1 5,466 6,938 bp Forward Primer Reverse Primer

zebrafish sorl1 gene

Evolution and Expression of an Alzheimer’s Disease Associated Gene, sorl1 in Zebrafish

Elizabeth Horst and Dr. Wendy Boehmler Department of Biology, York College of Pennsylvania

INTRODUCTION• Alzheimer’s Disease (AD) is characterized by the aggregation of senile plaques in the brain that cause deterioration of mental functions.

• Decreased sorl1 expression has been shown to increase pathogenesis of AD (Rogaeva 2007).

• Aside from its role in amyloid-ß-peptide plaque recycling, little is known about the role of sorl1 in the brain.

• Genes involved in neurodegeneration may also play a role in neurodevelopment (Bothwell and Giniger 2000).

• The advantages to characterizing genes in zebrafish are their rapid development, translucent embryos, large clutches, and the development of in situ hybridization and morpholino knockdown techniques.

OBJECTIVES1) What tissues show sorl1 gene

expression in the adult? (Figure 1)

2) What is the evolutionary relationship between the zebrafish sorl1 gene and other organisms’ sorl1 gene? (Table 1)

3) What is the spatio-temporal expression pattern of sorl1 in zebrafish embryos?

(Figures 3 & 4)

METHODS

RESULTS CONCLUSIONS• Using PCR it was determined that sorl1 is present in the brain, eye, gut, heart, and muscle tissue of zebrafish.

• Using bioinformatics, sorl1 was located on chromosome 15 of zebrafish and 11 in humans. These two chromosomes share many similar genes demonstrating synteny.

• In situ shows where sorl1 is being expressed spatially and temporally in development.

FUTURE EXPERIMENT• Determine the neurodevelopmental function of sorl1 using morpholino knockdown of sorl1. Insights into the functional role of sorl1 may lead to development of therapeutics for neurodegenerative disorders.

REFERENCESBothwell, M. and E. Giniger. 2000. Alzheimer’s disease: neurodevelopment converges with neurodegeneration. Cell 102:271-273.

Rogaeva, E., Meng, Y., Lee, J. H., Gu, Y., Kawarai, T., Zou, F., Katayama, T., Baldwin, C. T., Cheng, R., Hasegawa, H., Chen, F., Shibata, N., Lunetta, K. L., Pardossi-Piquard, R., Bohm, C., Wakutani, Y., Cupples, L. A., Cuenco, K. T., Green, R. C. and L. Pinessi. 2007. The neuronal sortilin-related receptor sorl1 is genetically associated with Alzheimer disease. Nature Genetics 39:168-177.

Woods, I. G., Wilson, C., Friedlander, B., Chang, P., Reyes, D. K., Nix, R., Kelly, P. D., Chu, F., Postlethwait, J. H., and W. S. Talbot. 2005. The zebrafish gene map defines ancestral vertebrate chromosomes. Genome Research 15:1307-1314. Available from: Google scholar. Accessed 2009 March 23.

Figure 1. Tissue panel showing RT-PCR results. The primers used were forward (AGTGAAGATGATCCCAGATG) and reverse (CTACGCAATGACCATCGGGAC) primers made for a 900 bp section of the 3’ end of sorl1. This shows that sorl1 is present in brain, eye, gut, heart and muscle tissue.

Table 1. Syntenic relationship between human chromosome 11 and zebrafish chromosome 15 supporting an evolutionary link between humans and zebrafish.

ACKNOWLEDGEMENTSI thank the Pennsylvania Academy of Science for their generous research grant that is funding this ongoing research. Special thanks to Dr. Wendy Boehmler for her advice and support in this research.

5’ 3’

Brain Eye Gut Heart Muscle

Figure 2. p-Drive vector containing a 900 bp fragment of the zebrafish sorl1 gene. Plasmid was linearized and T7 promoter used to synthesize antisense RNA probe for whole-mount in situ hybridization on zebrafish embryos.

sorl1900 bp segment

5’ end at M13 forward

3’ end at M13 reverse

pDriveCloningVector

Ampicillin Resistance

T7 promoter

Collect mRNA from several zebrafish organs use RT-PCR to evaluate where sorl1 is present

Clone gene into p-drive vector

900 bp

Gene Name Zebrafish Chromosome

Human Chromosome

sorl1 15 11

mre11a 15 11

spcs2 15 11

mgc10485 15 11

cryab 15 11

acad8 15 11

hsp47 15 11

or13.1 15 11

sesn3 15 11

tyr 15 11

clsc 15 11

loc196264 15 11

Figure 4. Lateral view of a 48 hour embryo. Note the darker staining in the midbrain-hindbrain boundary as well as in the spinal cord. Also notice the absence of staining in the forebrain, midbrain or yolk.

E-eye, F-forebrain, M-midbrain, H-hindbrain, Y-yolk, T-tail,MH-midbrain-hindbrain barrier

Figure 3. Lateral view of 24 hour embryo. Note the staining in the forebrain, midbrain and hindbrain regions. There is an absence of staining in the yolk or tail.

F-forebrain, M-midbrain, H-hindbrain, Y-yolk, T-tail

In situ hybridization

F

M H

Y

T

F M

MH

HE

Y

T

http://news.stanford.edu/news/2007/october17/med-fishsleep-101707.htmlhttp://www.healthhabits.ca/2008/09/29/is-your-diet-giving-you-alzheimers-disease/