View
186
Download
0
Category
Tags:
Preview:
DESCRIPTION
Talk given at iEvoBio 2013 on phylogenetic metadata
Citation preview
Using phylogenetic metadata in large-scale phylogenetic synthesis
Karen Cranston @kcranstnElliot Hauser @hauspoor
Hilmar Lapp @hlapp and @opentreeoflife
thermore, a paraphyletic relationship of phorids and syrphidswould support the hypothesis that their shared special mode ofextraembryonic development (dorsal amnion closure) (26)evolved in the stem lineage of Cyclorrhapha and preceded theorigin of the schizophoran amnioserosa.
To test this hypothesis, we used a relatively recent phylogenomicmarker: small, noncoding, regulatory micro-RNAs (miRNAs).miRNAs exhibit a striking phylogenetic pattern of conservationacross the metazoan tree of life, suggesting the accumulation andmaintenance ofmiRNA families throughout organismal evolution
Fig. 1. Combined molecular phylogenetic tree for Diptera. Partitioned ML analysis of combined taxon sets of tier 1 and tier 2 FLYTREE data samples (!lnL =344155.6169) calculated in RAxML. Circles indicate bootstrap support >80% (black/bp = 95–100%, gray/bp = 88–94%, white/bp = 80–88%). Nodes with im-proved bootstrap values resulting from postanalysis pruning of unstable taxa are marked by stars (black/bp = 95–100%, gray/bp = 88–94%, white/bp = 80–88%). Colored squares on terminal branches indicate the presence, in at least one species of a family, of ecological traits as shown to lower left. The numberof origins of each trait was estimated with reference to the phylogeny, the distribution of each trait among genera within a family, and the known biology ofthe organisms.
Wiegmann et al. PNAS Early Edition | 3 of 6
EVOLU
TION
ACGTTCGATACGTTCGATACGTTCGATACGTTCGAT
⋮CC-BY-SA: http://www.flickr.com/photos/drewlite/
Photo by DAVID ILIFF. License: CC-BY-SA 3.0
?
Wiegmann et al, 2011, PNAS
thermore, a paraphyletic relationship of phorids and syrphidswould support the hypothesis that their shared special mode ofextraembryonic development (dorsal amnion closure) (26)evolved in the stem lineage of Cyclorrhapha and preceded theorigin of the schizophoran amnioserosa.
To test this hypothesis, we used a relatively recent phylogenomicmarker: small, noncoding, regulatory micro-RNAs (miRNAs).miRNAs exhibit a striking phylogenetic pattern of conservationacross the metazoan tree of life, suggesting the accumulation andmaintenance ofmiRNA families throughout organismal evolution
Fig. 1. Combined molecular phylogenetic tree for Diptera. Partitioned ML analysis of combined taxon sets of tier 1 and tier 2 FLYTREE data samples (!lnL =344155.6169) calculated in RAxML. Circles indicate bootstrap support >80% (black/bp = 95–100%, gray/bp = 88–94%, white/bp = 80–88%). Nodes with im-proved bootstrap values resulting from postanalysis pruning of unstable taxa are marked by stars (black/bp = 95–100%, gray/bp = 88–94%, white/bp = 80–88%). Colored squares on terminal branches indicate the presence, in at least one species of a family, of ecological traits as shown to lower left. The numberof origins of each trait was estimated with reference to the phylogeny, the distribution of each trait among genera within a family, and the known biology ofthe organisms.
Wiegmann et al. PNAS Early Edition | 3 of 6
EVOLU
TION
Wiegmann et al, 2011, PNAS
=
?
thermore, a paraphyletic relationship of phorids and syrphidswould support the hypothesis that their shared special mode ofextraembryonic development (dorsal amnion closure) (26)evolved in the stem lineage of Cyclorrhapha and preceded theorigin of the schizophoran amnioserosa.
To test this hypothesis, we used a relatively recent phylogenomicmarker: small, noncoding, regulatory micro-RNAs (miRNAs).miRNAs exhibit a striking phylogenetic pattern of conservationacross the metazoan tree of life, suggesting the accumulation andmaintenance ofmiRNA families throughout organismal evolution
Fig. 1. Combined molecular phylogenetic tree for Diptera. Partitioned ML analysis of combined taxon sets of tier 1 and tier 2 FLYTREE data samples (!lnL =344155.6169) calculated in RAxML. Circles indicate bootstrap support >80% (black/bp = 95–100%, gray/bp = 88–94%, white/bp = 80–88%). Nodes with im-proved bootstrap values resulting from postanalysis pruning of unstable taxa are marked by stars (black/bp = 95–100%, gray/bp = 88–94%, white/bp = 80–88%). Colored squares on terminal branches indicate the presence, in at least one species of a family, of ecological traits as shown to lower left. The numberof origins of each trait was estimated with reference to the phylogeny, the distribution of each trait among genera within a family, and the known biology ofthe organisms.
Wiegmann et al. PNAS Early Edition | 3 of 6
EVOLU
TION
Wiegmann et al, 2011, PNAS
=
+DOI�RI�DOO�PHWDGDWD�W\SHV�DUH�FULWLFDOO\�LPSRUWDQW�WR�WZR��VXEILHOGV
6RXUFH��&UDQVWRQ�0,$3$�VXUYH\��������XQSXEOLVKHG�
7KH�PDMRULW\�RI�PHWDGDWD�W\SHV�DUH�HDV\�WR�SURGXFH�IRU�DOO�VXEILHOGV
6RXUFH��&UDQVWRQ�0,$3$�VXUYH\��������XQSXEOLVKHG�
Goal: synthesize a draft tree of life from published
phylogenies
one tree
two trees
Open Tree of Life
resolving the hairball of life...
...with phylogenetic metadata!
Recommended