Click here to load reader
Upload
doandiep
View
212
Download
0
Embed Size (px)
Citation preview
Supplementary Figure legends
Supplementary Figure 1 miR-29c-5p suppresses GBC cell proliferation and
migration in vitro by inducing EMT. (A) A wound-healing assay was conducted
with the indicated cells, and images were taken at 48 h. (B) DNA replication of NOZ
cells infected with pre-miR-29c or anti-miR-29c-5p compared with control cells and
determined with an EdU incorporation assay. (C) Representative images of penetrated
cells were analyzed using Transwell assays with or without Matrigel (*P<0.05,
**P<0.01). (D) Relative expression of miR-29c-3p or 5p was detected by quantitative
PCR in the indicated cells. Expression was normalized against an endogenous control
U6 level (*P<0.05, ***P<0.001). (E-F) The protein expression of E-cadherin,
vimentin and β-catenin in the indicated cells was examined by western blotting and
ICC analyses.
Supplementary Figure 2 MiR-29c-5p enhances cell apoptosis by inhibiting the
MAPK/ERK signaling pathway. (A) Western blot analysis of the expression of
MAPK/ERK pathway-associated downstream factors in the indicated cells. (B)
Protein expression levels of phospho-Chk1 (S345), phospho-Chk2 (T68), phospho-Rb
(S780) and Cyclin D in the indicated NOZ cells were examined by western blotting.
(C) MEK phosphorylation is significantly inhibited in NOZ cells treated with 20 μM
U0126 (MEK1/2 inhibitor).
Supplementary Figure 3 Frequent upregulation of CPEB4 in GBC. (A) qRT-PCR
1
analysis of CPEB4 mRNA levels in transfected GBC cells. (B) CPEB4 mRNA
expression in 40 paired GBC and adjacent non-tumor tissues. (C) Representative
immunestained images of CPEB4 in GBC and cholelithiasis samples. The high
expression of CPEB4 is more frequently found in GBC with lymph node metastasis
(LN+) than in gallbladder cancer without lymph node metastasis (LN-). Scale bar, 100
μm. (D) Forest plots showing the hazard ratio (HR) of OS and DFS for high-risk GBC
patients (*P<0.05; 95% CI, 95% confidence interval). (E) DFS of patients with
positive or negative CPEB4 expression. (F) Kaplan-Meier curves of DFS for miR-
29c-5p/CPEB4 loss/gain in GBC patients. P values were generated from all groups
together.
Supplementary Figure 4 CPEB4 plays an oncogenic role in GBC cells. (A-E)
RNAi knockdown of CPEB4 in GBC-SD cells decreased cell proliferation (A),
colony formation (B), Transwell cell migration (D), and xenograft tumor growth in
nude mice (E). (F-J) Ectopic expression of CPEB4 in NOZ cells promoted cell
proliferation (F), colony formation (G), Transwell cell migration (I), and xenograft
tumor growth in nude mice (J). The MAPK/ERK pathway was regulated by
knockdown or overexpression of CPEB4 (C and H; *P<0.05, **P<0.01, and
***P<0.001).
Supplementary Figure 5 miR-29c-5p is required for TGF-β-mediated EMT. (A)
Representative figures and data are from a Transwell assay, in which the indicated
2
cells were treated with 10 ng/mL of TGF-β for 24 or 48 h. Scale bar, 100 μm. (B) The
number of invaded cells was calculated and was depicted in the bar chart (**P<0.01,
and ***P<0.001). (C) NOZ cells were treated with TGF-β (10 ng/ml) alone, TGF-β
plus pre-miR-NC, or TGF-β plus pre-miR-29c for 48 h, and migration assays of the
indicated cells were then conducted (*P<0.05, **P<0.01, and ***P<0.001). (D)
Western blot for E-cadherin, vimentin and β-catenin in the indicated cells in response
to treatment with TGF-β.
3
Supplementary Tables
Supplementary Table 1. Clinicopathologic characteristics of patients
Characteristic Number of Patients
Patients 40
Sex
Male 14
Female 26
Age (years) 44-84, median=67
Tumor size (cm) 0.8-9.0, median=2.75
Histology differentiation
Well 7
Moderate 22
Poor 11
Local invasion
Tis-T2 14
T3-T4 26
Lymph node metastasis
Yes 19
No 21
TNM stage
I-II 11
III-IV 29
Time of follow-up (months) 1-36, median=8
TNM, tumor-nodes-metastasis, based on the American Joint
Committee on Cancer/International Union Against Cancer Staging
Manual (7th edition, 2009)
4
Supplementary Table 2. Univariate and multivariate analyses of clinical variables contributing to overall survival
VariableUnivariate analysis
Multivariate analysis
HR (95%CI) p HR (95%CI) p
Age (<60 vs. ≥60) 0.516 (0.174-1.532) 0.223 - -
Sex (male vs. female) 0.690 (0.301-1.581) 0.375 - -
Tumor size (cm) ( ≥3 vs. <3) 0.373 (0.134-1.039) 0.049 0.437 (0.104-1.845) 0.260
Histological differentiation (well or moderate vs. poor) 0.708 (0.378-1.326) 0.516 - -
Tumor invasion (AJCC) (Tis-T2 vs. T3-T4) 2.324 (0.861-6.272) 0.085 - -
Lymph node metastasis (yes vs. no) 3.288 (1.355-7.979) 0.006 1.320 (0.318-5.484) 0.702
TNM stage (AJCC) (I-II vs. III-IV) 1.653 (0.609-4.489) 0.317 - -
Type of surgery (curative resection vs. palliative) 0.431 (0.097-1.921) 0.255 - -
miR-29c-5p expression in tumor (low vs. high) 2.489 (1.007-6.157) 0.040 0.972 (0.185-5.113) 0.974
Bolded values indicate statistical significance, P<0.05; CI, confidence interval; HR, hazard ratio.
Supplementary Table 3. Univariate and multivariate analyses of the clinical variables contributing to disease-free survival
VariableUnivariate analysis
Multivariate analysis
HR (95% CI) p HR (95% CI) p
Age (<60 vs. ≥60) 1.153 (0.474-2.802) 0.735 - -
Sex (male vs. female) 0.594 (0.266-1.325) 0.165 - -
Tumor size (cm) ( ≥3 vs. <3) 0.568 (0.226-1.427) 0.187 - -
Histological differentiation (well or moderate vs. poor) 1.078 (0.595-1.953) 0.874 - -
Tumor invasion (AJCC) (Tis-T2 vs. T3-T4) 1.693 (0.704-4.071) 0.202 - -
Lymph node metastasis (yes vs. no) 2.373 (1.034-5.443) 0.024 1.273 (0.493-3.286) 0.618
TNM stage (AJCC) (I-II vs. III-IV) 1.139 (0.473-2.742) 0.755 - -
Type of surgery (curative resection vs. palliative) 0.736 (0.170-3.195) 0.651 - -
miR-29c-5p expression in tumor (low vs. high) 3.615 (1.417-9.223) 0.002 3.164 (1.074-9.325) 0.037
Bolded values indicate statistical significance, P<0.05; CI, confidence interval; HR, hazard ratio.
5
Supplementary Table 4. The nucleotides applied in the study
Description Name Sequence
Primers for qRT-PCR
hsa-miR-29c-3p CGGTAGCACCATTTGAAATCGGTTA
hsa-miR-29c-5p TGACCGATTTCTCCTGGTGTTC
U6 ATGGACTATCATATGCTTACCGTA
CPEB4-F CAACCCAACCCTTGACATCT
CPEB4-R ACCGTTATTAGCCGAAGCAG
GAPDH-F AGAAGGCTGGGGCTCATTTG
GADPH-R AGGGGCCATCCACAGTCTTC
shRNA for CPEB4 shRNA 5'-GACAUCUAGCGCAUCGUCUdTdT-3'
Primers for vector construction
CPEB4-F 5'-TGTCTAGATACGGGTTTGGAGTGCTAGTGC-3'
CPEB4-R 5'-TACCTAGGTCCTTTAGTTCCAGCGGAATGA-3'
p53/promoter-F 5'-GGGGTACCAGCCTTCACATGACTGATCCCTTATCCTC-3'
p53/promoter-R 5'-CCGCTCGAGGAAAACCCCAATCCCATCAACCCCT-3'
Sequences for has-miR-29c-5p
Anti-NC UCUACUCUUUCUAGGAGGUUGUGA
Anti-miR-29c-5p GAACACCAGGAGAAAUCGGUCA
pre-miR-NC
GAUCAAAGAUUCGUCGAUCCGCUCAUUCUGCCGGUUGU
UAUGCUAUUAUCAGAUUAAGCAUCACAACCUCCUAGAA
AGAGUAGAUCGAUUUUAAAACUU
pre-miR-29c
AUCUCUUACACAGGCUGACCGAUUUCUCCUGGUGUUCA
GAGUCUGUUUUUGUCUAGCACCAUUUGAAAUCGGUUAU
GAUGUAGGGGGA
agomir UGACCGAUUUCUCCUGGUGUUC
6
Supplementary Materials and Methods `
miRNA microarray analysis
Total RNA was extracted, purified using the mirVana™ miRNA Isolation Kit
(Cat#AM1560, Ambion, Austin, TX, US) according to the manufacturer’s
instructions, and analyzed for an RIN number (to inspect RNA integrity) using an
Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, US). The extracted
RNA was labeled and hybridized onto the Agilent Human MicroRNA Array (v19.0)
Analysis platform. Statistical analyses and data normalization were performed using
Gene Spring Software 11.0 (Agilent Technologies, Santa Clara, CA, US). The
miRNAs that were significantly differentially expressed were identified using volcano
plot filtering. The thresholds we used to screen for upregulated or downregulated
miRNAs were a fold change ≥ 2 and a p-value ≤ 0.05. To visualize differentially
expressed miRNAs, a heat map was generated with TreeView
(http://jtreeview.sourceforge.net).
The gene expression profiles of NOZ cells with or without miR-29c overexpression
were determined using the Agilent Whole Human Genome Microarray (4×44K)
according to the manufacturer's instructions.
Real-time quantitative reverse-transcription PCR
To validate the expression of specific transcripts, total RNA from tumors and cell
lines was isolated with TRIzol (Invitrogen) and converted into cDNA with the
PrimeScriptTM RT Master Mix Kit (Takara, Dalian, China). Real-time PCR was
performed with the StepOne™ Real-Time PCR System (Applied Biosystems, Foster
7
City, USA) using SYBR® Green (Takara, Dalian, China). GAPDH served as the
normalization control. For miRNA quantification, cDNA was synthesized from total
RNA with the Mir-X miRNA First-Strand Synthesis Kit (Clontech Laboratories, Inc)
and was quantified via qPCR using the Mir-X miRNA qRT-PCR SYBR Kit (Clontech
Laboratories, Inc). The amplification of U6 was used for the normalization. The
relative expression levels of RNAs were calculated using the comparative Ct method.
The primers used in all the qRT-PCR experiments are listed in Supplementary Table 4.
Chemical reagents
The MEK1/2 inhibitor (U0126) was purchased from Selleck Chemicals (Munich,
Germany). Human recombinant TGF-β1 was obtained from Sigma (St. Louis, MO).
Stock solutions were prepared in DMSO according to the manufacturer’s instructions.
In vitro tumorigenesis assays
Cell growth was determined with CCK8 (Dojindo) at 1, 2, 3, 4 and 5 days following
transfection of GBC-SD and NOZ cells. Anchorage-independent growth was assessed
by a colony-formation assay. The treated cells were plated into a six-well culture plate
(800 cells/well) and cultured for approximately 14 days. Next, the colonies were fixed
in 4% paraformaldehyde and stained with 0.1% crystal violet (Sigma, St. Louis, MO).
The total number of colonies (>50 cells/colony) was counted.
Edu staining for microscopic analysis: EdU retention assays were performed to
examine the effect of miR-29c-5p on DNA replication. Dissociated cells were
exposed to 25 μM 5-ethynyl-2’-deoxyuridine (EdU, RiboBio, Guangzhou, China) for
2 h at 37°C, and then the cells were fixed in 4% paraformaldehyde. After
8
permeabilization with 0.5% Triton X-100, the cells were incubated in 1× Apollo
reaction cocktail (RiboBio) for 30 min. Subsequently, the cellular DNA contents were
stained with Hoechst 33342 for 30 min and visualized under a fluorescence
microscope. The experiments were performed in triplicate.
Cell cycle analysis
The cells were treated with miRNAs for 48 h before being collected and washed twice
with phosphate-buffered saline (PBS). After fixation in ice-cold 70% ethanol for 12 h,
the samples were washed twice with PBS and then incubated with 10 mg/mL of
RNase and 1 mg/mL of propidium iodide (Sigma-Aldrich) for 30 min in the dark.
Finally, the samples were evaluated by flow cytometry, and the data were analyzed
using the CellQuest acquisition software (BD Biosciences).
Xenograft models in nude mice
Nude nu/nu mice that were 4–6 weeks old were purchased from the Shanghai
Laboratory Animal Center of the Chinese Academy of Sciences (Shanghai, China).
NOZ cells were first treated with miR-29c-5p agomir (200 nM) for 3 days, with the
NC agomir serving as a negative control. Then, to investigate the effects of miR-29c
and CPEB4 on tumor growth in vivo, viable cells (1×105 cells in 100 μL of PBS) were
subcutaneously injected into 4 groups of 4 week-old nude mice (4 mice/group). The
tumor size was measured with a caliper every 5 days. The tumor volume was
calculated using the following formula: tumor volume = 4π/3 × (width/2)2 ×
(length/2), where the width and length were the shortest and longest dimensions of the
tumor, respectively. Two weeks after tumor cell inoculation, the 2 groups of mice
9
were treated with the miR-29c-5p agomir (5 nmol each) or the NC agomir (5 nmol
each) via multiple intratumoral injections twice per week for 2 weeks. After 4 weeks,
the mice were sacrificed, and the tumors were removed and examined by IHC. A tail
vein-injection model was used for the lung colonization assays. Four mice from each
group were sacrificed at 4 or 6 weeks after injection to monitor for the appearance of
macrometastases. After 8 weeks of incubation, the two groups of mice were
sacrificed, and the mouse lungs were harvested. Serial sections of lung specimens
were utilized for HE staining to confirm the presence of metastases. The number of
lung tumour nests in each group was counted under a low power field and is presented
as the mean±s.d., *P<0.05.
Western blot , Immunofluorescence staining and Immunohistochemical staining
Western blot: Cell lysates were analyzed by western blot using antibodies for
phosphor-Chk1 (S345, Abcam), phosphor-Chk2 (T68, Abcam), phosphor-Rb (S780,
Abcam), Cyclin D1 (CST), E-cadherin (Abcam), vimentin (Abcam), β-catenin
(Abcam), β-actin (Proteintech), phospho-MEK1/2 (Ser217, Santa Cruz), MEK1/2
(Abcam), ERK (Proteintech), phospho-ERK (Proteintech), AKT (Abcam), phospho-
AKT (Ser473, Abcam), p53(Abcam), Bax (Abcam), BCL2 (Cell Signaling), cleaved
caspase-9 (CST), cleaved caspase-3 (CST), PARP (CST), cleaved PARP (CST), and
CPEB4 (Abcam). Blots were assessed using an Amersham Imager 600 (GE) as
previously described1.
Immunofluorescence analysis: Cells were seeded into 6-well plates and cultured
overnight. Next, the cells were fixed in 3.7% paraformaldehyde and permeabilized in
10
a solution of 0.1% BSA and 0.1% Triton X-100 at room temperature. After the
blocking solution was removed, the cells were incubated with primary antibodies
against E-cadherin, vimentin, or β-catenin (Abcam) for 60 min at 37°C and then
washed twice with 0.1% BSA. After 60 min of incubation at 37°C with Cy3 and FITC
goat anti-rabbit IgG (Beyotime, Shanghai, China) and subsequent washing with 0.1%
BSA, the cells were mounted with DAPI-containing mounting medium (Vector
Laboratories, Burlingame, CA, USA) and visualized under a fluorescence microscope
(Leica, Germany). The experiments were performed in triplicate.
Immunohistochemical staining: Immunohistochemical staining of patient tissue
sections was performed as previously described1. Tissues were fixed in 4%
paraformaldehyde and cut from paraffin block to 5 mm thickness. After dewaxing
with xylene and rehydration with a graded series of ethanol, slides were heated in the
autoclave for three minutes using citrate sodium buffer (PH 6.0) and incubated with
the primary antibodies (anti-E-cadherin (Abcam), anti-vimentin (Abcam), anti-p-
MEK1/2 (Ser217, Santa Cruz), anti-MEK1/2 (Abcam) and anti-Ki67(abcam)). Images
were captured with a fluorescence microscope.
In vitro migration and invasion assays
For the in vitro wound-healing assay, cells were seeded in 6-well plates, grown to
90% confluence, and then serum-starved for 24 h. A linear wound was created in the
confluent monolayer using a 200-μL pipette tip, and wounds were observed and
photographed at 0 and 48 h. The wound size was measured perpendicular to the
wound at five randomly selected sites. To measure cell migration and invasion, GBC-
11
SD (3 × 104) and NOZ (4 × 104) cells in 0.5 mL of serum-free medium were seeded
into the upper chamber, containing an uncoated (Corning 3422, USA) or Matrigel-
coated insert (BD Biosciences 354480, USA). The bottom sides of the Transwells
were filled with DMEM containing 15% FBS. After 24 h, the cells located on the
upper surface were removed using a cotton swab, and the cells on the lower surface
were fixed in 4% polyoxymethylene and stained with crystal violet. The migrated or
invaded cells were counted in five randomly chosen fields in each well. Imaging and
cell counting was performed at 10× magnification with a fluorescence microscope.
The experiments were performed in triplicate.
Flow cytometric analysis of cellular apoptosis
The extent of apoptosis was measured with an Annexin V-APC Apoptosis Detection
kit (BD Biosciences) according to the manufacturer’s instructions. The treated cells
were collected, washed twice with cold PBS, gently resuspended in 100 μL of 1×
binding buffer containing 2.5 μL of APC-conjugated Annexin-V and 1 μL of 100
μg/mL PI, and then incubated at room temperature in the dark for 15 min. The stained
cells were analyzed by flow cytometry (BD Biosciences). The experiments were
performed in triplicate.
Detection of ΔΨm variation with fluorescence microscopy
The 5,50,6,60-tetrachloro-1,10,3,30-tetraethylbenzimidazolcarbocyanine iodide (JC-
1) probe was used to analyze the ΔΨm by fluorescence microscopy. After treatment
with miRNA for 48 h, 5 µL of the JC-1 staining solution (Beyotime, China) per mL of
culture medium was added to each well, and the samples were then incubated in a 5%
12
CO2 incubator at 37°C for 20 min while being protected from light. After two washes
with buffer solution, the GBC-SD and NOZ cells were analyzed with a fluorescence
microscope (Leica, Germany).
Luciferase reporter assay
For CPEB4 3’UTR luciferase assays, Cells (1×104) were cotransfected with 500 ng of
the CPEB4 3’UTR or mutated CPEB4 3’UTR and 20 nM pre-miRNAs. Each sample
was cotransfected with 50 ng of the pRL-TK plasmid, expressing Renilla luciferase,
to monitor the transfection efficiency. For the p53 promoter luciferase reporter assay,
cells were co-transfected with 500ng of the p53 promoter luciferase reporter plasmid,
20nM pre-miRNAs and internal control of SV40 promoter-driven Renilla luciferase
vector (pSV40-RL). Luciferase and renilla signals were measured 24 h after
transfection using the Dual Luciferase Reporter Assay Kit (Promega) according to a
protocol provided by the manufacturer. The relative luciferase activities were
calculated by comparing the Firefly/Renilla luciferase ratio. Three independent
experiments were performed, and the data are presented as mean±s.d..
Plasmids, RNA oligonucleotides, and target cell infection
P53 promoter luciferase assay. The previously reported 2 promoter region for p53 (-
2000/+200) was amplified by PCR from NOZ cells using the primer listed in
Supplementary Table S4 and subcloned into the basic vector pGL3 (Promega) via the
Kpnl / Xhol sites.
CPEB4 3’UTR luciferase reporter assay. The 380 bp sequence of the CPEB4 3’-UTR
containing the predicted has-miR-29c binding sites and its mutant of the has-miR-29c
13
binding sites were synthesized by Shanghai Generay Biotech Co., Ltd. The DNA
fragments were digested with Xbal and BamHI. The resulting fragments were
subcloned into the Xbal and BamHI sites of the pGL3 luciferase reporter plasmid
(Promega, Madison, WI, USA).
MiRNAs and siRNA. MiR-29c precursor (pre-miR-29c), anti-miR-29c-5p, has-miR-
29c-5p agomir, small interfering RNA (siRNA), and their cognate control RNAs were
purchased from Biotend (Shanghai, China). The sequences are listed in
Supplementary Table 4. For transfection of RNA oligonucleotides, 50 nmol/L of
siRNA or anti-miR-29c-5p and 10 nmol/L of pre-miR-29c were used.
Lentivirus packaging and transduction. The human CPEB4 gene was PCR-amplified
from genomic DNA using the primer listed in Supplementary Table 4 and cloned into
the pMSCV-puro retroviral vector. Stable cell lines expressing CPEB4 were generated
by retroviral infection of NOZ cells and were selected with 0.5 µg/ml of puromycin
for 10 days. For the in vivo assay, shCPEB4 and the negative control were synthesized
and inserted into the pFH1UGW lentiviral core vector containing a cytomegalovirus-
driven enhanced green fluorescent protein (EGFP) reporter gene. Recombinant
lentiviruses expressing CPEB4-siRNA or the negative control were produced by
Genechem (Shanghai, China). The expression level of CPBE4 was determined by
qRT-PCR and western blot assays. The cells were transfected using Lipofectamine
2000 (Invitrogen) according to the manufacturer’s instructions.
Statistical analysis
14
All the statistical analyses were performed using SPSS 19.0 software. The levels of
miR-29c-5p and CPEB4 mRNA in the tumor and paired nontumor tissues were
compared using paired Student’s t-tests. The independent Student’s t-test was used to
compare the means of two groups. Pearson’s χ2 test was used to analyze the
association between miR-29c-5p expression and the clinicopathologic parameters.
Kaplan-Meier plots and log-rank tests were used for the survival analyses. The
univariate and multivariate Cox proportional hazard regression models were used to
analyze independent prognostic factors. Each experimental value was expressed as the
mean ± standard deviation (SD). The differences between groups were considered
significant at P<0.05. All the data points represent the mean of triplicate experiments.
References1. Shu YJ, Weng H, Ye YY, Hu YP, Bao RF, Cao Y, et al. SPOCK1 as a potential cancer prognostic
marker promotes the proliferation and metastasis of gallbladder cancer cells by activating the PI3K/AKT pathway. Mol Cancer 2015, 14(1): 12.
2. Sun X, Shimizu H, Yamamoto K. Identification of a novel p53 promoter element involved in genotoxic stress-inducible p53 gene expression. Mol Cell Biol 1995, 15(8): 4489-4496.
15