46: 1 DNA & Protein Synthesis From Gene to Protein. 2 Nucleic Acids and Protein Synthesis All functions of a cell are directed from some central form of information

46