1 2 3 Study Of Integrons In Helicobacter Pylori Isolated From Biopsy of Dyspepsia Paitents By PCR Method Peter M.Bennett: integrons and gene cassettes 4 5 HISTORY OF SPIRAL ORGANISMS IN THE HUMAN STOMACH 1893 Bizzozero 1981/1982 Marshall and Warren 1982 successful culture 1987 Campylobacter pylori 1989 New genus: Helicobacter pylori 1994 who classifies H.pylori as a group 1 carcinogen 2005 nobel prize Helical or curved gram negative rods. O microns wide and microns long microaerophilic Urease + Oxidase + Catalase + Motility is possitive by multiple unpolar flagella 7 H.pylori is one of the most common bacterial infection About 50% of the world population have helicobacter In different parts of iran h.pylori is about 70-90% prevalence Infection is most commonly acquired in childhold and transmission occurs by person-to-person contact, oral- oral and fecal-oral routes. 8 Epidmiology Chronic gastritis Peptic ulcer disease(PUD) Gastric malignancy Gastric adenocarcinoma Extragastric disease 9 Urease Catalase Superoxide dismutase Flagella Cytotoxin associated gene(cagA) Vacuolating cytotoxin(vacA) adhesins 10 Treatment rate of H.pylori in Iran is much lower than the rate reported from western countries Quadruple therapy comprising a proton pump inhibitor(PPI),bismuth and 2antimicrobial agents. 11 First line : Furazolidone or clarithromycin, amoxicillin,bismuth subcitrate and omperazol for 2 weeks Second line: Furazolidone,tetracyclin,subcitrate and omperazol for 2 weeks Third line : choose the antibiotic regimen according to culture and drug susceptibility testing. 12 13 T: tetracycline C: clarithromycin M:metronidazole A: amoxicillin F:fuorazolidon resistant to metronidazoles. clarithromycin and dual resistance were 37.8%. 13.8% and 8.7% respectively in china (wai man wong and et al (2000) Resistance to metronidazol was high (77.3%), amoxicillin(71.9%) and clarithromycin (58.8%). H.WU, X.D.Sh in china (2008). in Iran resistance to metronidazoles and clarithromycin were 37.5 % and 28% respectively (2000 siavoshi and et al). In isfahan resistance to metronidazole,ciproflowacin, clarithromycin were 30%,8,75%and 6.25% (2008 reza khashei and et at) Resistance rates to metronidazole, clarithromycin, were 64% and 23%,respectively(2010 haghi and et at) The prevalences of resistance of H. pylori strains isolated from the patients were 73.4% for metronidazole, 30% for clarithromycin, 6.8% for amoxicillin, and 9% for tetracycline(2010 talebi and et at tehran 14 Resistance may be innate (naturally resistant) Resistance may be acquired 15 1.Altered cell permeability 2.Enzymatic inactivation of the antibiotic 3.Modification of antibiotic target site 4.Synthesis of a resistant metabolic pathways 16 Acquired Resistance 17 I. Bacteria can transfer genetic information to themselves with protection against most antibiotics II. Ecoli strains efficiently exchange genetic material with pathogens such as Salmonella,Shigella,Yersinia,and Vibrio species as well as pathogenic Ecoli III. The acquisition of resistance gene arrays involves genetic mobile elements like A. Plasmids B. Transposons C. integrons 18 I. Integrons were defined by Hall & Collis in 1989 II. The first prevalence integrons were reported in 1990 III. The first 3D structure of an integron were presented in Structure 1. Conserved region 1. Conserved region (intI,5`CS,3`CS) A. Integrase gene (intI) encoding an integrase B. Recombination site (attI) C. Promoter (P int) is part of the 5`CS D. Promoter C 2. Variable region 2. Variable region (gene cassette) A. Attc 20 21 A. Target site for integration of gene cassettes B. Specific recombination site C. Termed base element D. It is adjacent to the intI gene 22 3 Conserved segment attI1attC Cassette (s)intIqacEsul P ORF 5Conserved Segment I. Definition: A. Is located downstream of the gene in each cassette II. Size: A. vary considerably both in length (from57-141b)and in sequence 23 3 Conserved segment attI1attC Cassette (s)intIqacEsul P ORF 5Conserved Segment I. Definition: A. Belong to the tyrosine recombinase family B. The tyrosine family members comprise of aa II. Structure: A. N-terminal domain of intI were required for binding to both forms of attI and attC B. C-terminal is the catalytic domain More than 40 different types of integron integrase have been identified 24 3 Conserved segment attI1attC Cassette (s)intIqacEsul P ORF 5Conserved Segment A. Gene cassette is mobile component of the integron system B. Consist of a coding sequence which usually lacks a promoter C. It doesn't encode the protein that catalyzed its own movement D. Over to 80cassettes have been identified I. Size A. Cassettes exhibit variable size 260bp-1500bp but have common structure 25 chromosome plasmid integron resistance gene cassette integrase Resistance gene expressed transposon 26 Several classes of integrons have been described according to the sequence of intI gene Four classes are known today Three classes of them are well characterized and are involved in antibiotic resistance 27 3 Conserved segment attI1attC Cassette (s)intIqacEsul P ORF 5Conserved Segment I. Class 1: A. Are the most prevalent integrons and were the first described B. Widely spread among gram-negative species C. Acinetobacter,Escherichia coli.Shigella Salmonella,Serratia D. conserved 3`CS their contain the qacE 28 II. Class 2: A. Integron class2 are embedded in the Tn7 family B. Acinetobacter, Shigella, Salmonella III. Class 3: A. Were originally found on a transferable large plasmid in Serratia marcescens B. Carry the Metallo-beta-lactamase gene C. Psuedomonas, Serratia,klebsiella 29 IV. Class4: A. Was found in Vibrio cholerae chromosome B. Named Super integron C. Contain at least 216 gene in 179 cassettes with unknown functions 30 Structure of multiresistant integrons (MRI) 5Conserved Segment 3 segment attI1attC Cassette (s) Class 1 Class 2 Class 3 attI3 attI2 intI3 intI1 intI2 qacE1sul1ORF5 tns genes P1P2 P P ORFXaadA1satdfrA1 32 400 urease positive biopsi specimens were transported to the Microbiology lab. during a period of 5 months. Dr.m.khani poor roshan 34 35 Of each patients 2 biopsy were taken; one for RUT and the second sample for culture which were transported to the laboratory in the cold box at 4C within 2 Hours. 36 Samples were cultured on Brucella agar supplemented with campylobacter selective reagent and 5% sheep blood and incubated at 37 in 10 % CO2 and 5% O2 for 3-5 days I. Preparation of bacterial DNA were extracted by phenol chloroform method. 37 A. Integrons were detect with degenerated primers to conserve regions of integron encoded integrase genes intI1, intI2 and intI3. B. Primers used were hep35(F) and hep36(R) Hep 35(5`TGCGGGTTAAGGATCTGGATTT3` ) hep 36( 5`CATCACATGCGTTTATAT3`) 38 3 Conserved segment attI1attC Cassette (s)intIqacEsul P ORF 5Conserved Segment materialVolume(l) Final cocentration dNTPs mM mgCl mM PCR buffer 2.51X Primer hep Pm Primer hep Pm Taq polymerase unit dd H 2 O DNA template 5- - Final volume 40ProgramStepDefinite Temperat ure TimeCycleProg.11 Initial denaturation 95 c 5 min 1 Prog.2123DenaturateAnnealingExtension 94 c 55 c 72 c 30s30s45s Prog.31 Final extension 72 c 10 min 1 GEL PREPARATION Seal the ends of the gel tray securely with strips of colored lab tape. 2. Position the comb over the gel tray. 3. Mix agarose and melt in microwave oven. 4. When agarose is completely dissolved, allow to cool slowly. 5. After agarose has cooled to about 60C, pour the agarose into the gel tray. 6. Allow the gel to solidify at room temperature for about 1 hour. 7. Place the tray into the gel box containing buffer. 42 Results observation Gel Electrophoresis An electrophoresis chamber and power supply Gel casting trays Sample combs Electrophoresis buffer Loading buffer Ethidium bromide Transilluminator geldoc Voltage: 80v Time: 1.5 h 43 samples Urease + 45 youngest patient was 17 years and oldest patient was 92 years The predominant admitted patients age was between 30 50 Age of Patients 46 HISTORY OF ANTI H. PYLORI TREATMENT 47 BLOOD GROUP OABAB Percent 48 symptomspercent 1 5 years13 unclear22 duration between the symptoms onset and visiting physician 49 % isolates were possitive for prescence of integrons( class1, class2 and class3) Result for PCR of integrase gene 51 A. The level of antibiotic resistance among isolates from H. pylori has steadily increased and has become a major global health problem. In only study of argentina studied The presence of class 2 integrase in H.pylori was 37.5 % In H.pylori isolates selearcted for this study integrons occurred frequently(9.8%). 53 Increased Prevalence of Class I Integrons in enterobacteriaciae (Escherichia coli, Klebsiella Species, and Enterobacter) Species Isolates over a 7-Year Period in a German University Hospital from 4.7% in 1993 to 9.7% in 1996 and finally to 17.4% in 1999 ( Franz-Josef Schmitz an et at in Germany ) prevalence of integron-mediated antibiotic resistance in a diverse sample set of Salmonella enterica isolated from animals (30.8%) of isolates contained class 1 integron ( 2005-Dr Alan P. Johnson in USA( Class I integrons were detected in 40.8% of Pseudomonas aeruginosa strains and 52.8% of Acinetobacter baumannii strains in the Nanjing area of China Bing Gu an et at in Integrons in others bacteria Distribution integrons of E.coli in different countries in USAindiakorea iran integrons 6.39% 36%6.54%3.36% Class 1 4.9% 14%5%5.8% Class Class %50%11.54%8.44% 56 57 58 59 60 61